[Debian-med-packaging] Bug#1032550: igdiscover: FTBFS in testing: dh_auto_test: error: pybuild --test --test-pytest -i python{version} -p 3.11 returned exit code 13
Lucas Nussbaum
lucas at debian.org
Wed Mar 8 20:29:54 GMT 2023
Source: igdiscover
Version: 0.11-3
Severity: serious
Justification: FTBFS
Tags: bookworm sid ftbfs
User: lucas at debian.org
Usertags: ftbfs-20230307 ftbfs-bookworm
Hi,
During a rebuild of all packages in testing (bookworm), your package failed
to build on amd64.
Relevant part (hopefully):
> make[1]: Entering directory '/<<PKGBUILDDIR>>'
> dh_auto_build
> pybuild --build -i python{version} -p 3.11
> I: pybuild base:240: /usr/bin/python3 setup.py build
> running build
> running build_py
> creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/species.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/clonoquery.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/dendrogram.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/rename.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/__main__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/merge.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/germlinefilter.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/union.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/errorplot.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/plotalleles.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/init.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/group.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/__init__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/discoverj.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/igblast.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/table.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/config.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/haplotype.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/clonotypes.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/dereplicate.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/upstream.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/commonv.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/discover.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/filter.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/multidiscover.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/run.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/trie.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/clusterplot.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/dbdiff.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/utils.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/_version.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/count.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/cluster.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/parse.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/igdiscover.yaml -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/Snakefile -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/empty.aux -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> UPDATING /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover/_version.py
> set /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover/_version.py to '0.11'
> PYTHONPATH=. http_proxy='127.0.0.1:9' sphinx-build -N -bhtml doc/ build/html # HTML generator
> Running Sphinx v5.3.0
> making output directory... done
> WARNING: html_static_path entry '_static' does not exist
> building [mo]: targets for 0 po files that are out of date
> building [html]: targets for 9 source files that are out of date
> updating environment: [new config] 9 added, 0 changed, 0 removed
> reading sources... [ 11%] advanced
> reading sources... [ 22%] changes
> reading sources... [ 33%] develop
> reading sources... [ 44%] faq
> reading sources... [ 55%] guide
> reading sources... [ 66%] index
> reading sources... [ 77%] installation
> reading sources... [ 88%] manual-installation
> reading sources... [100%] testing
>
> looking for now-outdated files... none found
> pickling environment... done
> checking consistency... done
> preparing documents... done
> writing output... [ 11%] advanced
> writing output... [ 22%] changes
> writing output... [ 33%] develop
> writing output... [ 44%] faq
> writing output... [ 55%] guide
> writing output... [ 66%] index
> writing output... [ 77%] installation
> writing output... [ 88%] manual-installation
> writing output... [100%] testing
>
> generating indices... genindex done
> writing additional pages... search done
> copying static files... done
> copying extra files... done
> dumping search index in English (code: en)... done
> dumping object inventory... done
> build succeeded, 1 warning.
>
> The HTML pages are in build/html.
> PYTHONPATH=. http_proxy='127.0.0.1:9' sphinx-build -N -bman doc/ build/man # Manpage generator
> Running Sphinx v5.3.0
> making output directory... done
> WARNING: html_static_path entry '_static' does not exist
> building [mo]: targets for 0 po files that are out of date
> building [man]: all manpages
> updating environment: [new config] 9 added, 0 changed, 0 removed
> reading sources... [ 11%] advanced
> reading sources... [ 22%] changes
> reading sources... [ 33%] develop
> reading sources... [ 44%] faq
> reading sources... [ 55%] guide
> reading sources... [ 66%] index
> reading sources... [ 77%] installation
> reading sources... [ 88%] manual-installation
> reading sources... [100%] testing
>
> looking for now-outdated files... none found
> pickling environment... done
> checking consistency... done
> writing... igdiscover.1 { installation manual-installation testing guide faq advanced develop changes } done
> build succeeded, 1 warning.
>
> The manual pages are in build/man.
> make[1]: Leaving directory '/<<PKGBUILDDIR>>'
> dh_auto_test -O--buildsystem=pybuild
> pybuild --test --test-pytest -i python{version} -p 3.11
> I: pybuild base:240: cd /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build; python3.11 -m pytest tests
> ============================= test session starts ==============================
> platform linux -- Python 3.11.2, pytest-7.2.1, pluggy-1.0.0+repack
> rootdir: /<<PKGBUILDDIR>>, configfile: setup.cfg
> collected 36 items
>
> tests/test_cluster.py .. [ 5%]
> tests/test_commands.py ..... [ 19%]
> tests/test_merger.py ............ [ 52%]
> tests/test_parse.py . [ 55%]
> tests/test_species.py FFF [ 63%]
> tests/test_trie.py ..... [ 77%]
> tests/test_utils.py F....... [100%]
>
> =================================== FAILURES ===================================
> __________________________ test_cdr3_detection_heavy ___________________________
>
> def test_cdr3_detection_heavy():
> heavy = """
> ARRLHSGSYILFDY CAGGTGACCTTGAAGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGTATGGGTGTGGGCTGGATCCGTCAGCCCTCACGGAAGACCCTGGAGTGGCTTGCACACATTTATTGGAATGATGATAAATACTACAGCACATCGCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTTCTAACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACGGAGACTTCATAGTGGGAGCTACATTCTCTTTGACTACTGGGGCCAGGGAGTCCTGGTCACCGTCTCCTCAGGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCGTCTCCTGTGA
>
> ARIKWLRSPGYGYFDF CAGGTGACCTTGAAGGAGTCTGGTCCTGCGCTGGTGAGACCCACACAGACCCTCACTCTGACCTGCACCTTCTCTGGGTTCTCAATCAGCACCTCTGGAACAGGTGTGGGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAATGGCTTGCAAGCATTTATTGGACTGATGCTAAATACTATAGCACATCGCAGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAGAAACCAGGTGATTCTAACAATGACCAACATGGAGCCTGTGGACATAGCCACATATTTCTGTGCACGGATAAAGTGGCTGCGGTCCCCAGGCTATGGATACTTCGATTTCTGGGGCCCTGGCACCCCAATCACCATCTCCTCAGGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCGTCTCCTGTGA
>
> ARHGIAAAGTHNWFDP TCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGGATTACTGTGCGAGACATGGGATAGCAGCAGCTGGTACCCACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCGTCTCCTGTGAGAATTCCCCGTCGGCAGGTTGTT
> """
> > assert_cdr3_detection('VH', heavy)
>
> tests/test_species.py:30:
> _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
>
> chain = 'VH'
> s = '\n\tARRLHSGSYILFDY CAGGTGACCTTGAAGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGG...ACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCGTCTCCTGTGAGAATTCCCCGTCGGCAGGTTGTT\n\t'
>
> def assert_cdr3_detection(chain, s):
> for amino_acids, sequence in split(s):
> for offset in range(3):
> target = sequence[offset:]
> match = find_cdr3(target, chain)
> > assert match is not None
> E assert None is not None
>
> tests/test_species.py:18: AssertionError
> __________________________ test_cdr3_detection_kappa ___________________________
>
> def test_cdr3_detection_kappa():
> kappa = """
> QQYDSSPRT TTCAGTGGCAGTGGAGCAGGGACAGATTTCACTCTCACCATCAGCAGTCTGGAACCTGAGGATGTCGCAACTTACTACTGTCAGCAGTATGATAGCAGCCCCCGGACGTTCGGCGCTGGGACCAAGCTGGAAATCAAACGGAGTGTGCAGAAGCCAACTATCTCCCTCTTCCCTCCATCATCTGAGGAGG
>
> QQYSSYPYT GAGCTGGCCTCGGGAGTCCCAGCTCGCTTCAGTGGGAGTGGGTCAGGGACTTCTTTCTCTCTCACAATCAGCAACGTGGAGGCTGAAGATGTTGCAACCTATTACTGTCAGCAGTATAGCAGTTATCCGTACACGTTCGGCGCAGGGACCAAGCTGGAAATCAAACGGAGTGTGCAGAAGCCAACTATCTCCCTCTTCCCTCCATCATCTGAGGAGG
>
> LQYDSSPYT ATTCTCACCATCAGCAGCCTGCAGCCTGAAGACTTTGCAACTTACTACTGTCTACAGTATGATAGTTCCCCGTACACGTTCGGCGCAGGGACCAAGCTGGAAATCAAACGGAGTGTGCAGAAGCCAACTATCTCCCTCTTCCCTCCATCATCTGAGGAGG
>
> FQYYSGRLT ACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAGGACATTGCAGTTTATTACTGTTTCCAGTATTACAGCGGGAGACTCACGTTCGGAGGAGGGACCCGCTTGGAAATCAAACGGAGTGTGCAGAAGCCAACTATCTCCCTCTTCCCTCCATCATCTGAGGAGG
> """
> > assert_cdr3_detection('VK', kappa)
>
> tests/test_species.py:43:
> _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
>
> chain = 'VK'
> s = '\nQQYDSSPRT TTCAGTGGCAGTGGAGCAGGGACAGATTTCACTCTCACCATCAGCAGTCTGGAACCTGAGGATGTCGCAACTTACTACTGTCAGCAGTATGATAGCAGCCCCCGG...ACTGTTTCCAGTATTACAGCGGGAGACTCACGTTCGGAGGAGGGACCCGCTTGGAAATCAAACGGAGTGTGCAGAAGCCAACTATCTCCCTCTTCCCTCCATCATCTGAGGAGG\n\t'
>
> def assert_cdr3_detection(chain, s):
> for amino_acids, sequence in split(s):
> for offset in range(3):
> target = sequence[offset:]
> match = find_cdr3(target, chain)
> > assert match is not None
> E assert None is not None
>
> tests/test_species.py:18: AssertionError
> __________________________ test_cdr3_detection_lambda __________________________
>
> def test_cdr3_detection_lambda():
> lambda_ = """
> LTYHGNSGTFV GGATCCAAAAACCCCTCAGCCAATGCAGGAATTTTGCTCATCTCTGAACTCCAGAATGAGGATGAGGCTGACTATTACTGTCTGACATATCATGGTAATAGTGGTACTTTTGTATTCGGTGGAGGAACCAAGCTGACCGTCCTAGGTCAGCCCAAGTCTGCCCCCACAGTCAGCCTGTTCC
>
> QLWDANSTV ATGGCCACACTGACCATCACTGGCGCCCAGGGTGAGGACGAGGCCGACTATTGCTGTCAGTTGTGGGATGCTAACAGTACTGTGTTCGGTGGAGGAACCACGCTGACCGTCCTAGGTCAGCCCAAGTCTGCCCCCACAGTCAGCCTGTTCCCGCCCTCCTC
>
> GVGYSGGYV GATCGCTACTTAACCATCTCCAACATCCAGCCTGAAGACGAGGCTGACTATTTCTGTGGTGTGGGTTATAGCGGTGGTTATGTATTCGGTGGAGGAACCAAGTTGACCGTCCTAGGTCAGCCCAAGTCTGCTCCCACAGTCAGCCTGTTCCCGCCCTCCTC
> """
> > assert_cdr3_detection('VL', lambda_)
>
> tests/test_species.py:54:
> _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
>
> chain = 'VL'
> s = '\nLTYHGNSGTFV GGATCCAAAAACCCCTCAGCCAATGCAGGAATTTTGCTCATCTCTGAACTCCAGAATGAGGATGAGGCTGACTATTACTGTCTGACATATCATGGTAATAGTG...CTATTTCTGTGGTGTGGGTTATAGCGGTGGTTATGTATTCGGTGGAGGAACCAAGTTGACCGTCCTAGGTCAGCCCAAGTCTGCTCCCACAGTCAGCCTGTTCCCGCCCTCCTC\n\t'
>
> def assert_cdr3_detection(chain, s):
> for amino_acids, sequence in split(s):
> for offset in range(3):
> target = sequence[offset:]
> match = find_cdr3(target, chain)
> > assert match is not None
> E assert None is not None
>
> tests/test_species.py:18: AssertionError
> ________________________________ test_has_stop _________________________________
>
> def test_has_stop():
> > assert has_stop('TAA')
> E AssertionError: assert False
> E + where False = has_stop('TAA')
>
> tests/test_utils.py:11: AssertionError
> =============================== warnings summary ===============================
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_commands.py::test_main
> /usr/lib/python3/dist-packages/snakemake/rules.py:14: DeprecationWarning: module 'sre_constants' is deprecated
> import sre_constants
>
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_ambiguous
> /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: PytestRemovedIn8Warning: Support for nose tests is deprecated and will be removed in a future release.
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_ambiguous is using nose-specific method: `setup(self)`
> To remove this warning, rename it to `setup_method(self)`
> See docs: https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
> fixture_result = next(generator)
>
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_missing
> /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: PytestRemovedIn8Warning: Support for nose tests is deprecated and will be removed in a future release.
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_missing is using nose-specific method: `setup(self)`
> To remove this warning, rename it to `setup_method(self)`
> See docs: https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
> fixture_result = next(generator)
>
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_existing
> /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: PytestRemovedIn8Warning: Support for nose tests is deprecated and will be removed in a future release.
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_existing is using nose-specific method: `setup(self)`
> To remove this warning, rename it to `setup_method(self)`
> See docs: https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
> fixture_result = next(generator)
>
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_empty_string
> /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: PytestRemovedIn8Warning: Support for nose tests is deprecated and will be removed in a future release.
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_empty_string is using nose-specific method: `setup(self)`
> To remove this warning, rename it to `setup_method(self)`
> See docs: https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
> fixture_result = next(generator)
>
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_contains
> /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: PytestRemovedIn8Warning: Support for nose tests is deprecated and will be removed in a future release.
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_contains is using nose-specific method: `setup(self)`
> To remove this warning, rename it to `setup_method(self)`
> See docs: https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
> fixture_result = next(generator)
>
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_len
> /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: PytestRemovedIn8Warning: Support for nose tests is deprecated and will be removed in a future release.
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_len is using nose-specific method: `setup(self)`
> To remove this warning, rename it to `setup_method(self)`
> See docs: https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
> fixture_result = next(generator)
>
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_has_similar
> /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: PytestRemovedIn8Warning: Support for nose tests is deprecated and will be removed in a future release.
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_has_similar is using nose-specific method: `setup(self)`
> To remove this warning, rename it to `setup_method(self)`
> See docs: https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
> fixture_result = next(generator)
>
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_find_all_similar
> /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: PytestRemovedIn8Warning: Support for nose tests is deprecated and will be removed in a future release.
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_find_all_similar is using nose-specific method: `setup(self)`
> To remove this warning, rename it to `setup_method(self)`
> See docs: https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
> fixture_result = next(generator)
>
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_utils.py::test_config
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_utils.py::test_config
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover/config.py:82: PendingDeprecationWarning:
> safe_load will be removed, use
>
> yaml=YAML(typ='safe', pure=True)
> yaml.load(...)
>
> instead
> new_config = self.make_compatible(ruamel.yaml.safe_load(content))
>
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_utils.py::test_config
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_utils.py::test_config
> /usr/lib/python3/dist-packages/ruamel/yaml/main.py:1123: PendingDeprecationWarning:
> load will be removed, use
>
> yaml=YAML(typ='unsafe', pure=True)
> yaml.load(...)
>
> instead
> return load(stream, SafeLoader, version)
>
> -- Docs: https://docs.pytest.org/en/stable/how-to/capture-warnings.html
> =========================== short test summary info ============================
> FAILED tests/test_species.py::test_cdr3_detection_heavy - assert None is not ...
> FAILED tests/test_species.py::test_cdr3_detection_kappa - assert None is not ...
> FAILED tests/test_species.py::test_cdr3_detection_lambda - assert None is not...
> FAILED tests/test_utils.py::test_has_stop - AssertionError: assert False
> ================== 4 failed, 32 passed, 13 warnings in 3.40s ===================
> E: pybuild pybuild:388: test: plugin distutils failed with: exit code=1: cd /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build; python3.11 -m pytest tests
> dh_auto_test: error: pybuild --test --test-pytest -i python{version} -p 3.11 returned exit code 13
The full build log is available from:
http://qa-logs.debian.net/2023/03/07/igdiscover_0.11-3_testing.log
All bugs filed during this archive rebuild are listed at:
https://bugs.debian.org/cgi-bin/pkgreport.cgi?tag=ftbfs-20230307;users=lucas@debian.org
or:
https://udd.debian.org/bugs/?release=na&merged=ign&fnewerval=7&flastmodval=7&fusertag=only&fusertagtag=ftbfs-20230307&fusertaguser=lucas@debian.org&allbugs=1&cseverity=1&ctags=1&caffected=1#results
A list of current common problems and possible solutions is available at
http://wiki.debian.org/qa.debian.org/FTBFS . You're welcome to contribute!
If you reassign this bug to another package, please mark it as 'affects'-ing
this package. See https://www.debian.org/Bugs/server-control#affects
If you fail to reproduce this, please provide a build log and diff it with mine
so that we can identify if something relevant changed in the meantime.
More information about the Debian-med-packaging
mailing list