[med-svn] [ariba] 02/04: New upstream version 2.11.0+ds

Sascha Steinbiss satta at debian.org
Mon Feb 5 08:53:16 UTC 2018 

This is an automated email from the git hooks/post-receive script.

satta pushed a commit to branch master
in repository ariba.

commit 110e4fec224bf2b28e3ca5380bb677e0295e757b
Author: Sascha Steinbiss <satta at debian.org>
Date:   Mon Feb 5 09:46:34 2018 +0100

    New upstream version 2.11.0+ds
---
 README.md                                          | 122 ++++++++---
 ariba/assembly.py                                  | 114 +++++++++-
 ariba/cluster.py                                   |  95 ++++++---
 ariba/clusters.py                                  | 199 +++++++++++-------
 ariba/common.py                                    |  10 +-
 ariba/external_progs.py                            |  16 +-
 ariba/mic_plotter.py                               |   2 +
 ariba/tasks/run.py                                 |   4 +-
 ariba/tests/assembly_test.py                       |  48 ++++-
 ariba/tests/cluster_test.py                        |  72 +++++--
 ...mbly_test_assemble_with_spades_fails_reads_1.fq |   4 +
 ...mbly_test_assemble_with_spades_fails_reads_2.fq |   5 +
 .../assembly_test_assemble_with_spades_reads_1.fq  | 232 +++++++++++++++++++++
 .../assembly_test_assemble_with_spades_reads_2.fq  | 232 +++++++++++++++++++++
 .../assembly_test_check_spades_log_file.log.bad    |   5 +
 .../assembly_test_check_spades_log_file.log.good   |   5 +
 scripts/ariba                                      |   6 +
 setup.py                                           |   2 +-
 18 files changed, 1012 insertions(+), 161 deletions(-)

diff --git a/README.md b/README.md
index 3b68744..01e2b85 100644
--- a/README.md
+++ b/README.md
@@ -1,37 +1,81 @@
-ARIBA
-=====
+# ARIBA
 
 Antimicrobial Resistance Identification By Assembly
 
-For methods and benchmarking, please see the [preprint on biorxiv][ariba biorxiv].
+For how to use ARIBA, please see the [ARIBA wiki page][ARIBA wiki].
 
+[![Build Status](https://travis-ci.org/sanger-pathogens/ariba.svg?branch=master)](https://travis-ci.org/sanger-pathogens/ariba)
+[![License: GPL v3](https://img.shields.io/badge/License-GPL%20v3-brightgreen.svg)](https://github.com/ssjunnebo/ariba/blob/master/LICENSE)
+[![status](https://img.shields.io/badge/MGEN-10.1099%2Fmgen.0.000131-brightgreen.svg)](http://mgen.microbiologyresearch.org/content/journal/mgen/10.1099/mgen.0.000131)
 
-For how to use ARIBA, please see the [ARIBA wiki page][ARIBA wiki].
+## Contents
+* [Introduction](#introduction)
+* [Quick Start](#quick-start)
+* [Installation](#installation)
+  * [Required dependencies](#required-dependencies)
+  * [Using pip3](#using-pip3)
+  * [From Source](#from-source)
+  * [Docker](#docker)
+  * [Debian (testing)](#debian-testing)
+  * [Ubuntu](#ubuntu)
+  * [Dependencies and environment variables](#dependencies-and-environment-variables)
+* [Temporary files](#temporary-files)
+* [Usage](#usage)
+* [License](#license)
+* [Feedback/Issues](#feedbackissues)
+* [Citation](#citation)
+
+## Introduction
+ARIBA is a tool that identifies antibiotic resistance genes by running local assemblies.
+It can also be used for [MLST calling](https://github.com/sanger-pathogens/ariba/wiki/MLST-calling-with-ARIBA).
+
+The input is a FASTA file of reference sequences (can be a mix of genes and noncoding sequences) and paired sequencing reads. ARIBA reports which of the reference sequences were found, plus detailed information on the quality of the assemblies and any variants between the sequencing reads and the reference sequences.
+
+## Quick Start
+Get reference data, for instance from [CARD](https://card.mcmaster.ca/). See [getref](https://github.com/sanger-pathogens/ariba/wiki/Task%3A-getref) for a full list.
+
+    ariba getref card out.card
+
+Prepare reference data for ARIBA:
+
+    ariba prepareref -f out.card.fa -m out.card.tsv out.card.prepareref
+
+Run local assemblies and call variants:
+
+    ariba run out.card.prepareref reads1.fastq reads2.fastq out.run
+
+Summarise data from several runs:
 
+    ariba summary out.summary out.run1/report1.tsv out.run2/report2.tsv out.run3/report3.tsv
 
+Please read the [ARIBA wiki page][ARIBA wiki] for full usage instructions.
 
-Installation
-------------
+## Installation
 
-ARIBA has the following dependencies, which need to be installed:
+If you encounter an issue when installing ARIBA please contact your local system administrator. If you encounter a bug please log it [here](https://github.com/sanger-pathogens/ariba/issues) or email us at ariba-help at sanger.ac.uk.
+
+### Required dependencies
   * [Python3][python] version >= 3.3.2
   * [Bowtie2][bowtie2] version >= 2.1.0
   * [CD-HIT][cdhit] version >= 4.6
   * [MUMmer][mummer] version >= 3.23
 
+ARIBA also depends on several Python packages, all of which are available
+via pip. Installing ARIBA with pip3 will get these automatically if they
+are not already installed:
+  * dendropy >= 4.2.0
+  * matplotlib (no minimum version required, but only tested on 2.0.0)
+  * pyfastaq >= 3.12.0
+  * pysam >= 0.9.1
+  * pymummer >= 0.10.1
 
-Once the dependencies are installed, install ARIBA using pip:
+### Using pip3
+Install ARIBA using pip:
 
     pip3 install ariba
 
-ARIBA also depends on several Python packages, all of which are available
-via pip, so the above command will get those automatically if they
-are not installed. The packages are dendropy >= 4.2.0, matplotlib (no
-minimum version required, but only tested on 2.0.0),
-pyfastaq >= 3.12.0, pysam >= 0.9.1, and pymummer >= 0.10.1.
-
-Alternatively, you can download the latest release from this github repository,
-or clone the repository. Then run the tests:
+### From Source
+Download the latest release from this github repository or clone it. Run the tests:
 
     python3 setup.py test
 
@@ -40,11 +84,11 @@ If the tests all pass, install:
     python3 setup.py install
 
 ### Docker
-ARIBA can be run in a Docker container. First of all install Docker, then to install ARIBA run:
+ARIBA can be run in a Docker container. First install Docker, then install ARIBA:
 
     docker pull sangerpathogens/ariba
 
-To use ARIBA you would use a command such as this (substituting in your directories), where your files are assumed to be stored in /home/ubuntu/data:
+To use ARIBA use a command like this (substituting in your directories), where your files are assumed to be stored in /home/ubuntu/data:
 
     docker run --rm -it -v /home/ubuntu/data:/data sangerpathogens/ariba ariba -h
 
@@ -54,9 +98,7 @@ ARIBA is available in the latest version of Debian, and over time will progressi
 
     sudo apt-get install ariba
 
-
 ### Ubuntu
-
 You can use `apt-get` (see above), or to ensure you get the latest version of ARIBA, the following commands can be
 used to install ARIBA and its dependencies. This was tested on a new instance of Ubuntu 16.04.
 
@@ -90,11 +132,9 @@ Note that ARIBA also runs `bowtie2-build`, for which it uses the
 it would try to use
 
     $HOME/bowtie2-2.1.0/bowtie2-build
-
  
-### Temporary files
+## Temporary files
  
-
 ARIBA can temporarily make a large number of files whilst running, which
 are put in a temporary directory made by ARIBA.  The total size of these
 files is small, but there can be a many of them. This can be a
@@ -128,16 +168,44 @@ This forces the temporary directory to be placed in the output
 directory, and temporary files are kept. It is intended for
 debugging.
 
+## Usage
+    usage: ariba <command> <options>
+
+    optional arguments:
+      -h, --help      show this help message and exit
+
+    Available commands:
+
+	aln2meta      Converts multi-aln fasta and SNPs to metadata
+	expandflag    Expands flag column of report file
+	flag          Translate the meaning of a flag
+	getref        Download reference data
+	micplot       Make violin/dot plots using MIC data
+	prepareref    Prepare reference data for input to "run"
+	pubmlstget    Download species from PubMLST and make db
+	pubmlstspecies
+		      Get list of available species from PubMLST
+	refquery      Get cluster or sequence info from prepareref output
+	run           Run the local assembly pipeline
+	summary       Summarise multiple reports made by "run"
+	test          Run small built-in test dataset
+	version       Get versions and exit
 
+Please read the [ARIBA wiki page][ARIBA wiki] for full usage instructions.
 
-Usage
------
+## License
+ARIBA is free software, licensed under [GPLv3](https://github.com/sanger-pathogens/ariba/blob/master/LICENSE).
 
-Please read the [ARIBA wiki page][ARIBA wiki] for usage instructions.
+## Feedback/Issues
+Please report any issues to the [issues page](https://github.com/sanger-pathogens/ariba/issues) or email ariba-help at sanger.ac.uk
 
+## Citation
+If you use this software please cite:
 
+ARIBA: rapid antimicrobial resistance genotyping directly from sequencing reads
+Hunt M, Mather AE, Sánchez-Busó L, Page AJ, Parkhill J , Keane JA, Harris SR.
+Microbial Genomics 2017. doi: [110.1099/mgen.0.000131](http://mgen.microbiologyresearch.org/content/journal/mgen/10.1099/mgen.0.000131)
 
-Build status: [![Build Status](https://travis-ci.org/sanger-pathogens/ariba.svg?branch=master)](https://travis-ci.org/sanger-pathogens/ariba)
 
   [ariba biorxiv]: http://biorxiv.org/content/early/2017/04/07/118000
   [bowtie2]: http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
diff --git a/ariba/assembly.py b/ariba/assembly.py
index f028a63..0d64882 100644
--- a/ariba/assembly.py
+++ b/ariba/assembly.py
@@ -5,6 +5,7 @@ import pyfastaq
 import pymummer
 import fermilite_ariba
 from ariba import common, faidx, mapping, bam_parse, external_progs, ref_seq_chooser
+import shlex
 
 class Error (Exception): pass
 
@@ -29,6 +30,9 @@ class Assembly:
       nucmer_breaklen=200,
       extern_progs=None,
       clean=True,
+      spades_mode="wgs",
+      spades_options=None,
+      threads=1
     ):
         self.reads1 = os.path.abspath(reads1)
         self.reads2 = os.path.abspath(reads2)
@@ -50,6 +54,9 @@ class Assembly:
         self.nucmer_min_len = nucmer_min_len
         self.nucmer_breaklen = nucmer_breaklen
         self.clean = clean
+        self.spades_mode = spades_mode
+        self.spades_options = spades_options
+        self.threads = threads
 
         if extern_progs is None:
             self.extern_progs = external_progs.ExternalProgs()
@@ -94,6 +101,106 @@ class Assembly:
         self.assembled_ok = (got_from_fermilite == 0)
         os.chdir(cwd)
 
+    @staticmethod
+    def _check_spades_log_file(logfile):
+        '''SPAdes can fail with a strange error. Stop everything if this happens'''
+        f = pyfastaq.utils.open_file_read(logfile)
+
+        for line in f:
+            if line.startswith('== Error ==  system call for:') and line.rstrip().endswith('finished abnormally, err code: -7'):
+                pyfastaq.utils.close(f)
+                print('Error running SPAdes. Cannot continue. This is the error from the log file', logfile, '...', file=sys.stderr)
+                print(line, file=sys.stderr)
+                raise Error('Fatal error ("err code: -7") running spades. Cannot continue')
+
+        pyfastaq.utils.close(f)
+        return True
+
+    def _assemble_with_spades(self):
+        cwd = os.getcwd()
+        self.assembled_ok = False
+        try:
+            try:
+                os.chdir(self.working_dir)
+            except:
+                raise Error('Error chdir ' + self.working_dir)
+            spades_exe = self.extern_progs.exe('spades')
+            if not spades_exe:
+                raise Error("Spades executable has not been found")
+            spades_options = self.spades_options
+            if spades_options is not None:
+                spades_options = shlex.split(self.spades_options)
+            if self.spades_mode == "rna":
+                spades_options = ["--rna"] + (["-k","127"] if spades_options is None else spades_options)
+                spades_out_seq_base = "transcripts.fasta"
+            elif self.spades_mode == "sc":
+                spades_options = ["--sc"] + (["-k", "33,55,77,99,127","--careful"] if spades_options is None else spades_options)
+                spades_out_seq_base = "contigs.fasta"
+            elif self.spades_mode == "wgs":
+                spades_options = ["-k", "33,55,77,99,127","--careful"] if spades_options is None else spades_options
+                spades_out_seq_base = "contigs.fasta"
+            else:
+                raise ValueError("Unknown spades_mode value: {}".format(self.spades_mode))
+            asm_cmd = [spades_exe, "-t", str(self.threads), "--pe1-1", self.reads1, "--pe1-2", self.reads2, "-o", self.assembler_dir] + \
+                spades_options
+            asm_ok,err = common.syscall(asm_cmd, verbose=True, verbose_filehandle=self.log_fh, shell=False, allow_fail=True)
+            if not asm_ok:
+                print('Assembly finished with errors. These are the errors:', file=self.log_fh)
+                print(err, file=self.log_fh)
+                print('\nEnd of spades errors\n', file=self.log_fh)
+            else:
+
+                spades_log = os.path.join(self.assembler_dir, 'spades.log')
+                if os.path.exists(spades_log):
+                    self._check_spades_log_file(spades_log)
+
+                    with open(spades_log) as f:
+                        print('\n______________ SPAdes log ___________________\n', file=self.log_fh)
+                        for line in f:
+                            print(line.rstrip(), file=self.log_fh)
+                        print('\n______________ End of SPAdes log _________________\n', file=self.log_fh)
+
+                spades_warnings = os.path.join(self.assembler_dir, 'warnings.log')
+                if os.path.exists(spades_warnings):
+                    with open(spades_warnings) as f:
+                        print('\n______________ SPAdes warnings ___________________\n', file=self.log_fh)
+                        for line in f:
+                            print(line.rstrip(), file=self.log_fh)
+                        print('\n______________ End of SPAdes warnings _________________\n', file=self.log_fh)
+
+                ## fermilight module generates contig names that look like `cluster_1.l15.c17.ctg.1` where 'cluster_1'==self.contig_name_prefix
+                ## the whole structure of the contig name is expected in several places downstream where it is parsed into individual components.
+                ## For example, it is parsed into to l and c parts in ref_seq_chooser (although the parts are not actually used).
+                ## This is the code from fermilight module that generates the contig ID string:
+                ## ofs << ">" << namePrefix << ".l" << overlap << ".c" << minCount << ".ctg." << i + 1 << '\n'
+                ##
+                ## We generate the same contig name structure here using dummy values for overlap and minCount, in order
+                ## to avoid distrupting the downstream code.
+                ## Note that the fermilight module generates multiple versions of the assembly on a grid of l and c values,
+                ## and ref_seq_chooser then picks a single "best" (l,c) version based on coverage/identity of the nucmer
+                ## alignment to the reference. Spades generates a single version of the assembly, so ref_seq_chooser
+                ## can only pick that one version.
+
+                spades_out_seq = os.path.join(self.assembler_dir,spades_out_seq_base)
+                ## No need really to use general-purpose pyfastaq.sequences.file_reader here and pay performance cost for
+                ## its multi-format line tests since we are only replacing the IDs in a pre-defined format
+                if os.path.exists(spades_out_seq):
+                    with open(spades_out_seq,"r") as inp, open(self.all_assembly_contigs_fa,"w") as out:
+                        pref = self.contig_name_prefix
+                        i_cont = 0
+                        for line in inp:
+                            if line.startswith(">"):
+                                i_cont += 1
+                                line = ">{}.l15.c17.ctg.{}\n".format(pref,i_cont)
+                            out.write(line)
+                        if i_cont > 0:
+                            self.assembled_ok = True
+            if self.clean:
+                print('Deleting assembly directory', self.assembler_dir, file=self.log_fh)
+                shutil.rmtree(self.assembler_dir,ignore_errors=True)
+        finally:
+            os.chdir(cwd)
+
 
     @staticmethod
     def _fix_contig_orientation(contigs_fa, ref_fa, outfile, min_id=90, min_length=20, breaklen=200):
@@ -148,7 +255,10 @@ class Assembly:
 
 
     def run(self):
-        self._assemble_with_fermilite()
+        if self.assembler == 'fermilite':
+            self._assemble_with_fermilite()
+        elif self.assembler == "spades":
+            self._assemble_with_spades()
         print('Finished running assemblies', flush=True, file=self.log_fh)
         self.sequences = {}
 
@@ -208,7 +318,7 @@ class Assembly:
                 self.reads2,
                 self.final_assembly_fa,
                 self.final_assembly_bam[:-4],
-                threads=1,
+                threads=self.threads,
                 sort=True,
                 bowtie2=self.extern_progs.exe('bowtie2'),
                 bowtie2_version=self.extern_progs.version('bowtie2'),
diff --git a/ariba/cluster.py b/ariba/cluster.py
index 75d244b..9d733f8 100644
--- a/ariba/cluster.py
+++ b/ariba/cluster.py
@@ -43,10 +43,12 @@ class Cluster:
       max_allele_freq=0.90,
       unique_threshold=0.03,
       max_gene_nt_extend=30,
-      spades_other_options=None,
+      spades_mode="rna", #["rna","wgs"]
+      spades_options=None,
       clean=True,
       extern_progs=None,
       random_seed=42,
+      threads_total=1
     ):
         self.root_dir = os.path.abspath(root_dir)
         self.read_store = read_store
@@ -71,7 +73,8 @@ class Cluster:
         self.sspace_k = sspace_k
         self.sspace_sd = sspace_sd
         self.reads_insert = reads_insert
-        self.spades_other_options = spades_other_options
+        self.spades_mode = spades_mode
+        self.spades_options = spades_options
 
         self.reads_for_assembly1 = os.path.join(self.root_dir, 'reads_for_assembly_1.fq')
         self.reads_for_assembly2 = os.path.join(self.root_dir, 'reads_for_assembly_2.fq')
@@ -96,6 +99,9 @@ class Cluster:
         self.status_flag = flag.Flag()
         self.clean = clean
 
+        self.threads_total = threads_total
+        self.remaining_clusters = None
+
         self.assembly_dir = os.path.join(self.root_dir, 'Assembly')
         self.final_assembly_fa = os.path.join(self.root_dir, 'assembly.fa')
         self.final_assembly_bam = os.path.join(self.root_dir, 'assembly.reads_mapped.bam')
@@ -138,13 +144,31 @@ class Cluster:
         for s in wanted_signals:
             signal.signal(s, self._receive_signal)
 
+    def _update_threads(self):
+        """Update available thread count post-construction.
+        To be called any number of times from run() method"""
+        if self.remaining_clusters is not None:
+            self.threads = max(1,self.threads_total//self.remaining_clusters.value)
+        #otherwise just keep the current (initial) value
+        print("{} detected {} threads available to it".format(self.name,self.threads), file = self.log_fh)
+
+    def _report_completion(self):
+        """Update shared counters to signal that we are done with this cluster.
+        Call just before exiting run() method (in a finally clause)"""
+        rem_clust = self.remaining_clusters
+        if rem_clust is not None:
+            # -= is non-atomic, need to acquire a lock
+            with self.remaining_clusters_lock:
+                rem_clust.value -= 1
+            # we do not need this object anymore
+            self.remaining_clusters = None
+            print("{} reported completion".format(self.name), file=self.log_fh)
 
     def _atexit(self):
         if self.log_fh is not None:
             pyfastaq.utils.close(self.log_fh)
             self.log_fh = None
 
-
     def _receive_signal(self, signum, stack):
         print('Signal', signum, 'received in cluster', self.name + '... Stopping!', file=sys.stderr, flush=True)
         if self.log_fh is not None:
@@ -190,7 +214,10 @@ class Cluster:
     def _clean_file(self, filename):
         if self.clean:
             print('Deleting file', filename, file=self.log_fh)
-            os.unlink(filename)
+            try: #protect against OSError: [Errno 16] Device or resource busy: '.nfs0000000010f0f04f000003c9' and such
+                os.unlink(filename)
+            except:
+                pass
 
 
     def _clean(self):
@@ -269,33 +296,39 @@ class Cluster:
             return total_reads
 
 
-    def run(self):
-        self._set_up_input_files()
+    def run(self,remaining_clusters=None,remaining_clusters_lock=None):
+        try:
+            self.remaining_clusters = remaining_clusters
+            self.remaining_clusters_lock = remaining_clusters_lock
+            self._update_threads()
+            self._set_up_input_files()
 
-        for fname in [self.all_reads1, self.all_reads2, self.references_fa]:
-            if not os.path.exists(fname):
-                raise Error('File ' + fname + ' not found. Cannot continue')
+            for fname in [self.all_reads1, self.all_reads2, self.references_fa]:
+                if not os.path.exists(fname):
+                    raise Error('File ' + fname + ' not found. Cannot continue')
 
-        original_dir = os.getcwd()
-        os.chdir(self.root_dir)
+            original_dir = os.getcwd()
+            os.chdir(self.root_dir)
+
+            try:
+                self._run()
+            except Error as err:
+                os.chdir(original_dir)
+                print('Error running cluster! Error was:', err, sep='\n', file=self.log_fh)
+                pyfastaq.utils.close(self.log_fh)
+                self.log_fh = None
+                raise Error('Error running cluster ' + self.name + '!')
 
-        try:
-            self._run()
-        except Error as err:
             os.chdir(original_dir)
-            print('Error running cluster! Error was:', err, sep='\n', file=self.log_fh)
+            print('Finished', file=self.log_fh, flush=True)
+            print('{:_^79}'.format(' LOG FILE END ' + self.name + ' '), file=self.log_fh, flush=True)
+
+            # This stops multiprocessing complaining with the error:
+            # multiprocessing.pool.MaybeEncodingError: Error sending result: '[<ariba.cluster.Cluster object at 0x7ffa50f8bcd0>]'. Reason: 'TypeError("cannot serialize '_io.TextIOWrapper' object",)'
             pyfastaq.utils.close(self.log_fh)
             self.log_fh = None
-            raise Error('Error running cluster ' + self.name + '!')
-
-        os.chdir(original_dir)
-        print('Finished', file=self.log_fh, flush=True)
-        print('{:_^79}'.format(' LOG FILE END ' + self.name + ' '), file=self.log_fh, flush=True)
-
-        # This stops multiprocessing complaining with the error:
-        # multiprocessing.pool.MaybeEncodingError: Error sending result: '[<ariba.cluster.Cluster object at 0x7ffa50f8bcd0>]'. Reason: 'TypeError("cannot serialize '_io.TextIOWrapper' object",)'
-        pyfastaq.utils.close(self.log_fh)
-        self.log_fh = None
+        finally:
+            self._report_completion()
 
 
     def _run(self):
@@ -310,6 +343,7 @@ class Cluster:
             print('\nUsing', made_reads, 'from a total of', self.total_reads, 'for assembly.', file=self.log_fh, flush=True)
             print('Assembling reads:', file=self.log_fh, flush=True)
 
+            self._update_threads()
             self.assembly = assembly.Assembly(
               self.reads_for_assembly1,
               self.reads_for_assembly2,
@@ -323,7 +357,10 @@ class Cluster:
               contig_name_prefix=self.name,
               assembler=self.assembler,
               extern_progs=self.extern_progs,
-              clean=self.clean
+              clean=self.clean,
+              spades_mode=self.spades_mode,
+              spades_options=self.spades_options,
+              threads=self.threads
             )
 
             self.assembly.run()
@@ -332,7 +369,7 @@ class Cluster:
             self._clean_file(self.reads_for_assembly2)
             if self.clean:
                 print('Deleting Assembly directory', self.assembly_dir, file=self.log_fh, flush=True)
-                shutil.rmtree(self.assembly_dir)
+                shutil.rmtree(self.assembly_dir,ignore_errors=True)
 
 
         if self.assembled_ok and self.assembly.ref_seq_name is not None:
@@ -342,13 +379,13 @@ class Cluster:
             self.is_variant_only = '1' if is_variant_only else '0'
 
             print('\nAssembly was successful\n\nMapping reads to assembly:', file=self.log_fh, flush=True)
-
+            self._update_threads()
             mapping.run_bowtie2(
                 self.all_reads1,
                 self.all_reads2,
                 self.final_assembly_fa,
                 self.final_assembly_bam[:-4],
-                threads=1,
+                threads=self.threads,
                 sort=True,
                 bowtie2=self.extern_progs.exe('bowtie2'),
                 bowtie2_preset='very-sensitive-local',
diff --git a/ariba/clusters.py b/ariba/clusters.py
index ae50cd5..60cdd71 100644
--- a/ariba/clusters.py
+++ b/ariba/clusters.py
@@ -14,8 +14,11 @@ from ariba import cluster, common, histogram, mlst_reporter, read_store, report,
 
 class Error (Exception): pass
 
-
-def _run_cluster(obj, verbose, clean, fails_dir):
+# passing shared objects (remaining_clusters) through here and thus making them
+# explicit arguments to Pool.startmap when running this function. That seems to be
+# a recommended safe transfer mechanism as opposed making them attributes of a
+# pre-constructed 'obj' variable (although the docs are a bit hazy on that)
+def _run_cluster(obj, verbose, clean, fails_dir, remaining_clusters, remaining_clusters_lock):
     failed_clusters = os.listdir(fails_dir)
 
     if len(failed_clusters) > 0:
@@ -25,7 +28,7 @@ def _run_cluster(obj, verbose, clean, fails_dir):
     if verbose:
         print('Start running cluster', obj.name, 'in directory', obj.root_dir, flush=True)
     try:
-        obj.run()
+        obj.run(remaining_clusters=remaining_clusters,remaining_clusters_lock=remaining_clusters_lock)
     except:
         print('Failed cluster:', obj.name, file=sys.stderr)
         with open(os.path.join(fails_dir, obj.name), 'w'):
@@ -38,7 +41,10 @@ def _run_cluster(obj, verbose, clean, fails_dir):
         if verbose:
             print('Deleting cluster dir', obj.root_dir, flush=True)
         if os.path.exists(obj.root_dir):
-            shutil.rmtree(obj.root_dir)
+            try:
+                shutil.rmtree(obj.root_dir)
+            except:
+                pass
 
     return obj
 
@@ -56,7 +62,8 @@ class Clusters:
       threads=1,
       verbose=False,
       assembler='fermilite',
-      spades_other=None,
+      spades_mode='rna',
+      spades_options=None,
       max_insert=1000,
       min_scaff_depth=10,
       nucmer_min_id=90,
@@ -86,10 +93,10 @@ class Clusters:
         self.logs_dir = os.path.join(self.outdir, 'Logs')
 
         self.assembler = assembler
-        assert self.assembler in ['fermilite']
         self.assembly_kmer = assembly_kmer
         self.assembly_coverage = assembly_coverage
-        self.spades_other = spades_other
+        self.spades_mode = spades_mode
+        self.spades_options = spades_options
 
         self.cdhit_files_prefix = os.path.join(self.refdata_dir, 'cdhit')
         self.cdhit_cluster_representatives_fa = self.cdhit_files_prefix + '.cluster_representatives.fa'
@@ -135,7 +142,6 @@ class Clusters:
                 os.mkdir(d)
             except:
                 raise Error('Error mkdir ' + d)
-
         if tmp_dir is None:
             if 'ARIBA_TMPDIR' in os.environ:
                 tmp_dir = os.path.abspath(os.environ['ARIBA_TMPDIR'])
@@ -373,6 +379,28 @@ class Clusters:
         cluster_list = []
         self.log_files = []
 
+        # How the thread count withing each Cluster.run is managed:
+        # We want to handle those cases where there are more total threads allocated to the application than there are clusters
+        # remaining to run (for example,
+        # there are only two references, and eight threads). If we keep the default thread value of 1 in cluster. Cluster,
+        # then we will be wasting the allocated threads. The most simple approach would be to divide all threads equally between clusters
+        # before calling Pool.map. Multithreaded external programs like Spades and Bowtie2 are then called with multiple threads. That should
+        # never be slower than keeping just one thread in cluster.Cluster, except maybe in the extreme cases when (if)
+        # a multi-threaded run of the external program takes longer wall-clock time than a single-threaded one.
+        # However, this solution would always keep
+        # Cluster.threads=1 if the initial number of clusters > number of total threads. This can result in inefficiency at the
+        # tail of the Pool.map execution flow - when the clusters are getting finished overall, we are waiting for the completion of
+        # fewer and fewer remaining
+        # single-threaded cluster tasks while more and more total threads are staying idle. We mitigate this through the following approach:
+        # - Create a shared Value object that holds the number of remaining clusters (remaining_clusters).
+        # - Each Cluster.run decrements the remaining_clusters when it completes
+        # - Cluster.run sets its own thread count to max(1,threads_total//remaining_clusters). This can be done as many times
+        #   as needed at various points within Cluster.run (e.g. once before Spades is called, and again before Bowtie2 is called),
+        #   in order to catch more idle threads.
+        # This is a simple and conservative approach to adaptively use all threads at the tail of the map flow. It
+        # never over-subscribes the threads, and it does not require any extra blocking within Cluster.run in order to
+        # wait for threads becoming available.
+
         for cluster_name in sorted(self.cluster_to_dir):
             counter += 1
 
@@ -406,25 +434,56 @@ class Clusters:
                 reads_insert=self.insert_size,
                 sspace_k=self.min_scaff_depth,
                 sspace_sd=self.insert_sspace_sd,
-                threads=1, # clusters now run in parallel, so this should always be 1!
+                threads=1, # initially set to 1, then will adaptively self-modify while running
                 assembled_threshold=self.assembled_threshold,
                 unique_threshold=self.unique_threshold,
                 max_gene_nt_extend=self.max_gene_nt_extend,
-                spades_other_options=self.spades_other,
+                spades_mode=self.spades_mode,
+                spades_options=self.spades_options,
                 clean=self.clean,
                 extern_progs=self.extern_progs,
+                threads_total=self.threads
             ))
-
+        # Here is why we use proxy objects from a Manager process below
+        # instead of simple shared multiprocessing.Value counter:
+        # Shared memory objects in multiprocessing use tempfile module to
+        # create temporary directory, then create temporary file inside it,
+        # memmap the file and unlink it. If TMPDIR envar points to a NFS
+        # mount, the final cleanup handler from multiprocessing will often
+        # return an exception due to a stale NFS file (.nfsxxxx) from a shutil.rmtree
+        # call. See help on tempfile.gettempdir() for how the default location of
+        # temporary files is selected. The exception is caught in except clause
+        # inside multiprocessing cleanup, and only a harmless traceback is printed,
+        # but it looks very spooky to the user and causes confusion. We use
+        # instead shared proxies from the Manager. Those do not rely on shared
+        # memory, and thus bypass the NFS issues. The counter is accesses infrequently
+        # relative to computations, so the performance does not suffer.
+        # default authkey in the manager will be some generated random-looking string
+        manager = multiprocessing.Manager()
+        remaining_clusters = manager.Value('l',len(cluster_list))
+        # manager.Value does not provide access to the internal RLock that we need for
+        # implementing atomic -=, so we need to carry around a separate RLock object.
+        remaining_clusters_lock = manager.RLock()
         try:
             if self.threads > 1:
                 self.pool = multiprocessing.Pool(self.threads)
-                cluster_list = self.pool.starmap(_run_cluster, zip(cluster_list, itertools.repeat(self.verbose), itertools.repeat(self.clean), itertools.repeat(self.fails_dir)))
+                cluster_list = self.pool.starmap(_run_cluster, zip(cluster_list, itertools.repeat(self.verbose), itertools.repeat(self.clean), itertools.repeat(self.fails_dir),
+                                                                   itertools.repeat(remaining_clusters),itertools.repeat(remaining_clusters_lock)))
+                # harvest the pool as soon as we no longer need it
+                self.pool.close()
+                self.pool.join()
             else:
                 for c in cluster_list:
-                    _run_cluster(c, self.verbose, self.clean, self.fails_dir)
+                    _run_cluster(c, self.verbose, self.clean, self.fails_dir, remaining_clusters, remaining_clusters_lock)
         except:
             self.clusters_all_ran_ok = False
 
+        if self.verbose:
+            print('Final value of remaining_clusters counter:', remaining_clusters)
+        remaining_clusters = None
+        remaining_clusters_lock = None
+        manager.shutdown()
+
         if len(os.listdir(self.fails_dir)) > 0:
             self.clusters_all_ran_ok = False
 
@@ -498,7 +557,7 @@ class Clusters:
 
     def _clean(self):
         if self.clean:
-            shutil.rmtree(self.fails_dir)
+            shutil.rmtree(self.fails_dir,ignore_errors=True)
 
             try:
                 self.tmp_dir_obj.cleanup()
@@ -507,10 +566,7 @@ class Clusters:
 
             if self.verbose:
                 print('Deleting Logs directory', self.logs_dir)
-            try:
-                shutil.rmtree(self.logs_dir)
-            except:
-                pass
+            shutil.rmtree(self.logs_dir,ignore_errors=True)
 
             try:
                 if self.verbose:
@@ -551,67 +607,68 @@ class Clusters:
 
     def _run(self):
         cwd = os.getcwd()
-        os.chdir(self.outdir)
-        self.write_versions_file(cwd)
-        self._map_and_cluster_reads()
-        self.log_files = None
-
-        if len(self.cluster_to_dir) > 0:
-            got_insert_data_ok = self._set_insert_size_data()
-            if not got_insert_data_ok:
-                print('WARNING: not enough proper read pairs (found ' + str(self.proper_pairs) + ') to determine insert size.', file=sys.stderr)
-                print('This probably means that very few reads were mapped at all. No local assemblies will be run', file=sys.stderr)
-                if self.verbose:
-                    print('Not enough proper read pairs mapped to determine insert size. Skipping all assemblies.', flush=True)
+        try:
+            os.chdir(self.outdir)
+            self.write_versions_file(cwd)
+            self._map_and_cluster_reads()
+            self.log_files = None
+
+            if len(self.cluster_to_dir) > 0:
+                got_insert_data_ok = self._set_insert_size_data()
+                if not got_insert_data_ok:
+                    print('WARNING: not enough proper read pairs (found ' + str(self.proper_pairs) + ') to determine insert size.', file=sys.stderr)
+                    print('This probably means that very few reads were mapped at all. No local assemblies will be run', file=sys.stderr)
+                    if self.verbose:
+                        print('Not enough proper read pairs mapped to determine insert size. Skipping all assemblies.', flush=True)
+                else:
+                    if self.verbose:
+                        print('{:_^79}'.format(' Assembling each cluster '))
+                        print('Will run', self.threads, 'cluster(s) in parallel', flush=True)
+                    self._init_and_run_clusters()
+                    if self.verbose:
+                        print('Finished assembling clusters\n')
             else:
                 if self.verbose:
-                    print('{:_^79}'.format(' Assembling each cluster '))
-                    print('Will run', self.threads, 'cluster(s) in parallel', flush=True)
-                self._init_and_run_clusters()
-                if self.verbose:
-                    print('Finished assembling clusters\n')
-        else:
-            if self.verbose:
-                print('No reads mapped. Skipping all assemblies', flush=True)
-            print('WARNING: no reads mapped to reference genes. Therefore no local assemblies will be run', file=sys.stderr)
+                    print('No reads mapped. Skipping all assemblies', flush=True)
+                print('WARNING: no reads mapped to reference genes. Therefore no local assemblies will be run', file=sys.stderr)
 
-        if not self.clusters_all_ran_ok:
-            raise Error('At least one cluster failed! Stopping...')
+            if not self.clusters_all_ran_ok:
+                raise Error('At least one cluster failed! Stopping...')
 
-        if self.verbose:
-            print('{:_^79}'.format(' Writing reports '), flush=True)
-            print('Making', self.report_file_all_tsv)
-        self._write_report(self.clusters, self.report_file_all_tsv)
+            if self.verbose:
+                print('{:_^79}'.format(' Writing reports '), flush=True)
+                print('Making', self.report_file_all_tsv)
+            self._write_report(self.clusters, self.report_file_all_tsv)
 
-        if self.verbose:
-            print('Making', self.report_file_filtered)
-        rf = report_filter.ReportFilter(infile=self.report_file_all_tsv)
-        rf.run(self.report_file_filtered)
+            if self.verbose:
+                print('Making', self.report_file_filtered)
+            rf = report_filter.ReportFilter(infile=self.report_file_all_tsv)
+            rf.run(self.report_file_filtered)
 
-        if self.verbose:
-            print()
-            print('{:_^79}'.format(' Writing fasta of assembled sequences '), flush=True)
-            print(self.catted_assembled_seqs_fasta, 'and', self.catted_genes_matching_refs_fasta, flush=True)
-        self._write_catted_assembled_seqs_fasta(self.catted_assembled_seqs_fasta)
-        self._write_catted_genes_matching_refs_fasta(self.catted_genes_matching_refs_fasta)
-        self._write_catted_assemblies_fasta(self.catted_assemblies_fasta)
-
-        if self.log_files is not None:
-            clusters_log_file = os.path.join(self.outdir, 'log.clusters.gz')
             if self.verbose:
                 print()
-                print('{:_^79}'.format(' Catting cluster log files '), flush=True)
-                print('Writing file', clusters_log_file, flush=True)
-            common.cat_files(self.log_files, clusters_log_file)
-
-        if self.verbose:
-            print()
-            print('{:_^79}'.format(' Cleaning files '), flush=True)
-        self._clean()
+                print('{:_^79}'.format(' Writing fasta of assembled sequences '), flush=True)
+                print(self.catted_assembled_seqs_fasta, 'and', self.catted_genes_matching_refs_fasta, flush=True)
+            self._write_catted_assembled_seqs_fasta(self.catted_assembled_seqs_fasta)
+            self._write_catted_genes_matching_refs_fasta(self.catted_genes_matching_refs_fasta)
+            self._write_catted_assemblies_fasta(self.catted_assemblies_fasta)
+
+            if self.log_files is not None:
+                clusters_log_file = os.path.join(self.outdir, 'log.clusters.gz')
+                if self.verbose:
+                    print()
+                    print('{:_^79}'.format(' Catting cluster log files '), flush=True)
+                    print('Writing file', clusters_log_file, flush=True)
+                common.cat_files(self.log_files, clusters_log_file)
 
-        Clusters._write_mlst_reports(self.mlst_profile_file, self.report_file_filtered, self.mlst_reports_prefix, verbose=self.verbose)
+            if self.verbose:
+                print()
+                print('{:_^79}'.format(' Cleaning files '), flush=True)
+            self._clean()
 
-        if self.clusters_all_ran_ok and self.verbose:
-            print('\nAll done!\n')
+            Clusters._write_mlst_reports(self.mlst_profile_file, self.report_file_filtered, self.mlst_reports_prefix, verbose=self.verbose)
 
-        os.chdir(cwd)
+            if self.clusters_all_ran_ok and self.verbose:
+                print('\nAll done!\n')
+        finally:
+            os.chdir(cwd)
diff --git a/ariba/common.py b/ariba/common.py
index 0410334..92ab3c9 100644
--- a/ariba/common.py
+++ b/ariba/common.py
@@ -9,11 +9,13 @@ import pyfastaq
 class Error (Exception): pass
 
 
-def syscall(cmd, allow_fail=False, verbose=False, verbose_filehandle=sys.stdout, print_errors=True):
+def syscall(cmd, allow_fail=False, verbose=False, verbose_filehandle=sys.stdout, print_errors=True, shell=True):
     if verbose:
         print('syscall:', cmd, flush=True, file=verbose_filehandle)
+        if not shell:
+            print('syscall string:', " ".join('"{}"'.format(_) for _ in cmd), flush=True, file=verbose_filehandle)
     try:
-        subprocess.check_output(cmd, shell=True, stderr=subprocess.STDOUT)
+        subprocess.check_output(cmd, shell=shell, stderr=subprocess.STDOUT)
     except subprocess.CalledProcessError as error:
         errors = error.output.decode()
         if print_errors:
@@ -26,7 +28,9 @@ def syscall(cmd, allow_fail=False, verbose=False, verbose_filehandle=sys.stdout,
             return False, errors
         else:
             sys.exit(1)
-
+    except Exception as msg:
+        print("Unexpected exception: ", msg, file=sys.stderr)
+        raise
     return True, None
 
 
diff --git a/ariba/external_progs.py b/ariba/external_progs.py
index dbbe077..dfcd4e6 100644
--- a/ariba/external_progs.py
+++ b/ariba/external_progs.py
@@ -13,6 +13,7 @@ prog_to_default = {
     'bowtie2': 'bowtie2',
     'cdhit': 'cd-hit-est',
     'nucmer' : 'nucmer',
+    'spades' : 'spades.py'
 }
 
 
@@ -23,6 +24,7 @@ prog_to_version_cmd = {
     'bowtie2': ('--version', re.compile('.*bowtie2.*version (.*)$')),
     'cdhit': ('', re.compile('CD-HIT version ([0-9\.]+) \(')),
     'nucmer': ('--version', re.compile('^NUCmer \(NUCleotide MUMmer\) version ([0-9\.]+)')),
+    'spades': ('--version', re.compile('SPAdes\s+v([0-9\.]+)'))
 }
 
 
@@ -30,8 +32,12 @@ min_versions = {
     'bowtie2': '2.1.0',
     'cdhit': '4.6',
     'nucmer': '3.1',
+    'spades': '3.11.0'
 }
 
+prog_optional = set([
+    'spades'
+])
 
 class ExternalProgs:
     def __init__(self, verbose=False, fail_on_error=True):
@@ -47,11 +53,15 @@ class ExternalProgs:
         warnings = []
 
         for prog in sorted(prog_to_default):
+            msg_sink = errors
+            if prog in prog_optional:
+                msg_sink = warnings
+
             prog_exe = self._get_exe(prog)
             self.progs[prog] = shutil.which(prog_exe)
 
             if self.progs[prog] is None:
-                errors.append(prog + ' not found in path. Looked for ' + prog_exe)
+                msg_sink.append(prog + ' not found in path. Looked for ' + prog_exe)
 
                 self.version_report.append('\t'.join([prog, 'NA', 'NOT_FOUND']))
                 if verbose:
@@ -63,10 +73,10 @@ class ExternalProgs:
             if got_version:
                 self.versions[prog] = version
                 if prog in min_versions and LooseVersion(version) < LooseVersion(min_versions[prog]):
-                    errors.append(' '.join(['Found version', version, 'of', prog, 'which is too low! Please update to at least', min_versions[prog] + '. Found it here:', prog_exe]))
+                    msg_sink.append(' '.join(['Found version', version, 'of', prog, 'which is too low! Please update to at least', min_versions[prog] + '. Found it here:', prog_exe]))
             else:
                 self.versions[prog] = None
-                errors.append(version)
+                msg_sink.append(version)
                 version = 'ERROR'
 
             self.version_report.append('\t'.join([prog, version, self.progs[prog]]))
diff --git a/ariba/mic_plotter.py b/ariba/mic_plotter.py
index 644e5b2..7948689 100644
--- a/ariba/mic_plotter.py
+++ b/ariba/mic_plotter.py
@@ -5,6 +5,8 @@ import re
 import os
 import itertools
 import collections
+import matplotlib
+matplotlib.use('Agg')
 import matplotlib.pyplot as plt
 import matplotlib.gridspec as gridspec
 import matplotlib.cm as cmx
diff --git a/ariba/tasks/run.py b/ariba/tasks/run.py
index db3bd32..75f484f 100644
--- a/ariba/tasks/run.py
+++ b/ariba/tasks/run.py
@@ -47,7 +47,7 @@ def run(options):
           extern_progs,
           version_report_lines=version_report_lines,
           assembly_coverage=options.assembly_cov,
-          assembler='fermilite',
+          assembler=options.assembler,
           threads=options.threads,
           verbose=options.verbose,
           min_scaff_depth=options.min_scaff_depth,
@@ -59,6 +59,8 @@ def run(options):
           max_gene_nt_extend=options.gene_nt_extend,
           clean=(not options.noclean),
           tmp_dir=options.tmp_dir,
+          spades_mode=options.spades_mode,
+          spades_options=options.spades_options
         )
     c.run()
 
diff --git a/ariba/tests/assembly_test.py b/ariba/tests/assembly_test.py
index f33f2c5..0636849 100644
--- a/ariba/tests/assembly_test.py
+++ b/ariba/tests/assembly_test.py
@@ -5,10 +5,11 @@ import shutil
 import filecmp
 import pyfastaq
 from ariba import assembly
+from ariba import external_progs
 
 modules_dir = os.path.dirname(os.path.abspath(assembly.__file__))
 data_dir = os.path.join(modules_dir, 'tests', 'data')
-
+extern_progs = external_progs.ExternalProgs()
 
 class TestAssembly(unittest.TestCase):
     def test_run_fermilite(self):
@@ -102,3 +103,48 @@ class TestAssembly(unittest.TestCase):
         os.unlink(bam + '.unmapped_mates')
         os.unlink(bam + '.scaff')
 
+    def test_check_spades_log_file(self):
+        '''test _check_spades_log_file'''
+        good_file = os.path.join(data_dir, 'assembly_test_check_spades_log_file.log.good')
+        bad_file = os.path.join(data_dir, 'assembly_test_check_spades_log_file.log.bad')
+        self.assertTrue(assembly.Assembly._check_spades_log_file(good_file))
+        with self.assertRaises(assembly.Error):
+            self.assertTrue(assembly.Assembly._check_spades_log_file(bad_file))
+
+    @unittest.skipUnless(extern_progs.exe('spades'), "Spades assembler is optional and is not configured")
+    def test_assemble_with_spades(self):
+        '''test _assemble_with_spades'''
+        reads1 = os.path.join(data_dir, 'assembly_test_assemble_with_spades_reads_1.fq')
+        reads2 = os.path.join(data_dir, 'assembly_test_assemble_with_spades_reads_2.fq')
+        tmp_dir = 'tmp.test_assemble_with_spades'
+        tmp_log = 'tmp.test_assemble_with_spades.log'
+        with open(tmp_log, 'w') as tmp_log_fh:
+            print('First line', file=tmp_log_fh)
+            shutil.rmtree(tmp_dir, ignore_errors=True)
+            #using spades_options=" --only-assembler" because error correction cannot determine quality offset on this
+            #artificial dataset
+            a = assembly.Assembly(reads1, reads2, 'not needed', 'not needed', tmp_dir, 'not_needed_for_this_test.fa',
+                                  'not_needed_for_this_test.bam', tmp_log_fh, 'not needed',
+                                  assembler="spades", spades_options=" --only-assembler")
+            a._assemble_with_spades()
+        self.assertTrue(a.assembled_ok)
+        shutil.rmtree(tmp_dir,ignore_errors=True)
+        os.unlink(tmp_log)
+
+    @unittest.skipUnless(extern_progs.exe('spades'), "Spades assembler is optional and is not configured")
+    def test_assemble_with_spades_fail(self):
+        '''test _assemble_with_spades handles spades fail'''
+        reads1 = os.path.join(data_dir, 'assembly_test_assemble_with_spades_fails_reads_1.fq')
+        reads2 = os.path.join(data_dir, 'assembly_test_assemble_with_spades_fails_reads_2.fq')
+        tmp_dir = 'tmp.test_assemble_with_spades_fail'
+        tmp_log = 'tmp.test_assemble_with_spades_fail.log'
+        with open(tmp_log, 'w') as tmp_log_fh:
+            print('First line', file=tmp_log_fh)
+            shutil.rmtree(tmp_dir, ignore_errors=True)
+            a = assembly.Assembly(reads1, reads2, 'not needed', 'not needed', tmp_dir, 'not_needed_for_this_test.fa',
+                                  'not_needed_for_this_test.bam', tmp_log_fh, 'not needed',
+                                  assembler="spades", spades_options=" --only-assembler")
+            a._assemble_with_spades()
+        self.assertFalse(a.assembled_ok)
+        shutil.rmtree(tmp_dir,ignore_errors=True)
+        os.unlink(tmp_log)
diff --git a/ariba/tests/cluster_test.py b/ariba/tests/cluster_test.py
index 754c7a5..ea7c078 100644
--- a/ariba/tests/cluster_test.py
+++ b/ariba/tests/cluster_test.py
@@ -43,6 +43,7 @@ class TestCluster(unittest.TestCase):
         dirs = [os.path.join(data_dir, d) for d in dirs]
         for d in dirs:
             tmpdir = 'tmp.cluster_test_init_fail_files_missing'
+            shutil.rmtree(tmpdir,ignore_errors=True)
             shutil.copytree(d, tmpdir)
             with self.assertRaises(cluster.Error):
                 cluster.Cluster(tmpdir, 'name', refdata=refdata, total_reads=42, total_reads_bases=4242)
@@ -100,6 +101,7 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_no_reads_after_filtering.in.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.test_full_run_no_reads_after_filtering'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_no_reads_after_filtering'), tmpdir)
 
         c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=0, total_reads_bases=0)
@@ -118,9 +120,10 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_choose_ref_fail.in.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.test_full_run_choose_ref_fail'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_choose_ref_fail'), tmpdir)
 
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=2, total_reads_bases=108, spades_other_options='--only-assembler')
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=2, total_reads_bases=108)
         c.run()
 
         expected = '\t'.join(['.', '.', '.', '.', '1024', '2', 'cluster_name'] + ['.'] * 24)
@@ -137,9 +140,10 @@ class TestCluster(unittest.TestCase):
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.test_full_run_ref_not_in_cluster'
         all_refs_fa =  os.path.join(data_dir, 'cluster_test_full_run_ref_not_in_cluster.all_refs.fa')
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ref_not_in_cluster'), tmpdir)
 
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=72, total_reads_bases=3600, all_ref_seqs_fasta=all_refs_fa)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=72, total_reads_bases=3600, all_ref_seqs_fasta=all_refs_fa)
         c.run()
 
         expected = '\t'.join(['.', '.', '.', '.', '1024', '72', 'cluster_name'] + ['.'] * 24)
@@ -155,6 +159,7 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_assembly_fail.in.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.test_full_run_assembly_fail'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_assembly_fail'), tmpdir)
 
         c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=4, total_reads_bases=304)
@@ -173,9 +178,10 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_ok_non_coding.metadata.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.test_full_run_ok_non_coding'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ok_non_coding'), tmpdir)
 
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=72, total_reads_bases=3600)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=72, total_reads_bases=3600)
         c.run()
 
         self.maxDiff=None
@@ -198,9 +204,10 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_ok_presence_absence.metadata.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_ok_presence_absence'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ok_presence_absence'), tmpdir)
 
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=64, total_reads_bases=3200)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=64, total_reads_bases=3200)
         c.run()
 
         expected = [
@@ -220,9 +227,10 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_ok_variants_only.not_present.metadata.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_ok_variants_only.not_present'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ok_variants_only'), tmpdir)
 
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=66, total_reads_bases=3300)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=66, total_reads_bases=3300)
         c.run()
         expected = [
             'variants_only1\tvariants_only1\t1\t1\t27\t66\tcluster_name\t96\t96\t100.0\tcluster_name.l15.c30.ctg.1\t215\t15.3\t1\tSNP\tp\tR3S\t0\t.\t.\t7\t9\tCGC\t65\t67\tCGC\t18;18;19\tC;G;C\t18;18;19\tvariants_only1:1:1:R3S:.:Ref and assembly have wild type, so do not report\tGeneric description of variants_only1'
@@ -237,9 +245,10 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_full_run_varonly.not_present.always_report.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_full_run_varonly.not_present.always_report'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ok_variants_only'), tmpdir)
 
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=66, total_reads_bases=3300)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=66, total_reads_bases=3300)
         c.run()
         expected = [
             'variants_only1\tvariants_only1\t1\t1\t27\t66\tcluster_name\t96\t96\t100.0\tcluster_name.l15.c30.ctg.1\t215\t15.3\t1\tSNP\tp\tR3S\t0\t.\t.\t7\t9\tCGC\t65\t67\tCGC\t18;18;19\tC;G;C\t18;18;19\tvariants_only1:1:1:R3S:.:Ref and assembly have wild type, but always report anyway\tGeneric description of variants_only1'
@@ -254,9 +263,10 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_ok_variants_only.present.metadata.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_ok_variants_only.present'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ok_variants_only'), tmpdir)
 
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=66, total_reads_bases=3300)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=66, total_reads_bases=3300)
         c.run()
 
         expected = [
@@ -273,8 +283,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_ok_gene_start_mismatch.metadata.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_ok_gene_start_mismatch'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ok_gene_start_mismatch'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=112, total_reads_bases=1080)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=112, total_reads_bases=1080)
         c.run()
         expected = [
             'gene\tgene\t1\t0\t27\t112\tcluster_name\t96\t96\t100.0\tcluster_name.l6.c30.ctg.1\t362\t27.8\t.\t.\t.\t.\t.\t.\t.\t.\t.\t.\t.\t.\t.\t.\t.\t.\t.\tGeneric description of gene'
@@ -289,8 +300,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_full_run_smtls_snp_presabs_gene.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_ok_samtools_snp_pres_abs_gene'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_full_run_smtls_snp_presabs_gene'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=148, total_reads_bases=13320)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=148, total_reads_bases=13320)
         c.run()
         expected = [
             'ref_gene\tref_gene\t1\t0\t155\t148\tcluster_name\t96\t96\t100.0\tcluster_name.l15.c30.ctg.1\t335\t39.8\t0\tHET\t.\t.\t.\tG18A\t.\t18\t18\tG\t137\t137\tG\t63\tG,A\t32,31\t.\tGeneric description of ref_gene'
@@ -307,8 +319,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_full_run_smtls_snp_varonly_gene_2.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_full_run_smtls_snp_varonly_gene_2'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_full_run_smtls_snp_varonly_gene_2'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=148, total_reads_bases=13320)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=148, total_reads_bases=13320)
         c.run()
         expected = [
             'ref_gene\tref_gene\t1\t1\t155\t148\tcluster_name\t96\t96\t100.0\tcluster_name.l15.c30.ctg.1\t335\t39.8\t0\tHET\t.\t.\t.\tG18A\t.\t18\t18\tG\t137\t137\tG\t63\tG,A\t32,31\t.\tGeneric description of ref_gene'
@@ -323,8 +336,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_full_run_known_smtls_snp_presabs_gene.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_ok_samtools_snp_known_position_pres_abs_gene'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_full_run_known_smtls_snp_presabs_gene'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=148, total_reads_bases=13320)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=148, total_reads_bases=13320)
         c.run()
 
         # We shouldn't get an extra 'HET' line because we already know about the snp, so
@@ -342,8 +356,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_full_run_smtls_snp_varonly_gene_no_snp.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_smtls_snp_varonly_gene_no_snp'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_full_run_smtls_snp_varonly_gene_no_snp'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=148, total_reads_bases=13320)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=148, total_reads_bases=13320)
         c.run()
 
         # We shouldn't get an extra 'HET' line because we already know about the snp, so
@@ -361,8 +376,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_full_run_smtls_snp_varonly_gene.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_ok_samtools_snp_known_position_var_only_gene_does_have_var'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_full_run_smtls_snp_varonly_gene'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=148, total_reads_bases=13320)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=148, total_reads_bases=13320)
         c.run()
 
         # We shouldn't get an extra 'HET' line because we already know about the snp, so
@@ -380,8 +396,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_full_run_smtls_snp_presabs_nonc.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_smtls_snp_presabs_nonc'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_full_run_smtls_snp_presabs_nonc'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=148, total_reads_bases=13320)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=148, total_reads_bases=13320)
         c.run()
         expected = [
             'ref_seq\tref_seq\t0\t0\t147\t148\tcluster_name\t96\t96\t100.0\tcluster_name.l15.c30.ctg.1\t335\t39.8\t0\tHET\t.\t.\t.\tG18A\t.\t18\t18\tG\t137\t137\tG\t63\tG,A\t32,31\t.\tGeneric description of ref_seq'
@@ -396,8 +413,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_full_run_smtls_known_snp_presabs_nonc.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_smtls_known_snp_presabs_nonc'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_full_run_smtls_known_snp_presabs_nonc'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=148, total_reads_bases=13320)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=148, total_reads_bases=13320)
         c.run()
         expected = [
             'ref_seq\tref_seq\t0\t0\t147\t148\tcluster_name\t96\t96\t100.0\tcluster_name.l15.c30.ctg.1\t335\t39.8\t1\tSNP\tn\tG18A\t0\t.\t.\t18\t18\tG\t137\t137\tG\t63\tG,A\t32,31\tref_seq:0:0:G18A:.:Description of G18A\tGeneric description of ref_seq'
@@ -412,8 +430,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_full_run_smtls_snp_varonly_nonc.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_full_run_smtls_snp_varonly_nonc'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_full_run_smtls_snp_varonly_nonc'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=148, total_reads_bases=13320)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=148, total_reads_bases=13320)
         c.run()
         expected = [
             'ref_seq\tref_seq\t0\t1\t147\t148\tcluster_name\t96\t96\t100.0\tcluster_name.l15.c30.ctg.1\t335\t39.8\t0\tHET\t.\t.\t.\tG18A\t.\t18\t18\tG\t137\t137\tG\t63\tG,A\t32,31\t.\tGeneric description of ref_seq'
@@ -428,8 +447,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_full_run_known_smtls_snp_presabs_nonc.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_ok_samtools_snp_known_position_pres_abs_noncoding'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_full_run_known_smtls_snp_presabs_nonc'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=148, total_reads_bases=13320)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=148, total_reads_bases=13320)
         c.run()
 
         # We shouldn't get an extra 'HET' line because we already know about the snp, so
@@ -447,8 +467,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_full_run_smtls_snp_varonly_nonc_no_snp.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_ok_samtools_snp_known_position_var_only_noncoding'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_full_run_smtls_snp_varonly_nonc_no_snp'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=148, total_reads_bases=13320)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=148, total_reads_bases=13320)
         c.run()
 
         # We shouldn't get an extra 'HET' line because we already know about the snp, so
@@ -466,8 +487,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_smtls_snp_varonly_nonc.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_ok_samtools_snp_known_position_var_only_noncoding'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_smtls_snp_varonly_nonc'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=148, total_reads_bases=13320)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=148, total_reads_bases=13320)
         c.run()
 
         # We shouldn't get an extra 'HET' line because we already know about the snp, so
@@ -485,8 +507,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_partial_asmbly.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_partial_assembly'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_partial_asmbly'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=278, total_reads_bases=15020)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=278, total_reads_bases=15020)
         c.run()
 
         expected = [
@@ -502,8 +525,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_multiple_vars.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_run_multiple_vars'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_multiple_vars'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=292, total_reads_bases=20900)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=292, total_reads_bases=20900)
         c.run()
 
         expected = [
@@ -520,8 +544,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_delete_codon.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_delete_codon'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_delete_codon'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=292, total_reads_bases=20900)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=292, total_reads_bases=20900)
         c.run()
 
         expected = [
@@ -537,8 +562,9 @@ class TestCluster(unittest.TestCase):
         tsv_in = os.path.join(data_dir, 'cluster_test_full_run_insert_codon.tsv')
         refdata = reference_data.ReferenceData([fasta_in], [tsv_in])
         tmpdir = 'tmp.cluster_test_full_insert_codon'
+        shutil.rmtree(tmpdir, ignore_errors=True)
         shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_insert_codon'), tmpdir)
-        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, spades_other_options='--only-assembler', total_reads=292, total_reads_bases=20900)
+        c = cluster.Cluster(tmpdir, 'cluster_name', refdata, total_reads=292, total_reads_bases=20900)
         c.run()
 
         expected = [
diff --git a/ariba/tests/data/assembly_test_assemble_with_spades_fails_reads_1.fq b/ariba/tests/data/assembly_test_assemble_with_spades_fails_reads_1.fq
new file mode 100644
index 0000000..15574dd
--- /dev/null
+++ b/ariba/tests/data/assembly_test_assemble_with_spades_fails_reads_1.fq
@@ -0,0 +1,4 @@
+ at read1/1
+CACGTTCGTCGTGATGACTGACGTCACGAGCTCTGCGTACGTCATCTAGCGTATCGTACTGACTGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
diff --git a/ariba/tests/data/assembly_test_assemble_with_spades_fails_reads_2.fq b/ariba/tests/data/assembly_test_assemble_with_spades_fails_reads_2.fq
new file mode 100644
index 0000000..4274d1d
--- /dev/null
+++ b/ariba/tests/data/assembly_test_assemble_with_spades_fails_reads_2.fq
@@ -0,0 +1,5 @@
+ at read1/2
+CACGTTCGTCGTGATGACTGACGTCACGAGCTCTGCGTACGTCATCTAGCGTATCGTACTGACTGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+
diff --git a/ariba/tests/data/assembly_test_assemble_with_spades_reads_1.fq b/ariba/tests/data/assembly_test_assemble_with_spades_reads_1.fq
new file mode 100644
index 0000000..c367e21
--- /dev/null
+++ b/ariba/tests/data/assembly_test_assemble_with_spades_reads_1.fq
@@ -0,0 +1,232 @@
+ at 1:1:82:186/1
+GCTCTAAGTCCAACTCTGGCACCAGCTACAACTCTAATTGATATCCAACAAGACCTGTTAACATACGATGCGGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:2:6:109/1
+GGCTTTAGCCTGGCCCAATGCCCTGAGTGGCCCTCCCTTGACTAACTCTGACGCGATCAGAGGGCTAAAGTTTGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:3:1:106/1
+CTCGCGGCTTTAGCCTGGCCCAATGCCCTGAGTGGCCCTCCCTTGACTAACTCTGACGCGATCAGAGGGCTAAAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:4:33:136/1
+TGGCCCTCCCTTGACTAACTCTGACGCGATCAGAGGGCTAAAGTTTGTAGCTCTAAGTCCAACTCTGGCACCAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:5:196:299/1
+CCTTCTACTCCCATTGTCTTTGACGCTTTCTGATGTCAGTCGCCGGAGACCAGCTGTCTCCCTAGGGCGTTTAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:6:63:168/1
+CAGAGGGCTAAAGTTTGTAGCTCTAAGTCCAACTCTGGCACCAGCTACAACTCTAATTGATATCCAACAAGACCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:7:10:111/1
+TTAGCCTGGCCCAATGCCCTGAGTGGCCCTCCCTTGACTAACTCTGACGCGATCAGAGGGCTAAAGTTTGTAGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:8:74:178/1
+AGTTTGTAGCTCTAAGTCCAACTCTGGCACCAGCTACAACTCTAATTGATATCCAACAAGACCTGTTAACATACGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:9:84:186/1
+TCTAAGTCCAACTCTGGCACCAGCTACAACTCTAATTGATATCCAACAAGACCTGTTAACATACGATGCGGAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:1:41:144/1
+CCTTGACTAACTCTGACGCGATCATAGGGCTAAAGTTTGTAGCTCTAAGTCCAACTCTGGCACCAGCTACAACTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:2:144:247/1
+ATACGATGCGGAGGGACTAGAGTCTCATCGTGCTCTGACGATTATATGTTGACCTTCTACTCCCATTGTCTTTGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:3:225:329/1
+CTGATGTCAGTCGCCGGAGACCAGCTGTCTCCCTAGGGCGTATAGGTGTTCCGGATACCCGTCCTCAGGCGGTGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:4:237:340/1
+GCCGGAGACCAGCTGTCTCCCTAGGGCGTATAGGTGTTCCGGATACCCGTCCTCAGGCGGTGCGTATGCTTGAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:5:45:151/1
+GACTAACTCTGACGCGATCATAGGGCTAAAGTTTGTAGCTCTAAGTCCAACTCTGGCACCAGCTACAACTCTAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:6:284:386/1
+CGTCCTCAGGCGGTGCGTATGCTTGAGTCGGTAATATCGTCCGGACTCATCCCTACTCTTACAACTTACGTGGTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:7:305:407/1
+CTTGAGTCGGTAATATCGTCCGGACTCATCCCTACTCTTACAACTTACGTGGTTACGCTTACCCAGAGAAATATGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:8:213:317/1
+CTTTGACGCTTTCTGATGTCAGTCGCCGGAGACCAGCTGTCTCCCTAGGGCGTATAGGTGTTCCGGATACCCGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:9:183:287/1
+GATTATATGTTGACCTTCTACTCCCATTGTCTTTGACGCTTTCTGATGTCAGTCGCCGGAGACCAGCTGTCTCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:10:289:393/1
+TCAGGCGGTGCGTATGCTTGAGTCGGTAATATCGTCCGGACTCATCCCTACTCTTACAACTTACGTGGTTACGCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:11:296:399/1
+GTGCGTATGCTTGAGTCGGTAATATCGTCCGGACTCATCCCTACTCTTACAACTTACGTGGTTACGCTTACCCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:12:270:373/1
+GTGTTCCGGATACCCGTCCTCAGGCGGTGCGTATGCTTGAGTCGGTAATATCGTCCGGACTCATCCCTACTCTTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:13:167:271/1
+CTCATCGTGCTCTGACGATTATATGTTGACCTTCTACTCCCATTGTCTTTGACGCTTTCTGATGTCAGTCGCCGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:14:43:147/1
+TTGACTAACTCTGACGCGATCATAGGGCTAAAGTTTGTAGCTCTAAGTCCAACTCTGGCACCAGCTACAACTCTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:15:323:424/1
+TCCGGACTCATCCCTACTCTTACAACTTACGTGGTTACGCTTACCCAGAGAAATATGTGCGCTACCTGCTTAGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:16:105:207/1
+AGCTACAACTCTAATTGATATCCAACAAGACCTGTTAACATACGATGCGGAGGGACTAGAGTCTCATCGTGCTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:17:237:341/1
+GCCGGAGACCAGCTGTCTCCCTAGGGCGTATAGGTGTTCCGGATACCCGTCCTCAGGCGGTGCGTATGCTTGAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:18:3:107/1
+CGCGGCTTTAGCCTGGCCCAATGCCCTGAGTGGCCCTCCCTTGACTAACTCTGACGCGATCATAGGGCTAAAGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:19:272:374/1
+GTTCCGGATACCCGTCCTCAGGCGGTGCGTATGCTTGAGTCGGTAATATCGTCCGGACTCATCCCTACTCTTACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:20:251:354/1
+GTCTCCCTAGGGCGTATAGGTGTTCCGGATACCCGTCCTCAGGCGGTGCGTATGCTTGAGTCGGTAATATCGTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:21:95:199/1
+CTCTGGCACCAGCTACAACTCTAATTGATATCCAACAAGACCTGTTAACATACGATGCGGAGGGACTAGAGTCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:22:96:199/1
+TCTGGCACCAGCTACAACTCTAATTGATATCCAACAAGACCTGTTAACATACGATGCGGAGGGACTAGAGTCTCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:23:94:197/1
+ACTCTGGCACCAGCTACAACTCTAATTGATATCCAACAAGACCTGTTAACATACGATGCGGAGGGACTAGAGTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:24:185:289/1
+TTATATGTTGACCTTCTACTCCCATTGTCTTTGACGCTTTCTGATGTCAGTCGCCGGAGACCAGCTGTCTCCCTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:25:152:256/1
+CGGAGGGACTAGAGTCTCATCGTGCTCTGACGATTATATGTTGACCTTCTACTCCCATTGTCTTTGACGCTTTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:26:285:389/1
+GTCCTCAGGCGGTGCGTATGCTTGAGTCGGTAATATCGTCCGGACTCATCCCTACTCTTACAACTTACGTGGTTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:27:137:241/1
+TGTTAACATACGATGCGGAGGGACTAGAGTCTCATCGTGCTCTGACGATTATATGTTGACCTTCTACTCCCATTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:28:261:365/1
+GGCGTATAGGTGTTCCGGATACCCGTCCTCAGGCGGTGCGTATGCTTGAGTCGGTAATATCGTCCGGACTCATCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:29:12:116/1
+AGCCTGGCCCAATGCCCTGAGTGGCCCTCCCTTGACTAACTCTGACGCGATCATAGGGCTAAAGTTTGTAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:30:107:210/1
+CTACAACTCTAATTGATATCCAACAAGACCTGTTAACATACGATGCGGAGGGACTAGAGTCTCATCGTGCTCTGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:31:162:266/1
+AGAGTCTCATCGTGCTCTGACGATTATATGTTGACCTTCTACTCCCATTGTCTTTGACGCTTTCTGATGTCAGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:32:213:317.dup.2/1
+CTTTGACGCTTTCTGATGTCAGTCGCCGGAGACCAGCTGTCTCCCTAGGGCGTATAGGTGTTCCGGATACCCGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:33:24:127/1
+TGCCCTGAGTGGCCCTCCCTTGACTAACTCTGACGCGATCATAGGGCTAAAGTTTGTAGCTCTAAGTCCAACTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:34:84:189/1
+TCTAAGTCCAACTCTGGCACCAGCTACAACTCTAATTGATATCCAACAAGACCTGTTAACATACGATGCGGAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:35:40:145/1
+CCCTTGACTAACTCTGACGCGATCATAGGGCTAAAGTTTGTAGCTCTAAGTCCAACTCTGGCACCAGCTACAACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:36:120:223/1
+TGATATCCAACAAGACCTGTTAACATACGATGCGGAGGGACTAGAGTCTCATCGTGCTCTGACGATTATATGTTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:37:106:211/1
+GCTACAACTCTAATTGATATCCAACAAGACCTGTTAACATACGATGCGGAGGGACTAGAGTCTCATCGTGCTCTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:38:98:202/1
+TGGCACCAGCTACAACTCTAATTGATATCCAACAAGACCTGTTAACATACGATGCGGAGGGACTAGAGTCTCATCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:39:72:177/1
+AAAGTTTGTAGCTCTAAGTCCAACTCTGGCACCAGCTACAACTCTAATTGATATCCAACAAGACCTGTTAACATAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:40:16:120/1
+TGGCCCAATGCCCTGAGTGGCCCTCCCTTGACTAACTCTGACGCGATCATAGGGCTAAAGTTTGTAGCTCTAAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:41:308:410/1
+GAGTCGGTAATATCGTCCGGACTCATCCCTACTCTTACAACTTACGTGGTTACGCTTACCCAGAGAAATATGTGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:42:26:129/1
+CCCTGAGTGGCCCTCCCTTGACTAACTCTGACGCGATCATAGGGCTAAAGTTTGTAGCTCTAAGTCCAACTCTGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:43:130:234/1
+CAAGACCTGTTAACATACGATGCGGAGGGACTAGAGTCTCATCGTGCTCTGACGATTATATGTTGACCTTCTACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:44:52:157/1
+TCTGACGCGATCATAGGGCTAAAGTTTGTAGCTCTAAGTCCAACTCTGGCACCAGCTACAACTCTAATTGATATCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:45:220:323/1
+GCTTTCTGATGTCAGTCGCCGGAGACCAGCTGTCTCCCTAGGGCGTATAGGTGTTCCGGATACCCGTCCTCAGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:46:125:228/1
+TCCAACAAGACCTGTTAACATACGATGCGGAGGGACTAGAGTCTCATCGTGCTCTGACGATTATATGTTGACCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:47:210:314/1
+TGTCTTTGACGCTTTCTGATGTCAGTCGCCGGAGACCAGCTGTCTCCCTAGGGCGTATAGGTGTTCCGGATACCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:48:220:324/1
+GCTTTCTGATGTCAGTCGCCGGAGACCAGCTGTCTCCCTAGGGCGTATAGGTGTTCCGGATACCCGTCCTCAGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:49:25:128/1
+GCCCTGAGTGGCCCTCCCTTGACTAACTCTGACGCGATCATAGGGCTAAAGTTTGTAGCTCTAAGTCCAACTCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
diff --git a/ariba/tests/data/assembly_test_assemble_with_spades_reads_2.fq b/ariba/tests/data/assembly_test_assemble_with_spades_reads_2.fq
new file mode 100644
index 0000000..14747f6
--- /dev/null
+++ b/ariba/tests/data/assembly_test_assemble_with_spades_reads_2.fq
@@ -0,0 +1,232 @@
+ at 1:1:82:186/2
+CCTAGGGAGACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGACAATGGGAGTAGAAGGTCAACCTATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:2:6:109/2
+TCGTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTATGTTAACAGGTCTTGTTGGATATCAATTAGAGTTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:3:1:106/2
+TCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTATGTTAACAGGTCTTGTTGGATATCAATTAGAGTTGTAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:4:33:136/2
+CAATGGGAGTAGAAGGTCAACCTATAATCGTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTATGTTAACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:5:196:299/2
+TTCTCTGGGTAAGCGTAACCACGTAAGTTGTAAGAGTAGGGATGAGTCCGGACGATATTACCGACTCAAGCATACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:6:63:168/2
+CTCCGGCGACTGACATCAGAAAGCGTCAAAGACAATGGGAGTAGAAGGTCAACCTATAATCGTCAGAGCACGATGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:7:10:111/2
+AATCGTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTATGTTAACAGGTCTTGTTGGATATCAATTAGAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:8:74:178/2
+GACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGACAATGGGAGTAGAAGGTCAACCTATAATCGTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at 1:9:84:186/2
+CCTAGGGAGACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGACAATGGGAGTAGAAGGTCAACCTATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:1:41:144/2
+GTCAAAGACAATGGGAGTAGAAGGTCAACATATAATCGTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:2:144:247/2
+CGATATTACCGACTCAAGCATACGCACCGCCTGAGGACGGGTATCCGGAACACCTATACGCCCTAGGGAGACAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:3:225:329/2
+TGTCGTAGGCTAAGCAGGTAGCGCACATATTTCTCTGGGTAAGCGTAACCACGTAAGTTGTAAGAGTAGGGATGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:4:237:340/2
+GGCTCCTGCCGTGTCGTAGGCTAAGCAGGTAGCGCACATATTTCTCTGGGTAAGCGTAACCACGTAAGTTGTAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:5:45:151/2
+AGAAAGCGTCAAAGACAATGGGAGTAGAAGGTCAACATATAATCGTCAGAGCACGATGAGACTCTAGTCCCTCCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:6:284:386/2
+GGTACTTCGCTAGCCGCATCAGCTGACACTTATTCAGGGCCTAGCAGGCTCCTGCCGTGTCGTAGGCTAAGCAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:7:305:407/2
+CTTGAACCTCAGCGCATGGTTGGTACTTCGCTAGCCGCATCAGCTGACACTTATTCAGGGCCTAGCAGGCTCCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:8:213:317/2
+AGCAGGTAGCGCACATATTTCTCTGGGTAAGCGTAACCACGTAAGTTGTAAGAGTAGGGATGAGTCCGGACGATAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:9:183:287/2
+GCGTAACCACGTAAGTTGTAAGAGTAGGGATGAGTCCGGACGATATTACCGACTCAAGCATACGCACCGCCTGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:10:289:393/2
+CATGGTTGGTACTTCGCTAGCCGCATCAGCTGACACTTATTCAGGGCCTAGCAGGCTCCTGCCGTGTCGTAGGCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:11:296:399/2
+TCAGCGCATGGTTGGTACTTCGCTAGCCGCATCAGCTGACACTTATTCAGGGCCTAGCAGGCTCCTGCCGTGTCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:12:270:373/2
+CCGCATCAGCTGACACTTATTCAGGGCCTAGCAGGCTCCTGCCGTGTCGTAGGCTAAGCAGGTAGCGCACATATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:13:167:271/2
+TGTAAGAGTAGGGATGAGTCCGGACGATATTACCGACTCAAGCATACGCACCGCCTGAGGACGGGTATCCGGAACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:14:43:147/2
+AGCGTCAAAGACAATGGGAGTAGAAGGTCAACATATAATCGTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:15:323:424/2
+CATCTAGGTTGGACAGCCTTGAACCTCAGCGCATGGTTGGTACTTCGCTAGCCGCATCAGCTGACACTTATTCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:16:105:207/2
+GTATCCGGAACACCTATACGCCCTAGGGAGACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGACAATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:17:237:341/2
+AGGCTCCTGCCGTGTCGTAGGCTAAGCAGGTAGCGCACATATTTCTCTGGGTAAGCGTAACCACGTAAGTTGTAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:18:3:107/2
+GTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTATGTTAACAGGTCTTGTTGGATATCAATTAGAGTTGTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:19:272:374/2
+GCCGCATCAGCTGACACTTATTCAGGGCCTAGCAGGCTCCTGCCGTGTCGTAGGCTAAGCAGGTAGCGCACATATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:20:251:354/2
+TTCAGGGCCTAGCAGGCTCCTGCCGTGTCGTAGGCTAAGCAGGTAGCGCACATATTTCTCTGGGTAAGCGTAACCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:21:95:199/2
+AACACCTATACGCCCTAGGGAGACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGACAATGGGAGTAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:22:96:199/2
+AACACCTATACGCCCTAGGGAGACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGACAATGGGAGTAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:23:94:197/2
+CACCTATACGCCCTAGGGAGACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGACAATGGGAGTAGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:24:185:289/2
+AAGCGTAACCACGTAAGTTGTAAGAGTAGGGATGAGTCCGGACGATATTACCGACTCAAGCATACGCACCGCCTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:25:152:256/2
+GAGTCCGGACGATATTACCGACTCAAGCATACGCACCGCCTGAGGACGGGTATCCGGAACACCTATACGCCCTAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:26:285:389/2
+GTTGGTACTTCGCTAGCCGCATCAGCTGACACTTATTCAGGGCCTAGCAGGCTCCTGCCGTGTCGTAGGCTAAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:27:137:241/2
+TACCGACTCAAGCATACGCACCGCCTGAGGACGGGTATCCGGAACACCTATACGCCCTAGGGAGACAGCTGGTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:28:261:365/2
+GCTGACACTTATTCAGGGCCTAGCAGGCTCCTGCCGTGTCGTAGGCTAAGCAGGTAGCGCACATATTTCTCTGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:29:12:116/2
+CATATAATCGTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTATGTTAACAGGTCTTGTTGGATATCAATTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:30:107:210/2
+CGGGTATCCGGAACACCTATACGCCCTAGGGAGACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:31:162:266/2
+GAGTAGGGATGAGTCCGGACGATATTACCGACTCAAGCATACGCACCGCCTGAGGACGGGTATCCGGAACACCTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:32:213:317.dup.2/2
+AGCAGGTAGCGCACATATTTCTCTGGGTAAGCGTAACCACGTAAGTTGTAAGAGTAGGGATGAGTCCGGACGATAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:33:24:127/2
+TAGAAGGTCAACATATAATCGTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTATGTTAACAGGTCTTGTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:34:84:189/2
+CGCCCTAGGGAGACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGACAATGGGAGTAGAAGGTCAACAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:35:40:145/2
+CGTCAAAGACAATGGGAGTAGAAGGTCAACATATAATCGTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:36:120:223/2
+CACCGCCTGAGGACGGGTATCCGGAACACCTATACGCCCTAGGGAGACAGCTGGTCTCCGGCGACTGACATCAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:37:106:211/2
+ACGGGTATCCGGAACACCTATACGCCCTAGGGAGACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:38:98:202/2
+CGGAACACCTATACGCCCTAGGGAGACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGACAATGGGAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:39:72:177/2
+ACAGCTGGTCTCCGGCGACTGACATCAGAAAGCGTCAAAGACAATGGGAGTAGAAGGTCAACATATAATCGTCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:40:16:120/2
+TCAACATATAATCGTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTATGTTAACAGGTCTTGTTGGATATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:41:308:410/2
+AGCCTTGAACCTCAGCGCATGGTTGGTACTTCGCTAGCCGCATCAGCTGACACTTATTCAGGGCCTAGCAGGCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:42:26:129/2
+AGTAGAAGGTCAACATATAATCGTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTATGTTAACAGGTCTTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:43:130:234/2
+TCAAGCATACGCACCGCCTGAGGACGGGTATCCGGAACACCTATACGCCCTAGGGAGACAGCTGGTCTCCGGCGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:44:52:157/2
+GACATCAGAAAGCGTCAAAGACAATGGGAGTAGAAGGTCAACATATAATCGTCAGAGCACGATGAGACTCTAGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:45:220:323/2
+AGGCTAAGCAGGTAGCGCACATATTTCTCTGGGTAAGCGTAACCACGTAAGTTGTAAGAGTAGGGATGAGTCCGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:46:125:228/2
+ATACGCACCGCCTGAGGACGGGTATCCGGAACACCTATACGCCCTAGGGAGACAGCTGGTCTCCGGCGACTGACAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:47:210:314/2
+AGGTAGCGCACATATTTCTCTGGGTAAGCGTAACCACGTAAGTTGTAAGAGTAGGGATGAGTCCGGACGATATTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:48:220:324/2
+TAGGCTAAGCAGGTAGCGCACATATTTCTCTGGGTAAGCGTAACCACGTAAGTTGTAAGAGTAGGGATGAGTCCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ at ref2:49:25:128/2
+GTAGAAGGTCAACATATAATCGTCAGAGCACGATGAGACTCTAGTCCCTCCGCATCGTATGTTAACAGGTCTTGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
diff --git a/ariba/tests/data/assembly_test_check_spades_log_file.log.bad b/ariba/tests/data/assembly_test_check_spades_log_file.log.bad
new file mode 100644
index 0000000..df88162
--- /dev/null
+++ b/ariba/tests/data/assembly_test_check_spades_log_file.log.bad
@@ -0,0 +1,5 @@
+line 1
+line 2
+
+== Error ==  system call for: "['/foo/bar/SPAdes-3.6.0-Linux/bin/spades', '/spam/eggs/K21/configs/config.info']" finished abnormally, err code: -7
+
diff --git a/ariba/tests/data/assembly_test_check_spades_log_file.log.good b/ariba/tests/data/assembly_test_check_spades_log_file.log.good
new file mode 100644
index 0000000..f0f0687
--- /dev/null
+++ b/ariba/tests/data/assembly_test_check_spades_log_file.log.good
@@ -0,0 +1,5 @@
+This is a dummy spades log file.
+
+It doesn't look like a real spades log file.
+
+But it doesn't have lines matching the bad stuff that will mean ariba should stop NOW.
diff --git a/scripts/ariba b/scripts/ariba
index 498dddd..8cf4a51 100755
--- a/scripts/ariba
+++ b/scripts/ariba
@@ -222,8 +222,14 @@ nucmer_group.add_argument('--nucmer_min_len', type=int, help='Minimum alignment
 nucmer_group.add_argument('--nucmer_breaklen', type=int, help='Value to use for -breaklen when running nucmer [%(default)s]', default=200, metavar='INT')
 
 assembly_group = subparser_run.add_argument_group('Assembly options')
+assembly_group.add_argument('--assembler', help='Assembler to use', choices=['fermilite','spades'], default='fermilite')
 assembly_group.add_argument('--assembly_cov', type=int, help='Target read coverage when sampling reads for assembly [%(default)s]', default=50, metavar='INT')
 assembly_group.add_argument('--min_scaff_depth', type=int, help='Minimum number of read pairs needed as evidence for scaffold link between two contigs [%(default)s]', default=10, metavar='INT')
+assembly_group.add_argument('--spades_mode', help='If using Spades assembler, either use default WGS mode, Single Cell mode (`spades.py --sc`) or RNA mode (`spades.py --rna`). '
+                                                  'Use SC or RNA mode if your input is from a viral sequencing with very uneven and deep coverage. '
+                                                  'Set `--assembly_cov` to some high value if using SC or RNA mode', choices=['wgs','sc','rna'], default='wgs')
+assembly_group.add_argument('--spades_options', help='Extra options to pass to Spades assembler. Sensible default options will be picked based on `--spades_mode` argument. '
+                                                     'Anything set here will replace the defaults completely')
 
 other_run_group = subparser_run.add_argument_group('Other options')
 other_run_group.add_argument('--threads', type=int, help='Experimental. Number of threads. Will run clusters in parallel, but not minimap (yet) [%(default)s]', default=1, metavar='INT')
diff --git a/setup.py b/setup.py
index 093be07..3aaae9c 100644
--- a/setup.py
+++ b/setup.py
@@ -55,7 +55,7 @@ vcfcall_mod = Extension(
 setup(
     ext_modules=[minimap_mod, fermilite_mod, vcfcall_mod],
     name='ariba',
-    version='2.10.3',
+    version='2.11.0',
     description='ARIBA: Antibiotic Resistance Identification By Assembly',
     packages = find_packages(),
     package_data={'ariba': ['test_run_data/*']},

-- 
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/ariba.git

More information about the debian-med-commit mailing list