[med-svn] r208 - trunk/packages/primer3/branches/upstream/current

Charles Plessy charles-guest at alioth.debian.org
Sat Feb 17 05:15:24 CET 2007


Author: charles-guest
Date: 2007-02-17 05:15:24 +0100 (Sat, 17 Feb 2007)
New Revision: 208

Added:
   trunk/packages/primer3/branches/upstream/current/COPYING.txt
   trunk/packages/primer3/branches/upstream/current/README.txt
Removed:
   trunk/packages/primer3/branches/upstream/current/Copyright.txt
   trunk/packages/primer3/branches/upstream/current/README.primer3_1.0.1.txt
Log:
To prepare to load /tmp/tmp.0iQF5i/primer3-1.1.0~beta into
trunk/packages/primer3/branches/upstream/current, perform 2 renames.

* trunk/packages/primer3/branches/upstream/current/README.txt: Renamed
  from
  trunk/packages/primer3/branches/upstream/current/README.primer3_1.0.1
  .txt.
* trunk/packages/primer3/branches/upstream/current/COPYING.txt: Renamed
  from trunk/packages/primer3/branches/upstream/current/Copyright.txt.


Copied: trunk/packages/primer3/branches/upstream/current/COPYING.txt (from rev 207, trunk/packages/primer3/branches/upstream/current/Copyright.txt)

Deleted: trunk/packages/primer3/branches/upstream/current/Copyright.txt
===================================================================
--- trunk/packages/primer3/branches/upstream/current/Copyright.txt	2007-02-14 14:30:03 UTC (rev 207)
+++ trunk/packages/primer3/branches/upstream/current/Copyright.txt	2007-02-17 04:15:24 UTC (rev 208)
@@ -1,31 +0,0 @@
-Copyright (c) 1996,1997,1998,1999,2000,2001,2004,2006
-Whitehead Institute for Biomedical Research, Steve Rozen
-(http://jura.wi.mit.edu/rozen), and Helen Skaletsky
-All rights reserved.
-
-Redistribution and use in source and binary forms, with or without
-modification, are permitted provided that the following conditions are
-met:
-
-   * Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
-   * Redistributions in binary form must reproduce the above
-copyright notice, this list of conditions and the following disclaimer
-in the documentation and/or other materials provided with the
-distribution.
-   * Neither the names of the copyright holders nor contributors may
-be used to endorse or promote products derived from this software
-without specific prior written permission.
-
-THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
-"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
-LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
-A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT
-OWNERS OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,
-SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT
-LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE,
-DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY
-THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
-(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
-OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
-

Deleted: trunk/packages/primer3/branches/upstream/current/README.primer3_1.0.1.txt
===================================================================
--- trunk/packages/primer3/branches/upstream/current/README.primer3_1.0.1.txt	2007-02-14 14:30:03 UTC (rev 207)
+++ trunk/packages/primer3/branches/upstream/current/README.primer3_1.0.1.txt	2007-02-17 04:15:24 UTC (rev 208)
@@ -1,1463 +0,0 @@
-primer3 release 1.0.1  (This version identical to 1.0b except version number.)
-
-Copyright (c) 1996,1997,1998,1999,2000,2001,2004,2006
-Whitehead Institute for Biomedical Research, Steve Rozen
-(http://jura.wi.mit.edu/rozen), and Helen Skaletsky
-All rights reserved.
-
-Redistribution and use in source and binary forms, with or without
-modification, are permitted provided that the following conditions are
-met:
-
-   * Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
-   * Redistributions in binary form must reproduce the above
-copyright notice, this list of conditions and the following disclaimer
-in the documentation and/or other materials provided with the
-distribution.
-   * Neither the names of the copyright holders nor contributors may
-be used to endorse or promote products derived from this software
-without specific prior written permission.
-
-THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
-"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
-LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
-A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT
-OWNERS OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,
-SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT
-LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE,
-DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY
-THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
-(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
-OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
-
-
-INTRODUCTION
-------------
-Primer3 picks primers for PCR reactions, considering as criteria:
-
-o oligonucleotide melting temperature, size, GC content,
-  and primer-dimer possibilities,
-
-o PCR product size,
-
-o positional constraints within the source sequence, and
-
-o miscellaneous other constraints.
-
-All of these criteria are user-specifiable as constraints, and
-some are specifiable as terms in an objective function that
-characterizes an optimal primer pair.
-
-Whitehead Institute for Biomedical Research provides a web-based
-front end to Primer3 at
-http://fokker.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi
-
-CITING PRIMER3
---------------
-We request but do not require that use of this software be cited in
-publications as
-
-Steve Rozen and Helen J. Skaletsky (2000)
-Primer3 on the WWW for general users and for biologist programmers.
-In: Krawetz S, Misener S (eds)
-Bioinformatics Methods and Protocols: Methods in Molecular Biology.
-Humana Press, Totowa, NJ, pp 365-386
-
-Source code available at http://fokker.wi.mit.edu/primer3/.
-The paper above is available at
-http://jura.wi.mit.edu/rozen/papers/rozen-and-skaletsky-2000-primer3.pdf
-
-INSTALLATION INSTRUCTIONS
--------------------------
-Unzip and untar the distribution.
-
-DO NOT do this on a PC -- primer3_core will not compile if pc
-newlines get inserted into the source files.  Instead, move the
-distribution (primer3_<release>.tar.gz) to Unix, and then
-
-$ unzip primer3_1.0.1.tar.gz
-$ tar xvf primer3_1.0.1.tar
-$ cd primer3_1.0.1/src
-
-If you do not use gcc, modify the makefile to
-  use your (ANSI) C compiler and appropriate 
-  compile and link flags.
-
-$ make all
-# Warnings about pr_release being unused are harmless.
-# You should have created executables primer3_core, ntdpal,
-#  olgotm, and long_seq_tm_test
-
-$ cd ../test
-$ perl -w p3test.pl
-$ perl -w dpal_test.pl
-# You should not see 'FAILED' during the tests.
-
-If your perl command is not called perl (for example, if it is
-called perl5) you will have to modify the internals of the test
-scripts).
-
-ntdpal (NucleoTide Dynamic Programming ALignment) is a
-stand-alone program that provides Primer3's alignment
-functionality (local, a.k.a. Smith-Waterman, global,
-a.k.a. Needleman-Wunsch, plus "half global").  It is provided
-strictly as is; for further documentation please see the code.
-
-SYSTEM REQUIREMENTS
--------------------
-Primer3 has been successfully installed and tested on the
-following systems
-
-     o Sparc running SunOS 4.1 (gcc 2.7.0)
-     o Alpha running DEC Unix 3.2 (gcc 2.7.0 and DEC cc)
-     o Pentium running Linux 1.2 (Red Hat) (gcc 2.7.0)
-
-Primer3 will likely compile and run on other POSIX architectures with
-ANSI C compilers.
-
-
-INPUT AND OUTPUT CONVENTIONS
-----------------------------
-
-By default, Primer3 accepts input and produces output in
-Boulder-io format, a pre-XML text-based input/output format
-for program-to-program data interchange format.  When run
-with the -format_output command-line flag, Primer3 prints a
-more user-oriented report for each sequence.  Additional
-command-line flags include -2x_compat (which causes Primer3
-to print its output using Primer v2 compatible tag names),
-and -strict_tags (both discussed below).  Primer3 exits with
-0 status if it operates correctly.  See EXIT STATUS CODES
-below for additional information.
-
-The syntax of the version of Boulder-io recognized by Primer3 is
-as follows:
-
-  o Input consists of a sequence of RECORDs.
-
-  o A RECORD consists of a sequence of (TAG,VALUE) pairs, each terminated
-    by a newline character (\n). A RECORD is terminated by  '='
-    appearing by itself on a line.
-
-  o A (TAG,VALUE) pair has the following requirements:
-
-        o the TAG must be immediately (without spaces) 
-          followed by '='.
-	o the pair must be terminated by a newline character.
-
-An example of a legal (TAG,VALUE) pair is
-
-PRIMER_SEQUENCE_ID=my_marker
-
-and an example of a BOULDER-IO record is
-
-PRIMER_SEQUENCE_ID=test1
-SEQUENCE=GACTGATCGATGCTAGCTACGATCGATCGATGCATGCTAGCTAGCTAGCTGCTAGC
-=
-
-Many records can be sent, one after another. Below is an example
-of three different records which might be passed through a
-boulder-io stream:
-
-PRIMER_SEQUENCE_ID=test1
-SEQUENCE=GACTGATCGATGCTAGCTACGATCGATCGATGCATGCTAGCTAGCTAGCTGCTAGC
-=
-PRIMER_SEQUENCE_ID=test2
-SEQUENCE=CATCATCATCATCGATGCTAGCATCNNACGTACGANCANATGCATCGATCGT
-=
-PRIMER_SEQUENCE_ID=test3
-SEQUENCE=NACGTAGCTAGCATGCACNACTCGACNACGATGCACNACAGCTGCATCGATGC
-=
-
-Primer3 reads boulder-io on stdin and echos its input and returns
-results in boulder-io format on stdout.  Primer3 indicates many
-user-correctable errors by a value in the PRIMER_ERROR tag (see
-below) and indicates other errors, including system configuration
-errors, resource errors (such out-of-memory errors), and detected
-programming errors by a message on stderr and a non-zero exit
-status.
-
-Below is the list of input tags that Primer3 recognizes.
-Primer3 echos and ignores any tags it does not recognize, unless
-the -strict_tags flag is set on the command line, in which case
-Primer3 prints an error in the PRIMER_ERROR output tag (see
-below), and prints additional information on stdout; this option
-can be useful for debugging systems that incorporate primer.
-
-Except for tags with the type "interval list" each tag is allowed
-only ONCE in any given input record.  This restriction is not
-systematically checked in this beta release: use care.
-
-There are 2 major classes of input tags.  "Sequence" input tags
-describe a particular input sequence to Primer3, and are reset
-after every boulder record.  "Global" input tags describe the
-general parameters that Primer3 should use in its searches, and
-the values of these tags persist between input boulder records
-until or unless they are explicitly reset.  Errors in "Sequence"
-input tags invalidate the current record, but Primer3 will
-continue to process additional records.  Errors in "Global" input
-tags are fatal because they invalidate the basic conditions under
-which primers are being picked.
-
-"Sequence" Input Tags
----------------------
-
-PRIMER_SEQUENCE_ID (string, optional)
-
-(MARKER_NAME is a deprecated synonym maintained for v2
-compatibility.)
-
-An identifier that is reproduced in the output to enable users to
-identify the source of the chosen primers.
-
-This tag must be present if PRIMER_FILE_FLAG is non-zero.
-
-SEQUENCE (nucleotide sequence, REQUIRED)
-
-The sequence from which to choose primers.  The sequence
-must be presented 5' -> 3' (see the discussion of the
-PRIMER_SELF_END argument).  The bases may be upper or lower case.
-No newlines should be inserted into the sequence, because the
-Boulder-IO parser will assume that a line ends at a newline.
-
-INCLUDED_REGION (interval, optional)
-
-A sub-region of the given sequence in which to pick primers.  For
-example, often the first dozen or so bases of a sequence are
-vector, and should be excluded from consideration. The value for
-this parameter has the form
-
-<start>,<length>
-
-where <start> is the index of the first base to consider,
-and <length> is the number of subsequent bases in the
-primer-picking region.
-
-TARGET (interval list, default empty)
-
-If one or more Targets is specified then a legal primer pair must
-flank at least one of them.  A Target might be a simple sequence
-repeat site (for example a CA repeat) or a single-base-pair
-polymorphism.  The value should be a space-separated list of
-
-<start>,<length>
-
-pairs where <start> is the index of the first base of a
-Target, and <length> is its length.
-
-For backward compatibility Primer3 accepts (but ignores)
-a trailing ,<description> for each element of this argument.
-
-EXCLUDED_REGION (interval list, default empty)
-
-Primer oligos may not overlap any region specified in this tag.
-The associated value must be a space-separated list of
-
-<start>,<length>
-
-pairs where <start> is the index of the first base of
-the excluded region, and <length> is its length.  This tag is
-useful for tasks such as excluding regions of low sequence
-quality or for excluding regions containing repetitive elements
-such as ALUs or LINEs.
-
-PRIMER_COMMENT (string, optional)
-
-The value of this tag is ignored.
-
-COMMENT (string, optional)
-
-Deprecated synonym for PRIMER_COMMENT.
-
-PRIMER_SEQUENCE_QUALITY (quality list, default empty)
-
-A list of space separated integers. There must be exactly
-one integer for each base in SEQUENCE if this argument is
-non-empty.  For example, for the sequence ANNTTCA...
-PRIMER_SEQUENCE_QUALITY might be 45 10 0 50 30 34 50 67 ....
-High numbers indicate high confidence in the base called at
-that position and low numbers indicate low confidence in the
-base call at that position.  This parameter is only relevant
-if you are using a base calling program that provides
-quality information (for example phred).
-
-PRIMER_LEFT_INPUT (nucleotide sequence, default empty)
-
-The sequence of a left primer to check and around which to design
-right primers and optional internal oligos.  Must be a substring
-of SEQUENCE.
-
-PRIMER_RIGHT_INPUT (nucleotide sequence, default empty)
-
-The sequence of a right primer to check and around which to
-design left primers and optional internal oligos.  Must be a
-substring of the reverse strand of SEQUENCE.
-
-PRIMER_START_CODON_POSITION (int, default -1000000)
-
-This parameter should be considered EXPERIMENTAL at this point.
-Please check the output carefully; some erroneous inputs might
-cause an error in Primer3.
-
-Index of the first base of a start codon.  This parameter allows
-Primer3 to select primer pairs to create in-frame amplicons
-e.g. to create a template for a fusion protein.  Primer3 will
-attempt to select an in-frame left primer, ideally starting at or
-to the left of the start codon, or to the right if necessary.
-Negative values of this parameter are legal if the actual start
-codon is to the left of available sequence. If this parameter is
-non-negative Primer3 signals an error if the codon at the
-position specified by this parameter is not an ATG.  A value less
-than or equal to -10^6 indicates that Primer3 should ignore this
-parameter.
-
-Primer3 selects the position of the right primer by scanning
-right from the left primer for a stop codon.  Ideally the right
-primer will end at or after the stop codon.
-
-"Global" Input Tags
--------------------
-
-PRIMER_PICK_ANYWAY (boolean, default 0)
-
-If true pick a primer pair even if PRIMER_LEFT_INPUT,
-PRIMER_RIGHT_INPUT, or PRIMER_INTERNAL_OLIGO_INPUT violates
-specific constraints.
-
-PRIMER_MISPRIMING_LIBRARY (string, optional)
-
-The name of a file containing a nucleotide sequence library of
-sequences to avoid amplifying (for example repetitive sequences, or
-possibly the sequences of genes in a gene family that should
-not be amplified.)  The file must be in (a slightly restricted)
-FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp
-2444-2448 [1988]); we briefly discuss the organization of this
-file below.  If this parameter is specified then Primer3 locally
-aligns each candidate primer against each library sequence and
-rejects those primers for which the local alignment score times a
-specified weight (see below) exceeds PRIMER_MAX_MISPRIMING.
-(The maximum value of the weight is arbitrarily set to 100.0.)
-
-Each sequence entry in the FASTA-format file must begin with an
-"id line" that starts with '>'.  The contents of the id line is
-"slightly restricted" in that Primer3 parses everything after any
-optional asterisk ('*') as a floating point number to use as the
-weight mentioned above.  If the id line contains no asterisk then
-the weight defaults to 1.0.  The alignment scoring system used is
-the same as for calculating complementarity among oligos (e.g.
-PRIMER_SELF_ANY), except for the handling of IUB/IUPAC ambiguity
-codes (discussed below).  The remainder of an entry contains the
-sequence as lines following the id line up until a line starting
-with '>' or the end of the file.  Whitespace and newlines are
-ignored.  Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' 
-and IUB/IUPAC 'ambiguity' codes ('R, 'Y', 'K', 'M', 'S', 'W', 'N',
-including lower case) are retained. 
-
-WARNING: always set PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS=0
-if any sequence in the library contains strings of 'N's:
-NNNNNNNNNNNNNNNNNNNN.
-NOWWW
-There are no restrictions on line length.
-
-An empty value for this parameter indicates that no repeat
-library should be used and "turns off" the use of a
-previously specified library.
-
-Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, and
-others, 1995-1996, ftp://ncbi.nlm.nih.gov/repository/repbase)
-is an excellent source of repeat sequences and pointers to the
-literature. (The Repbase files need to be converted to Fasta
-format before they can be used by Primer3.)
-
-
-PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS (boolean, default 1)
-
-If set to 1, treat ambiguity codes as if they were consensus
-codes when matching oligos to mispriming or mishyb
-libraries. For example, if this flag is set, then a C in an
-oligo will be scored as a perfect match to an S in a library
-sequence, as will a G in the oligo. More importantly,
-though, any base in an oligo will be scored as a perfect
-match to an N in the library.  This is very bad if the
-library contains strings of Ns, as no oligo will be legal
-(and it will take a long time to find this out). So unless
-you know for sure that your library does not have runs of Ns
-(or Xs), then set this flag to 0.
-
-PRIMER_MAX_MISPRIMING (decimal,9999.99, default 12.00)
-
-The maximum allowed weighted similarity with any sequence in
-PRIMER_MISPRIMING_LIBRARY.  
-
-PRIMER_MAX_TEMPLATE_MISPRIMING (decimal,9999.99, default -1.00)
-
-The maximum allowed similarity to ectopic sites in the
-template.  A negative value means do not check.  The scoring
-system is the same as used for PRIMER_MAX_MISPRIMING, except
-that an ambiguity code in the template is never treated as a
-consensus (see PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS).
-
-PRIMER_PAIR_MAX_MISPRIMING (decimal,9999.99, default 24.00)
-
-The maximum allowed sum of similarities of a primer pair
-(one similarity for each primer) with any single sequence in
-PRIMER_MISPRIMING_LIBRARY.  
-Library sequence weights are not used in computing the sum
-of similarities.
-
-PRIMER_PAIR_MAX_TEMPLATE_MISPRIMING (decimal,9999.99, default -1.00)
-
-The maximum allowed summed similarity of both primers to
-ectopic sites in the template. A negative value means do not
-check.  The scoring system is the same as used for
-PRIMER_PAIR_MAX_MISPRIMING, except that an ambiguity code in
-the template is never treated as a consensus (see
-PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS).  Primer3 does not
-check the similarity of hybridization oligos (internal
-oligos) to locations outside of the amplicon.
-
-PRIMER_PRODUCT_MAX_TM (float, default 1000000.0)
-
-The maximum allowed melting temperature of the amplicon.  Primer3
-calculates product Tm calculated using the formula from Bolton
-and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook,
-Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL
-Press).
-
-   Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length
-
-Where [Na+] is the molar sodium concentration, (%GC) is the
-percent of Gs and Cs in the sequence, and length is the length of
-the sequence.
-
-A similar formula is used by the prime primer selection program
-in GCG (http://www.gcg.com), which instead uses 675.0 / length in
-the last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E.
-Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766
-without the mismatch and formamide terms).  The formulas here and
-in Baldino et al. assume Na+ rather than K+.  According to
-J.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227
-(1991) 50 mM K+ should be equivalent in these formulae to .2 M
-Na+.  Primer3 uses the same salt concentration value for
-calculating both the primer melting temperature and the oligo
-melting temperature.  If you are planning to use the PCR product
-for hybridization later this behavior will not give you the Tm
-under hybridization conditions.
-
-PRIMER_PRODUCT_MIN_TM (float, default -1000000.0)
-
-The minimum allowed melting temperature of the amplicon.  Please
-see the documentation on the maximum melting temperature of the
-product for details.
-
-PRIMER_EXPLAIN_FLAG (boolean, default 0)
-
-If this flag is non-0, produce PRIMER_LEFT_EXPLAIN,
-PRIMER_RIGHT_EXPLAIN, and PRIMER_INTERNAL_OLIGO_EXPLAIN output
-tags, which are intended to provide information on the number of
-oligos and primer pairs that Primer3 examined, and statistics on
-the number discarded for various reasons.  If -format_output is
-set similar information is produced in the user-oriented output.
-
-PRIMER_PRODUCT_SIZE_RANGE (size range list, default 100-300)
-
-The associated values specify the lengths of the product that the
-user wants the primers to create, and is a space separated list
-of elements of the form
-
-<x>-<y>
-
-where an <x>-<y> pair is a legal range of lengths for the
-product.  For example, if one wants PCR products to be between
-100 to 150 bases (inclusive) then one would set this parameter to
-100-150.  If one desires PCR products in either the range from
-100 to 150 bases or in the range from 200 to 250 bases then one
-would set this parameter to 100-150 200-250.
-
-Primer3 favors ranges to the left side of the parameter string.
-Primer3 will return legal primers pairs in the first range
-regardless the value of the objective function for these pairs.
-Only if there are an insufficient number of primers in the first
-range will Primer3 return primers in a subsequent range.
-
-PRIMER_PICK_INTERNAL_OLIGO (boolean, default 0)
-
-If the associated value is non-0, then Primer3 will attempt to
-pick an internal oligo (hybridization probe to detect the PCR
-product).  This tag is maintained for backward compatibility.
-Use PRIMER_TASK.
-
-PRIMER_GC_CLAMP (int, default 0)
-
-Require the specified number of consecutive Gs and Cs at the 3'
-end of both the left and right primer.  (This parameter has no
-effect on the internal oligo if one is requested.)
-
-PRIMER_OPT_SIZE (int, default 20)
-
-Optimum length (in bases) of a primer oligo. Primer3 will attempt
-to pick primers close to this length.
-
-PRIMER_DEFAULT_SIZE (int, default 20)
-
-A deprecated synonym for PRIMER_OPT_SIZE, maintained for v2
-compatibility.
-
-PRIMER_MIN_SIZE (int, default 18)
-
-Minimum acceptable length of a primer.  Must be greater than 0
-and less than or equal to PRIMER_MAX_SIZE.
-
-PRIMER_MAX_SIZE (int, default 27)
-
-Maximum acceptable length (in bases) of a primer.  Currently this
-parameter cannot be larger than 35.  This limit is governed by
-maximum oligo size for which Primer3's melting-temperature is
-valid.
-
-PRIMER_OPT_TM (float, default 60.0C)
-
-Optimum melting temperature(Celsius) for a primer oligo. Primer3
-will try to pick primers with melting temperatures are close to
-this temperature.  The oligo melting temperature formula in
-Primer3 is that given in Rychlik, Spencer and Rhoads, Nucleic
-Acids Research, 18(21): 6409-6412 and Breslauer,
-Frank, Bloeker and Marky, PNAS, 83: 3746-3750.
-Please refer to the former paper for background discussion.
-
-PRIMER_MIN_TM (float, default 57.0C)
-
-Minimum acceptable melting temperature(Celsius) for a primer
-oligo.
-
-PRIMER_MAX_TM (float, default 63.0C)
-
-Maximum acceptable melting temperature(Celsius) for a primer
-oligo.
-
-PRIMER_MAX_DIFF_TM (float, default 100.0C)
-
-Maximum acceptable (unsigned) difference between the melting
-temperatures of the left and right primers.
-
-PRIMER_MIN_GC (float, default 20.0%)
-
-Minimum allowable percentage of Gs and Cs in any primer.
-
-PRIMER_OPT_GC_PERCENT (float, default 50.0%)
-
-Optimum GC percent.  This parameter influences primer selection only if
-PRIMER_WT_GC_PERCENT_GT or PRIMER_WT_GC_PERCENT_LT are non-0.
-
-PRIMER_MAX_GC (float, default 80.0%)
-
-Maximum allowable percentage of Gs and Cs in any primer generated
-by Primer.
-
-PRIMER_SALT_CONC (float, default 50.0 mM)
-
-The millimolar concentration of salt (usually KCl) in the PCR.
-Primer3 uses this argument to calculate oligo melting
-temperatures.
-
-PRIMER_DNA_CONC (float, default 50.0 nM)
-
-The nanomolar concentration of annealing oligos in the PCR.
-Primer3 uses this argument to calculate oligo melting
-temperatures.  The default (50nM) works well with the standard
-protocol used at the Whitehead/MIT Center for Genome
-Research--0.5 microliters of 20 micromolar concentration for each
-primer oligo in a 20 microliter reaction with 10 nanograms
-template, 0.025 units/microliter Taq polymerase in 0.1 mM each
-dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35
-cycles with an annealing temperature of 56 degrees Celsius.  This
-parameter corresponds to 'c' in Rychlik, Spencer and Rhoads'
-equation (ii) (Nucleic Acids Research, 18(21): 6409-6412)
-where a suitable value (for a lower initial concentration of template)
-is "empirically determined".  The value of this parameter is less
-than the actual concentration of oligos in the reaction because
-it is the concentration of annealing oligos, which in turn
-depends on the amount of template (including PCR product) in a
-given cycle.  This concentration increases a great deal during a
-PCR; fortunately PCR seems quite robust for a variety of oligo
-melting temperatures.
-
-See ADVICE FOR PICKING PRIMERS.
-
-PRIMER_NUM_NS_ACCEPTED (int, default 0)
-
-Maximum number of unknown bases (N) allowable in any primer.
-
-PRIMER_SELF_ANY (decimal,9999.99, default 8.00)
-
-The maximum allowable local alignment score when testing a single
-primer for (local) self-complementarity and the maximum allowable
-local alignment score when testing for complementarity between
-left and right primers.  Local self-complementarity is taken to
-predict the tendency of primers to anneal to each other without
-necessarily causing self-priming in the PCR.  The scoring system
-gives 1.00 for complementary bases, -0.25 for a match of any base
-(or N) with an N, -1.00 for a mismatch, and -2.00 for a gap.
-Only single-base-pair gaps are allowed.  For example, the
-alignment
-
-5' ATCGNA 3'
-   || | |
-3' TA-CGT 5'
-
-is allowed (and yields a score of 1.75), but the alignment
-
-5' ATCCGNA 3'
-   ||  | |
-3' TA--CGT 5'
-
-is not considered.  Scores are non-negative, and a score of 0.00
-indicates that there is no reasonable local alignment between two
-oligos.
-
-PRIMER_SELF_END (decimal 9999.99, default 3.00)
-
-The maximum allowable 3'-anchored global alignment score when
-testing a single primer for self-complementarity, and the maximum
-allowable 3'-anchored global alignment score when testing for
-complementarity between left and right primers.  The 3'-anchored
-global alignment score is taken to predict the likelihood of
-PCR-priming primer-dimers, for example
-
-5' ATGCCCTAGCTTCCGGATG 3'
-             ||| |||||
-          3' AAGTCCTACATTTAGCCTAGT 5'
-
-or
-
-5` AGGCTATGGGCCTCGCGA 3'
-               ||||||
-            3' AGCGCTCCGGGTATCGGA 5'
-
-The scoring system is as for the Maximum Complementarity
-argument.  In the examples above the scores are 7.00 and 6.00
-respectively.  Scores are non-negative, and a score of 0.00
-indicates that there is no reasonable 3'-anchored global
-alignment between two oligos.  In order to estimate 3'-anchored
-global alignments for candidate primers and primer pairs, Primer
-assumes that the sequence from which to choose primers is
-presented 5'->3'.  It is nonsensical to provide a larger value
-for this parameter than for the Maximum (local) Complementarity
-parameter because the score of a local alignment will always be at
-least as great as the score of a global alignment.
-
-PRIMER_DEFAULT_PRODUCT (size range list, default 100-300)
-
-A deprecated synonym for PRIMER_PRODUCT_SIZE_RANGE, maintained
-for v2 compatibility.
-
-PRIMER_FILE_FLAG (boolean, default 0)
-
-If the associated value is non-0, then Primer3 creates two output
-files for each input SEQUENCE.  File <sequence_id>.for lists all
-acceptable left primers for <sequence_id>, and <sequence_id>.rev
-lists all acceptable right primers for <sequence_id>, where
-<sequence_id> is the value of the PRIMER_SEQUENCE_ID tag (which
-must be supplied).  In addition, if the input tag
-PRIMER_PICK_INTERNAL_OLIGO is non-0, Primer3 produces a file
-<sequence_id>.int, which lists all acceptable internal oligos.
-
-PRIMER_MAX_POLY_X (int, default 5)
-
-The maximum allowable length of a mononucleotide repeat,
-for example AAAAAA.
-
-PRIMER_LIBERAL_BASE (boolean, default 0)
-
-This parameter provides a quick-and-dirty way to get Primer3 to
-accept IUB / IUPAC codes for ambiguous bases (i.e. by changing
-all unrecognized bases to N).  If you wish to include an
-ambiguous
-base in an oligo, you must set PRIMER_NUM_NS_ACCEPTED to a
-non-0 value.
-
-Perhaps '-' and '* ' should be squeezed out rather than changed
-to 'N', but currently they simply get converted to N's.  The authors
-invite user comments.
-
-PRIMER_NUM_RETURN (int, default 5)
-
-The maximum number of primer pairs to return.  Primer pairs
-returned are sorted by their "quality", in other words by the
-value of the objective function (where a lower number indicates a
-better primer pair).  Caution: setting this parameter to a large
-value will increase running time.
-
-PRIMER_FIRST_BASE_INDEX (int, default 0)
-
-This parameter is the index of the first base in the input
-sequence.  For input and output using 1-based indexing (such as
-that used in GenBank and to which many users are accustomed) set
-this parameter to 1.  For input and output using 0-based indexing
-set this parameter to 0.  (This parameter also affects the
-indexes in the contents of the files produced when the primer
-file flag is set.)
-
-PRIMER_MIN_QUALITY (int, default 0)
-
-The minimum sequence quality (as specified by
-PRIMER_SEQUENCE_QUALITY) allowed within a primer.
-
-PRIMER_MIN_END_QUALITY (int, default 0)
-
-The minimum sequence quality (as specified by
-PRIMER_SEQUENCE_QUALITY) allowed within the 5' pentamer of a
-primer.
-
-PRIMER_QUALITY_RANGE_MIN (int, default 0)
-
-The minimum legal sequence quality (used for error checking
-of PRIMER_MIN_QUALITY and PRIMER_MIN_END_QUALITY).
-
-PRIMER_QUALITY_RANGE_MAX (int, default 100)
-
-The maximum legal sequence quality (used for error checking
-of PRIMER_MIN_QUALITY and PRIMER_MIN_END_QUALITY).
-
-PRIMER_INSIDE_PENALTY (float, default -1.0)
-
-This experimental parameter might not be maintained in this form
-in the next release.  Non-default values valid only for sequences
-with 0 or 1 target regions.  If the primer is part of a pair that
-spans a target and overlaps the target, then multiply this value
-times the number of nucleotide positions by which the primer
-overlaps the (unique) target to get the 'position penalty'.  The
-effect of this parameter is to allow Primer3 to include overlap
-with the target as a term in the objective function.
-
-PRIMER_OUTSIDE_PENALTY (float, default 0.0)
-
-This experimental parameter might not be maintained in this form
-in the next release.  Non-default values valid only for sequences
-with 0 or 1 target regions.  If the primer is part of a pair that
-spans a target and does not overlap the target, then multiply
-this value times the number of nucleotide positions from the 3'
-end to the (unique) target to get the 'position penalty'.
-The effect of this parameter is to allow Primer3 to include
-nearness to the target as a term in the objective function.
-
-PRIMER_MAX_END_STABILITY (float 999.9999, default 100.0)
-
-The maximum stability for the five 3' bases of a left or right
-primer.  Bigger numbers mean more stable 3' ends.  The value is
-the maximum delta G for duplex disruption for the five 3' bases
-as calculated using the nearest neighbor parameters published in
-Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA,
-vol 83, pp 3746-3750.  Primer3 uses a completely permissive
-default value for backward compatibility (which we may change in
-the next release).  Rychlik recommends a maximum value of 9
-(Wojciech Rychlik, "Selection of Primers for Polymerase Chain
-Reaction" in BA White, Ed., "Methods in Molecular Biology,
-Vol. 15: PCR Protocols: Current Methods and Applications", 1993,
-pp 31-40, Humana Press, Totowa NJ).
-
-PRIMER_PRODUCT_OPT_TM (float, default 0.0)
-
-The optimum melting temperature for the PCR product. 0 indicates
-that there is no optimum temperature.
-
-PRIMER_PRODUCT_OPT_SIZE (int, default 0)
-
-The optimum size for the PCR product.  0 indicates that there is
-no optimum product size.  This parameter influences primer
-pair selection only
-if PRIMER_PAIR_WT_PRODUCT_SIZE_GT or
-PRIMER_PAIR_WT_PRODUCT_SIZE_LT is non-0.
-
-PRIMER_TASK (string, default pick_pcr_primers)
-
-Tell Primer3 what task to perform. Legal values are pick_pcr_primers,
-pick_pcr_primers_and_hyb_probe, pick_left_only, pick_right_only,
-pick_hyb_probe_only.  The tasks should be self explanatory, except
-that we note that pick_pcr_primers_and_hyb_probe is
-equivalent to the setting PRIMER_PICK_INTERNAL_OLIGO to a non-zero
-value and setting PRIMER_TASK to pick_pcr_primers.
-
-PRIMER_WT_TM_GT (float, default 1.0)
-
-Penalty weight for primers with Tm over PRIMER_OPT_TM.
-
-PRIMER_WT_TM_LT (float, default 1.0)
-
-Penalty weight for primers with Tm under PRIMER_OPT_TM.
-
-PRIMER_WT_SIZE_LT (float, default 1.0)
-
-Penalty weight for primers shorter than PRIMER_OPT_SIZE.
-
-PRIMER_WT_SIZE_GT (float, default 1.0)
-
-Penalty weight for primers longer than PRIMER_OPT_SIZE.
-
-PRIMER_WT_GC_PERCENT_LT (float, default 1.0)
-
-Penalty weight for primers with GC percent greater than
-PRIMER_OPT_GC_PERCENT.
-
-PRIMER_WT_GC_PERCENT_GT (float, default 1.0)
-
-Penalty weight for primers with GC percent greater than
-PRIMER_OPT_GC_PERCENT.
-
-PRIMER_WT_COMPL_ANY (float, default 0.0)
-PRIMER_WT_COMPL_END (float, default 0.0)
-PRIMER_WT_NUM_NS (float, default 0.0)
-PRIMER_WT_REP_SIM (float, default 0.0)
-PRIMER_WT_SEQ_QUAL (float, default 0.0)
-PRIMER_WT_END_QUAL (float, default 0.0)
-PRIMER_WT_POS_PENALTY (float, default 0.0)
-PRIMER_WT_END_STABILITY (float, default 0.0)
-PRIMER_WT_TEMPLATE_MISPRIMING (float, default 0.0)
-PRIMER_PAIR_WT_PR_PENALTY (float, default 1.0)
-PRIMER_PAIR_WT_IO_PENALTY (float, default 0.0)
-PRIMER_PAIR_WT_DIFF_TM (float, default 0.0)
-PRIMER_PAIR_WT_COMPL_ANY (float, default 0.0)
-PRIMER_PAIR_WT_COMPL_END (float, default 0.0)
-PRIMER_PAIR_WT_PRODUCT_TM_LT (float, default 0.0)
-PRIMER_PAIR_WT_PRODUCT_TM_GT (float, default 0.0)
-PRIMER_PAIR_WT_PRODUCT_SIZE_GT (float, default 0.0)
-PRIMER_PAIR_WT_PRODUCT_SIZE_LT (float, default 0.0)
-PRIMER_PAIR_WT_REP_SIM (float, default 0.0)
-PRIMER_PAIR_WT_TEMPLATE_MISPRIMING (float, default 0.0)
-
-Like the arguments governing PCR primer selection, the input tags
-governing internal oligo selection are divided into sequence
-input tags and global input tags, with for former being
-automatically reset after each input record, and the latter
-persisting until explicitly reset.
-
-Because the laboratory detection step using internal oligos
-is independent of the PCR amplification procedure,
-internal oligo tags have defaults that are independent
-of the parameters that govern the selection of PCR primers.
-For example, the melting temperature of an oligo
-used for hybridization might be considerably lower
-than that used as a PCR primer.
-
-Internal Oligo "Sequence" Input Tags
-------------------------------------
-
-PRIMER_INTERNAL_OLIGO_EXCLUDED_REGION (interval list, default empty)
-
-Middle oligos may not overlap any region specified by this tag.
-The associated value must be a space-separated list of
-
-<start>,<length>
-
-pairs, where <start> is the index of the first base of
-an excluded region, and <length> is its length.  Often one would
-make Target regions excluded regions for internal oligos.
-
-PRIMER_INTERNAL_OLIGO_INPUT (nucleotide sequence, default empty)
-
-The sequence of an internal oligo to check and around which to
-design left and right primers.  Must be a substring of SEQUENCE.
-
-Internal Oligo "Global" Input Tags
-----------------------------------
-
-These tags are analogous to the global input tags (those
-governing primer oligos) discussed above.  The exception is
-PRIMER_INTERNAL_OLIGO_SELF_END which is meaningless when applied
-to internal oligos used for hybridization-based detection, since
-primer-dimer will not occur.  We recommend that
-PRIMER_INTERNAL_OLIGO_SELF_END be set at least as high as
-PRIMER_INTERNAL_OLIGO_SELF_ANY.
-
-PRIMER_INTERNAL_OLIGO_OPT_SIZE (int, default 20)
-PRIMER_INTERNAL_OLIGO_MIN_SIZE (int, default 18)
-PRIMER_INTERNAL_OLIGO_MAX_SIZE (int, default 27)
-PRIMER_INTERNAL_OLIGO_OPT_TM (float, default 60.0 degrees C)
-PRIMER_INTERNAL_OLIGO_OPT_GC_PERCENT (float, default 50.0%)
-PRIMER_INTERNAL_OLIGO_MIN_TM (float, default 57.0 degrees C)
-PRIMER_INTERNAL_OLIGO_MAX_TM (float, default 63.0 degrees C)
-PRIMER_INTERNAL_OLIGO_MIN_GC (float, default 20.0%)
-PRIMER_INTERNAL_OLIGO_MAX_GC (float, default 80.0%)
-PRIMER_INTERNAL_OLIGO_SALT_CONC (float, default 50.0 mM)
-PRIMER_INTERNAL_OLIGO_DNA_CONC (float, default 50.0 nM)
-PRIMER_INTERNAL_OLIGO_SELF_ANY (decimal 9999.99, default 12.00)
-PRIMER_INTERNAL_OLIGO_MAX_POLY_X (int, default 5)
-PRIMER_INTERNAL_OLIGO_SELF_END (decimal 9999.99, default 12.00)
-PRIMER_INTERNAL_OLIGO_MISHYB_LIBRARY (string, optional)
-
-Similar to PRIMER_MISPRIMING_LIBRARY, except that the event we
-seek to avoid is hybridization of the internal oligo to sequences
-in this library rather than priming from them.
-
-PRIMER_INTERNAL_OLIGO_MAX_MISHYB (decimal,9999.99, default 12.00)
-
-Similar to PRIMER_MAX_MISPRIMING except that this parameter applies
-to the similarity of candidate internal oligos to the library
-specified in PRIMER_INTERNAL_OLIGO_MISHYB_LIBRARY.
-
-PRIMER_INTERNAL_OLIGO_MAX_TEMPLATE_MISHYB (decimal,9999.99, default 12.00)
-
-Not implemented.
-
-PRIMER_INTERNAL_OLIGO_MIN_QUALITY (int, default 0)
-
-(Note that there is no PRIMER_INTERNAL_OLIGO_MIN_END_QUALITY.)
-
-PRIMER_IO_WT_TM_GT (float, default 1.0)
-PRIMER_IO_WT_TM_LT (float, default 1.0)
-PRIMER_IO_WT_GC_PERCENT_GT (float, default 1.0)
-PRIMER_IO_WT_GC_PERCENT_LT (float, default 1.0)
-PRIMER_IO_WT_SIZE_LT (float, default 1.0)
-PRIMER_IO_WT_SIZE_GT (float, default 1.0)
-PRIMER_IO_WT_COMPL_ANY (float, default 0.0)
-PRIMER_IO_WT_COMPL_END (float, default 0.0)
-PRIMER_IO_WT_NUM_NS (float, default 0.0)
-PRIMER_IO_WT_REP_SIM (float, default 0.0)
-PRIMER_IO_WT_SEQ_QUAL (float, default 0.0)
-PRIMER_IO_WT_END_QUAL (float, default 0.0)
-
-AN EXAMPLE
-----------
-One might be interested in performing PCR on an STS with a CA
-repeat in the middle of it. Primers need to be chosen based on
-the criteria of the experiment.
-
-We need to come up with a boulder-io record to send to Primer3 via
-stdin. There are lots of ways to accomplish this. We could save
-the record into a text file called 'input', and then type the
-UNIX command 'primer3 < input'. 
-
-Let's look at the input record itself:
-
-PRIMER_SEQUENCE_ID=example
-SEQUENCE=GTAGTCAGTAGACNATGACNACTGACGATGCAGACNACACACACACACACAGCACACAGGTATTAGTGGGCCATTCGATCCCGACCCAAATCGATAGCTACGATGACG
-TARGET=37,21
-PRIMER_OPT_SIZE=18
-PRIMER_MIN_SIZE=15
-PRIMER_MAX_SIZE=21
-PRIMER_NUM_NS_ACCEPTED=1
-PRIMER_PRODUCT_SIZE_RANGE=75-100
-PRIMER_FILE_FLAG=1
-PRIMER_PICK_INTERNAL_OLIGO=1
-PRIMER_INTERNAL_OLIGO_EXCLUDED_REGION=37,21
-PRIMER_EXPLAIN_FLAG=1
-=
-
-A breakdown of the reasoning behind each of the TAG=VALUE pairs
-is below:
-
-PRIMER_SEQUENCE_ID=example
-
-The main intent of this tag is to provide an identifier for the
-sequence that is meaningful to the user, for example when Primer3
-processes multiple records, and by default this tag is optional.
-However, this tag is _required_ when PRIMER_FILE_FLAG is non-0
-Because it provides the names of the files that contain lists
-of oligos that Primer3 considered.
-
-SEQUENCE=GTAGTCAGTAGACNATGACNACTGACGATGCAGACNACACACACACACACAGCACACAGGTATTAGTGGGCCATTCGATCCCGACCCAAATCGATAGCTACGATGACG
-
-The SEQUENCE tag is of ultimate importance. Without it, Primer3
-has no idea what to do. This sequence is 92 bases long. Note that
-there is no newline until the sequence terminates completely.
-
-TARGET=37,21
-
-There is a simple sequence repeat in our sequence, which starts
-at base 37, and has a length of 21 bases. We want Primer3 to
-choose primers which flank the repeat site, so we let Primer3 know
-that we consider this site to be important.
-
-PRIMER_OPT_SIZE=18
-
-Since our sequence length is rather small (only 92 bases
-long), we lower the PRIMER_OPT_SIZE from 20 to 18. It's
-more likely that Primer3 will succeed if it shoots for smaller
-primers with such a small sequence.
-
-PRIMER_MIN_SIZE=15
-PRIMER_MAX_SIZE=21
-
-With the lowering of optimal primer size, it's good to lower
-the minimum and maximum sizes as well.
-
-PRIMER_NUM_NS_ACCEPTED=1
-
-Again, since we've got such a small sequence with a
-non-negligible amount of unknown bases (N's) in it, let's make
-Primer3's job easier by allowing it to pick primers that have
-at most 1 unknown base.
-
-PRIMER_PRODUCT_SIZE_RANGE=75-100
-
-We reduce the product size range from the default of 100-300
-because our source sequence is only 108 base pairs long.  If we
-insisted on a product size of 100 base pairs Primer3 would have
-few possibilities to choose from.
-
-PRIMER_FILE_FLAG=1
-
-Since we've got such a small sequence, Primer might fail to
-pick primers. We want to get the list of primers it
-considered, then, so that we might manually pick primers
-ourselves if Primer fails to do so. Setting this flag to 1
-will force Primer to output the primers it considered to a
-forward_primer and a reverse_primer output file.
-
-PRIMER_PICK_INTERNAL_OLIGO=1
-
-We want to see if Primer v2.3 can pick an internal oligo for
-the sequence, so we set this flag to 1 (true).
-
-PRIMER_INTERNAL_OLIGO_EXCLUDED_REGION=37,21
-
-Normally CA-repeats make poor hybridization probes (because they
-not specific enough).  Therefor we exclude the CA repeat (which
-is the TARGET) from consideration for the middle oligo.
-
-PRIMER_EXPLAIN_FLAG=1
-
-We want to see statistics about the oligos and oligo triples
-(left primer, internal oligo, right primer) that Primer3
-examined.
-
-=
-
-The '=' character terminates the record.
-
-Tere are some boulderio tags that we never even
-specified. (INCLUDED_REGION, EXCLUDED_REGION, et al.), which is
-perfectly legal.  For the tags with default values, those
-defaults will be used in the analysis. For the tags with NO
-default values (like TARGET, for instance), the functionality
-requested by the those tags will simply be absent. It's not the
-case that we need to surround a simple sequence repeat every time
-we want to pick primers!
-
-
-OUTPUT TAGS
------------
-For each boulderio record passed into primer3 via stdin, exactly
-one boulderio record comes out of primer3 on stdout. These output
-records contain everything that the input record contains, plus a
-subset of the following tag/value pairs.  Unless noted by (*),
-each tag appears for each primer pair returned.  The first
-version is PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO,PAIR}_<tag_name>.
-Tags of additional primers chosen are of the form
-PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO,PAIR}_<j>_<tag_name>.  where
-<j> is an integer from 1 to n, where n is at most the value of
-PRIMER_NUM_RETURN.
-
-In the descriptions below, 'i,n' represents a start/length pair,
-'s' represents a string, x represents an arbitrary integer, and f
-represents a float.
-
-PRIMER_ERROR=s (*)
-
-s describes user-correctible errors detected in the input
-(separated by semicolons).  This tag is absent if there are no
-errors.
-
-PRIMER_LEFT=i,n
-(FORWARD_PRIMER if -v2_compat is set)
-
-The selected left primer (the primer to the left in the input
-sequence).  i is the 0-based index of the start base of the
-primer, and n is t its length.
-
-PRIMER_RIGHT=i,n
-(REVERSE_PRIMER if -v2_compat is set)
-
-The selected right primer (the primer to the right in the input
-sequence).  i is the 0-based index of the last base of the
-primer, and n is its length.
-
-PRIMER_INTERNAL_OLIGO=i,n
-(MIDDLE_OLIGO if -v2_compat is set)
-
-The selected internal oligo. Primer3 outputs this tag if
-PRIMER_PICK_INTERNAL_OLIGO was non-0.  If primer3 fails to pick a
-middle oligo upon request, this tag will not be output.  i is the
-0-based index of start base of the internal oligo, and n is its
-length.
-
-PRIMER_PRODUCT_SIZE=x
-(PRODUCT_SIZE if -v2_compat is set)
-
-x is the product size of the PCR product.
-
-PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_EXPLAIN=s (*)
-
-s is a (more or less) self-documenting string containing
-statistics on the possiblities that primer3 considered in
-selecting a single oligo.  For example
-
-PRIMER_LEFT_EXPLAIN=considered 62, too many Ns 53, ok 9
-PRIMER_RIGHT_EXPLAIN=considered 62, too many Ns 53, ok 9
-PRIMER_INTERNAL_OLIGO_EXPLAIN=considered 87, too many Ns 39, overlap excluded region 40, ok 8
-
-All the categories are exclusive, except the 'considered' category.
-
-PRIMER_PAIR_EXPLAIN=s (*)
-
-s is a self-documenting string containing statistics on picking a
-primer pair (plus internal oligo if requested).  For exaple
-
-PRIMER_PAIR_EXPLAIN=considered 81, unacceptable product size 49, no internal oligo 32, ok 0
-
-All the categories are exclusive, except the 'considered' category.
-
-In some cases Primer3 will examine a primer pair before it
-discovers that one of the primers in the pair violates specified
-constraints.  In this case PRIMER_PAIR_EXPLAIN might have a non-0
-number 'considered', even though one or more of
-PRIMER_LEFT_EXPLAIN, PRIMER_RIGHT_EXPLAIN, or
-PRIMER_INTERNAL_OLIGO_EXPLAIN has 'ok 0'.
-
-PRIMER_PAIR_PENALTY=f
-
-The value of the objective function for this pair (lower is better).
-
-PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_PENALTY=f
-
-The contribution of this individual primer or oligo to the
-objective function.
-
-PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_SEQUENCE=s
-
-The actual sequence of the oligo. The sequence of left primer and
-internal oligo is presented 5' -> 3' on the same strand as the
-input SEQUENCE (which must be presented 5' -> 3').  The sequence
-of the right primer is presented 5' -> 3' on the opposite strand
-from the input SEQUENCE.
-
-PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_TM=f
-
-The melting TM for the selected oligo.
-
-PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_GC_PERCENT=f
-
-The percent GC for the selected oligo (denominator is the number
-of non-ambiguous bases).
-
-PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_SELF_ANY=f
-PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_SELF_END=f
-
-The self-complementarity measures for the selected oligo.
-
-PRIMER_PAIR_COMPL_ANY=f
-PRIMER_PAIR_COMPL_END=f
-
-The inter-pair complementarity measures for the selected left and
-right primer
-
-PRIMER_WARNING=s (*)
-
-s lists warnings generated by primer (separated by semicolons);
-this tag is absent if there are no warnings
-
-PRIMER_{LEFT,RIGHT,PAIR}_MISPRIMING_SCORE=f, s
-
-f is the maximum mispriming score for the right primer
-against any sequence in the given PRIMER_MISPRIMING_LIBRARY;
-s is the id of corresponding library sequence.
-PRIMER_PAIR_MISPRIMING_SCORE is the maximum sum of
-mispriming scores in any single library sequence (perhaps a
-more reasonable estimator of the likelihood of mispriming).
-
-PRIMER_{LEFT,RIGHT,PAIR}_TEMPLATE_MISPRIMING=f
-
-Analogous to PRIMER_{LEFT,RIGHT,PAIR}_MISPRIMING_SCORE, except that
-these output tags apply to mispriming within the template sequence.
-This often arises, for example, in genes with repeated exons. For
-backward compatibility, these tags only appear if the corresponding
-input tags have defined values.
-
-PRIMER_PRODUCT_TM=f
-
-f is the melting temperature of the product. Calculated using equation (iii)
-from Rychlik, Spencer and Rhoads, Nucleic Acids Research 18(21) pg. 6410.
-Printed only if a non-default value of PRIMER_MAX_PRODUCT_TM or
-PRIMER_MIN_PRODUCT_TM is specified.
-
-PRIMER_PRODUCT_TM_OLIGO_TM_DIFF=f
-
-f is the difference between the melting temperature of the
-product and the melting temperature of the less stable primer.
-Printed only if PRIMER_MAX_PRODUCT_TM or PRIMER_MIN_PRODUCT_TM is
-specified.
-
-PRIMER_PAIR_T_OPT_A=f
-
-f is T sub a super OPT from equation (i) in Rychlik, Spencer, and
-Rhoads, Nucleic Acids Research 18(21), page 6410.  Printed only if
-PRIMER_MAX_PRODUCT_TM or PRIMER_MIN_PRODUCT_TM is specified.
-
-PRIMER_INTERNAL_OLIGO_MISHYB_SCORE=f, s
-
-f is the maximum mishybridization score for the right primer
-against any sequence in the given
-PRIMER_INTERNAL_OLIGO_MISHYB_LIBRARY; s is the id of
-corresponding library sequence.
-
-PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_MIN_SEQ_QUALITY=i
-
-i is the minimum _sequence_ quality within the primer
-or oligo (not to be confused with the PRIMER_PAIR_QUALITY
-output tag, which is really the value of the objective
-function.)
-
-PRIMER_{LEFT,RIGHT}_END_STABILITY=f
-
-f is the delta G of disruption of the five 3' bases of the
-primer.
-
-PRIMER_STOP_CODON_POSITION=i
-
-i is the position of the first base of the stop codon,
-if Primer3 found one, or -1 if Primer3 did not.  Printed
-only if the input tag PRIMER_START_CODON_POSITION with a
-non-default value is supplied.
-
-EXAMPLE OUTPUT
---------------
-You should run it youself.  Use the file 'example' in this
-directory as input.
-
-
-ADVICE FOR PICKING PRIMERS
---------------------------
-We suggest referring to: Wojciech Rychlik, "Selection of Primers
-for Polymerase Chain Reaction" in BA White, Ed., "Methods in
-Molecular Biology, Vol. 15: PCR Protocols: Current Methods and
-Applications", 1993, pp 31-40, Humana Press, Totowa NJ
-
-
-Cautions
---------
-Some of the most important issues in primer picking can be
-addressed only before using Primer3.  These are sequence quality
-(including making sure the sequence is not vector and not
-chimeric) and avoiding repetitive elements.
-
-Techniques for avoiding problems include a thorough understanding
-of possible vector contaminants and cloning artifacts coupled
-with database searches using blast, fasta, or other similarity
-searching program to screen for vector contaminants and possible
-repeats.  Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, and
-others, 1995-1996, ftp://ncbi.nlm.nih.gov/repository/repbase)
-is an excellent source of repeat sequences and pointers to the
-literature.  (The Repbase files need to be converted to Fasta format
-before they can be used by Primer3.) Primer3 now allows you to screen
-candidate oligos against a Mispriming Library (or a Mishyb Library in
-the case of internal oligos).
-
-
-Sequence quality can be controlled by manual trace viewing and
-quality clipping or automatic quality clipping programs.  Low-
-quality bases should be changed to N's or can be made part of
-Excluded Regions. The beginning of a sequencing read is often
-problematic because of primer peaks, and the end of the read
-often contains many low-quality or even meaningless called bases.
-Therefore when picking primers from single-pass sequence it is
-often best to use the INCLUDED_REGION parameter to ensure that
-Primer3 chooses primers in the high quality region of the read.
-
-In addition, Primer3 takes as input a Sequence Quality list for
-use with those base calling programs 
-
-(e.g. Phred, Bass/Grace, Trout) that output this information.
-
-
-
-
-
-What to do if Primer3 cannot find a primers?
---------------------------------------------
-Try relaxing various parameters, including the
-self-complementarity parameters and max and min oligo melting
-temperatures.  For example, for very A-T-rich regions you might
-have to increase maximum primer size or decrease minimum melting
-temperature.  It is usually unwise to reduce the minimum primer
-size if your template is complex (e.g. a mammalian genome), since
-small primers are more likely to be non-specific.  Make sure that
-there are adequate stretches of non-Ns in the regions in which
-you wish to pick primers.  If necessary you can also allow an N
-in your primer and use an oligo mixture containing all four bases
-at that position.
-
-Try setting the PRIMER_EXPLAIN_FLAG input tag.
-
-DIFFERENCES FROM EARLIER VERSIONS
----------------------------------
-
-See the file release_notes.txt in this directory.
-
-Compared to 0.5
----------------
-Completely different input format.  
-
-It has been reported the 0.5 deleted Ns when they occurred in
-primers.  
-
-More stringent self-complementarity defaults.
-
-Primer3 selects internal oligos on request (and produces .int
-files if requested).
-
-Compared to both 0.5 and v2
----------------------------
-The format of the contents of .for, .rev (and .int) files is
-different.
-
-Primer3 returns a user-specifiable number of primer pairs (or
-triples) sorted by "goodness".
-
-Primer3 will find a primer pair if any acceptable pair exists.
-
-Optional n-based indexing into source sequence.
-
-Use of sequence quality and 3' stability as constraints in primer
-picking.  Optional positional component to objective function.
-
-Compared to v2
--------------
-Tag name changes.  However, Primer3 should understand most or
-all Primer v2 input tags, and should produce v2-compatible output
-tag names when the -v2_compat command-line switch is used.
-
-The one exception is that the PRIMER_RECOMMEND tag is no longer
-produced. Instead Primer3 produces the PRIMER_x_EXPLAIN output
-tags.  The format of the data in this tags is different from the
-data in v2's PRIMER_RECOMMEND output tag.
-
-Numerous fixes.
-
-Uses the PRIMER_SELF_ANY and PRIMER_SELF_END parameters to govern
-maximum allowable complementarity between left and right primers,
-as well as complementarity between copies of a single oligo or
-within a single oligo.  This behaviour is very close to that of
-primer 0.5; self complementarity calculations in v2 were
-unreliable.
-
-Primer3 produces much more output information, including the TMs
-and self complementarity measures of selected primers.
-
-
-EXIT STATUS CODES
------------------
-
- 0 on normal operation
--1 under the following conditions:
-   illegal command-line arguments.
-   unable to fflush stdout.
-   unable to open (for writing and creating) a .for, .rev
-     or .int file (probably due to a protection problem).
--2 on out-of-memory
--3 empty input
--4 error in a "Global" input tag (message in PRIMER_ERROR).
-
-Primer3 calls abort() and dumps core (if possible) if a
-programming error is detected by an assertion violation.
-
-SIGINT and SIGTERM are handled essentially as empty input, except
-the signal received is returned as the exit status and printed to
-stderr.
-
-In all of the error cases above Primer3 prints a message to stderr.
-
-THE NEW PRIMER3 WWW INTERFACE
------------------------------
-This distribution does not contain the Primer3 WWW interface.  A
-snapshot of the interface used at Whitehead Institute may be available
-strictly 'AS-IS' and without support by e-mail request to
-primer3(at)wi.mit.edu, replacing (at) with @.
-
-The remainder of this section is out-of-date.
-
-The web interface consists of:
-
-primer3_www.cgi              (the user input screen)
-primer3_www_help.html        (user help for the input screen)
-primer3_www_results.cgi      (the results screen)
-primer3_www_results_help.cgi (user help for the results screen)
-
-To use this interface you will need perl5 and the perl5
-module CGI.pm.  Refer to your perl book to locate the perl5
-distribution.  CGI.pm was written by Lincoln D. Stein and is
-available from CPAN (www.cpan.org). You will also need to
-know enough about your operating system and web server to
-install a new CGI script, and enough about perl5 to read the
-script and figure out how it does what it does.
-
-You will have to make some modifications to primer3_www.cgi and
-to primer_www_results.cgi:
-
-1. Correct the path to perl5 on the first line of each .cgi file,
-since this path varies from system to system.
-
-2. Change the value of the $MAINTAINER variable near the top of
-both .cgi files so that they address the person maintaining your
-installation of the primer WWW interface.
-
-3. Specify available mispriming libraries.  In primer3_www.cgi
-modify the variable $SELECT_SEQ_LIBRARY as necessary and in
-primer3_www_results modify the value of %SEQ_LIBRARY in a
-corresponding way.
-
-4. Depending on your primer picking application you might want to
-change defaults; many of these are set in primer3_www.cgi, but
-there are some subtleties dealing with the interpretation of
-empty input fields.  You have to read the code to really
-understand what is going on.
-
-5. If primer3_www_help.html is not in the same directory as
-primer3_www.cgi fix $DOC_URL in primer3_www.cgi.
-
-6. If primer3_www_results.cgi is not in the same directory as
-primer3_www.cgi fix $PROCESS_INPUT_URL in primer3_www.cgi.
-
-7. If primer3_core is not in same directory as
-primer3_www_results.cgi, fix $PRIMER_BIN in
-primer3_www_results.cgi.
- 
-8. If primer3_www_results_help.html is not in the same directory
-as primer3_www_results.cgi fix $DOC_URL in
-primer3_www_results.cgi.
-
-
-ACKNOWLEDGMENTS
----------------
-
-The development of Primer3 was funded by Howard Hughes Medical
-Institute and by the National Institutes of Health, National
-Human Genome Research Institute under grants R01-HG00257 (to
-David C. Page) and P50-HG00098 (to Eric S. Lander).
-
-We gratefully acknowledge the support of Digital Equipment
-Corporation, which provided the Alphas which were used for most
-of the development of Primer3, and of Centerline Software, Inc.,
-whose TestCenter memory-error, -leak, and test-coverage checker
-helped us discover and correct a number of otherwise latent
-errors in Primer3.
-
-Primer3 was written by Helen J. Skaletsky (Howard Hughes Medical
-Institute, Whitehead Institute) and Steve Rozen (Whitehead
-Institute/MIT Center for Genome Research), based on the design of
-earlier versions: Primer 0.5 (Steve Lincoln, Mark Daly, and Eric
-S. Lander) and Primer v2 (Richard Resnick).  This documentation
-was written by Richard Resnick and Steve Rozen.  The original web
-interface was designed by Richard Resnick.  Lincoln Stein 
-championed the use of the Boulder-IO format and the idea of
-making Primer3 a software component.
-
-In addition, following is a partial list of people who kindly
-contributed to the design of Primer3
-
-Ernst Molitor
-Carl Foeller
-
-The authors of the current version would be pleased to receive
-error reports or requests for enhancements.  Please send e-mail
-to primer3(at)wi.mit.edu after replacing (at) with @.

Copied: trunk/packages/primer3/branches/upstream/current/README.txt (from rev 207, trunk/packages/primer3/branches/upstream/current/README.primer3_1.0.1.txt)




More information about the debian-med-commit mailing list