[med-svn] [python-cutadapt] 01/05: Imported Upstream version 1.11
Olivier Sallou
osallou at debian.org
Thu Aug 18 08:09:28 UTC 2016
This is an automated email from the git hooks/post-receive script.
osallou pushed a commit to branch master
in repository python-cutadapt.
commit 7782a43c1d123d1b687c12239c34b5ee4c208f6a
Author: Olivier Sallou <olivier.sallou at debian.org>
Date: Thu Aug 18 10:04:38 2016 +0200
Imported Upstream version 1.11
---
CHANGES.rst | 138 ++-
MANIFEST.in | 19 +
PKG-INFO | 5 +-
PKG-INFO => cutadapt.egg-info/PKG-INFO | 5 +-
cutadapt.egg-info/SOURCES.txt | 210 ++++
cutadapt.egg-info/dependency_links.txt | 1 +
cutadapt.egg-info/top_level.txt | 1 +
cutadapt/__init__.py | 4 +-
cutadapt/_seqio.c | 2107 ++++++++++----------------------
cutadapt/_seqio.pyx | 16 +-
cutadapt/_version.py | 21 +
cutadapt/scripts/cutadapt.py | 78 +-
cutadapt/seqio.py | 32 +-
doc/conf.py | 12 +-
doc/guide.rst | 26 +-
doc/recipes.rst | 32 +-
setup.cfg | 13 +
setup.py | 38 +-
tests/cut/SRR2040271_1.fastq | 8 +
tests/data/SRR2040271_1.fastq | 8 +
tests/testpaired.py | 88 +-
tests/tests.py | 5 +
tests/testseqio.py | 4 +-
versioneer.py | 1774 +++++++++++++++++++++++++++
24 files changed, 3005 insertions(+), 1640 deletions(-)
diff --git a/CHANGES.rst b/CHANGES.rst
index c3c97b2..d2328b9 100644
--- a/CHANGES.rst
+++ b/CHANGES.rst
@@ -2,11 +2,20 @@
Changes
=======
-v1.10
------
+v1.11 (2016-08-16)
+------------------
+
+* The ``--interleaved`` option no longer requires that both input and output
+ is interleaved. It is now possible to have two-file input and interleaved
+ output, and to have interleaved input and two-file output.
+* Fix issue #202: First and second FASTQ header could get out of sync when
+ options modifying the read name were used.
+
+v1.10 (2016-05-19)
+------------------
* Added a new “linked adapter” type, which can be used to search for a 5' and a
- 3' adapter at the same time. Use ``-a ADAPTER1...ADAPTER2` to search
+ 3' adapter at the same time. Use ``-a ADAPTER1...ADAPTER2`` to search
for a linked adapter. ADAPTER1 is interpreted as an anchored 5' adapter, which
is searched for first. Only if ADAPTER1 is found will ADAPTER2 be searched
for, which is a regular 3' adapter.
@@ -24,16 +33,16 @@ v1.10
* This is the last version of cutadapt to support Python 2.6. Future versions
will require at least Python 2.7.
-v1.9.1
-------
+v1.9.1 (2015-12-02)
+-------------------
* Added ``--pair-filter`` option, which :ref:`modifies how filtering criteria
apply to paired-end reads <filtering-paired>`
* Add ``--too-short-paired-output`` and ``--too-long-paired-output`` options.
* Fix incorrect number of trimmed bases reported if ``--times`` option was used.
-v1.9
-----
+v1.9 (2015-10-29)
+-----------------
* Indels in the alignment can now be disabled for all adapter types (use
``--no-indels``).
@@ -53,22 +62,25 @@ v1.9
* Thanks to Wolfgang Gerlach, there is now a Dockerfile.
* The new ``--debug`` switch makes cutadapt print out the alignment matrix.
-v1.8.3
-------
+v1.8.3 (2015-07-29)
+-------------------
* Fix issue #95: Untrimmed reads were not listed in the info file.
* Fix issue #138: pip install cutadapt did not work with new setuptools versions.
* Fix issue #137: Avoid a hang when writing to two or more gzip-compressed
output files in Python 2.6.
-v1.8.1
-------
+v1.8.2 (2015-07-24)
+-------------------
+
+v1.8.1 (2015-04-09)
+-------------------
* Fix #110: Counts for 'too short' and 'too long' reads were swapped in statistics.
* Fix #115: Make ``--trim-n`` work also on second read for paired-end data.
-v1.8
-----
+v1.8 (2015-03-14)
+-----------------
* Support single-pass paired-end trimming with the new ``-A``/``-G``/``-B``/``-U``
parameters. These work just like their -a/-g/-b/-u counterparts, but they
@@ -100,8 +112,9 @@ v1.8
* Started to use the GitHub issue tracker instead of Google Code. All old issues
have been moved.
-v1.7
-----
+v1.7 (2014-11-25)
+-----------------
+
* IUPAC characters are now supported. For example, use ``-a YACGT`` for an
adapter that matches both ``CACGT`` and ``TACGT`` with zero errors. Disable
with ``-N``. By default, IUPAC characters in the read are not interpreted in
@@ -121,8 +134,9 @@ v1.7
trimming adapters.
* Fix bug: Adapters read from a FASTA file can now be anchored.
-v1.6
-----
+v1.6 (2014-10-07)
+-----------------
+
* Fix bug: Ensure ``--format=...`` can be used even with paired-end input.
* Fix bug: Sometimes output files would be incomplete because they were not
closed correctly.
@@ -142,8 +156,9 @@ v1.6
* Galaxy support files are now in `a separate
repository <https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper>`_.
-v1.5
-----
+v1.5 (2014-08-05)
+-----------------
+
* Adapter sequences can now be read from a FASTA file. For example, write
``-a file:adapters.fasta`` to read 3' adapters from ``adapters.fasta``. This works
also for ``-b`` and ``-g``.
@@ -162,8 +177,9 @@ v1.5
* To properly handle paired-end reads, an option --untrimmed-paired-output was
added.
-v1.4
-----
+v1.4 (2014-03-13)
+-----------------
+
* This release of cutadapt reduces the overhead of reading and writing files.
On my test data set, a typical run of cutadapt (with a single adapter) takes
40% less time due to the following two changes.
@@ -182,8 +198,9 @@ v1.4
* Added one column to the info file that contains the name of the found adapter.
* Add an explanation about colorspace ambiguity to the README
-v1.3
-----
+v1.3 (2013-11-08)
+-----------------
+
* Preliminary paired-end support with the ``--paired-output`` option (contributed by
James Casbon). See the README section on how to use it.
* Improved statistics.
@@ -195,8 +212,9 @@ v1.3
* Slightly speed up alignment of 5' adapters.
* Support bzip2-compressed files.
-v1.2
-----
+v1.2 (2012-11-30)
+-----------------
+
* At least 25% faster processing of .csfasta/.qual files due to faster parser.
* Between 10% and 30% faster writing of gzip-compressed output files.
* Support 5' adapters in colorspace, even when no primer trimming is requested.
@@ -206,8 +224,9 @@ v1.2
Previously, not the longest possible poly-A tail would be trimmed.
* James Casbon contributed the ``--discard-untrimmed`` option.
-v1.1
-----
+v1.1 (2012-06-18)
+-----------------
+
* Allow to "anchor" 5' adapters (``-g``), forcing them to be a prefix of the read.
To use this, add the special character ``^`` to the beginning of the adapter sequence.
* Add the "-N" option, which allows 'N' characters within adapters to match literally.
@@ -224,8 +243,9 @@ v1.1
* allow to deal with colorspace FASTQ files from the SRA that contain a fake
additional quality in the beginning (use ``--format sra-fastq``)
-v1.0
-----
+v1.0 (2011-11-04)
+-----------------
+
* ASCII-encoded quality values were assumed to be encoded as ascii(quality+33).
With the new parameter ``--quality-base``, this can be changed to ascii(quality+64),
as used in some versions of the Illumina pipeline. (Fixes issue 7.)
@@ -241,8 +261,9 @@ v1.0
should also match without counting as error, this needs to be explicitly
requested via ``--match-read-wildcards``.
-v0.9.5
-------
+v0.9.5 (2011-07-20)
+-------------------
+
* Fix issue 20: Make the report go to standard output when ``-o``/``--output`` is
specified.
* Recognize `.fq` as an extension for FASTQ files
@@ -263,8 +284,9 @@ v0.9.5
found". The new alignment algorithm checks the error rate while aligning and only
reports alignments that do not have too many errors.
-v0.9.4
-------
+v0.9.4 (2011-05-20)
+-------------------
+
* now compatible with Python 3
* Add the ``--zero-cap`` option, which changes negative quality values to zero.
This is a workaround to avoid segmentation faults in BWA. The option is now
@@ -275,8 +297,9 @@ v0.9.4
parameter. This mostly fixes issue 12.
* Don't break when input file is empty.
-v0.9.2
-------
+v0.9.2 (2011-03-16)
+-------------------
+
* Install a single ``cutadapt`` Python package instead of multiple Python
modules. This avoids cluttering the global namespace and should lead to less
problems with other Python modules. Thanks to Steve Lianoglou for
@@ -289,8 +312,9 @@ v0.9.2
* allow to input FASTA/FASTQ on standard input (also FASTA/FASTQ is
autodetected)
-v0.9
-----
+v0.9 (2011-01-10)
+-----------------
+
* add ``--too-short-output`` and ``--untrimmed-output``, based on patch by Paul Ryvkin (thanks!)
* add ``--maximum-length`` parameter: discard reads longer than a specified length
* group options by category in ``--help`` output
@@ -301,8 +325,9 @@ v0.9
* some refactoring
* the filename ``-`` is now interpreted as standard in or standard output
-v0.8
-----
+v0.8 (2010-12-08)
+-----------------
+
* Change default behavior of searching for an adapter: The adapter is now assumed to
be an adapter that has been ligated to the 3' end. This should be the correct behavior
for at least the SOLiD small RNA protocol (SREK) and also for the Illumina protocol.
@@ -317,8 +342,9 @@ v0.8
from 36.5 to 37.6%.
* Speed improvements (20% less runtime on my test data set).
-v0.7
-----
+v0.7 (2010-12-03)
+-----------------
+
* Useful exit codes
* Better error reporting when malformed files are encountered
* Add ``--minimum-length`` parameter for discarding reads that are shorter than
@@ -328,28 +354,34 @@ v0.7
* pure Python fallback for alignment function for when the C module cannot
be used.
-v0.6
-----
+v0.6 (2010-11-18)
+-----------------
+
* Support gzipped input and output.
* Print timing information in statistics.
-v0.5
-----
+v0.5 (2010-11-17)
+-----------------
+
* add ``--discard`` option which makes cutadapt discard reads in which an adapter occurs
-v0.4
-----
+v0.4 (2010-11-17)
+-----------------
+
* (more) correctly deal with multiple adapters: If a long adapter matches with lots of
errors, then this could lead to a a shorter adapter matching with few errors getting ignored.
-v0.3
-----
+v0.3 (2010-09-27)
+-----------------
+
* fix huge memory usage (entire input file was unintentionally read into memory)
-v0.2
-----
+v0.2 (2010-09-14)
+-----------------
+
* allow FASTQ input
-v0.1
-----
+v0.1 (2010-09-14)
+-----------------
+
* initial release
diff --git a/MANIFEST.in b/MANIFEST.in
new file mode 100644
index 0000000..a758122
--- /dev/null
+++ b/MANIFEST.in
@@ -0,0 +1,19 @@
+# documentation
+include README.rst
+include CHANGES.rst
+include CITATION
+include LICENSE
+include doc/*.rst
+include doc/conf.py
+include doc/Makefile
+include cutadapt/*.pyx
+include cutadapt/_align.c
+include cutadapt/_qualtrim.c
+include cutadapt/_seqio.c
+include bin/_preamble.py
+include tests/test*.py
+include tests/utils.py
+graft tests/data
+graft tests/cut
+include versioneer.py
+include cutadapt/_version.py
diff --git a/PKG-INFO b/PKG-INFO
index 85f3ecb..9c0d080 100644
--- a/PKG-INFO
+++ b/PKG-INFO
@@ -1,8 +1,8 @@
Metadata-Version: 1.1
Name: cutadapt
-Version: 1.10
+Version: 1.11
Summary: trim adapters from high-throughput sequencing reads
-Home-page: https://cutadapt.readthedocs.org/
+Home-page: https://cutadapt.readthedocs.io/
Author: Marcel Martin
Author-email: marcel.martin at scilifelab.se
License: MIT
@@ -14,7 +14,6 @@ Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved :: MIT License
Classifier: Natural Language :: English
Classifier: Programming Language :: Cython
-Classifier: Programming Language :: Python :: 2.6
Classifier: Programming Language :: Python :: 2.7
Classifier: Programming Language :: Python :: 3
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
diff --git a/PKG-INFO b/cutadapt.egg-info/PKG-INFO
similarity index 85%
copy from PKG-INFO
copy to cutadapt.egg-info/PKG-INFO
index 85f3ecb..9c0d080 100644
--- a/PKG-INFO
+++ b/cutadapt.egg-info/PKG-INFO
@@ -1,8 +1,8 @@
Metadata-Version: 1.1
Name: cutadapt
-Version: 1.10
+Version: 1.11
Summary: trim adapters from high-throughput sequencing reads
-Home-page: https://cutadapt.readthedocs.org/
+Home-page: https://cutadapt.readthedocs.io/
Author: Marcel Martin
Author-email: marcel.martin at scilifelab.se
License: MIT
@@ -14,7 +14,6 @@ Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved :: MIT License
Classifier: Natural Language :: English
Classifier: Programming Language :: Cython
-Classifier: Programming Language :: Python :: 2.6
Classifier: Programming Language :: Python :: 2.7
Classifier: Programming Language :: Python :: 3
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
diff --git a/cutadapt.egg-info/SOURCES.txt b/cutadapt.egg-info/SOURCES.txt
new file mode 100644
index 0000000..0a37ece
--- /dev/null
+++ b/cutadapt.egg-info/SOURCES.txt
@@ -0,0 +1,210 @@
+CHANGES.rst
+CITATION
+LICENSE
+MANIFEST.in
+README.rst
+setup.cfg
+setup.py
+versioneer.py
+bin/_preamble.py
+bin/cutadapt
+cutadapt/__init__.py
+cutadapt/_align.c
+cutadapt/_align.pyx
+cutadapt/_qualtrim.c
+cutadapt/_qualtrim.pyx
+cutadapt/_seqio.c
+cutadapt/_seqio.pyx
+cutadapt/_version.py
+cutadapt/adapters.py
+cutadapt/align.py
+cutadapt/colorspace.py
+cutadapt/compat.py
+cutadapt/filters.py
+cutadapt/modifiers.py
+cutadapt/qualtrim.py
+cutadapt/report.py
+cutadapt/seqio.py
+cutadapt/xopen.py
+cutadapt.egg-info/PKG-INFO
+cutadapt.egg-info/SOURCES.txt
+cutadapt.egg-info/dependency_links.txt
+cutadapt.egg-info/top_level.txt
+cutadapt/scripts/__init__.py
+cutadapt/scripts/cutadapt.py
+doc/Makefile
+doc/changes.rst
+doc/colorspace.rst
+doc/conf.py
+doc/guide.rst
+doc/ideas.rst
+doc/index.rst
+doc/installation.rst
+doc/recipes.rst
+tests/testadapters.py
+tests/testalign.py
+tests/testcolorspace.py
+tests/testfilters.py
+tests/testmodifiers.py
+tests/testpaired.py
+tests/testqualtrim.py
+tests/tests.py
+tests/testseqio.py
+tests/testtrim.py
+tests/testxopen.py
+tests/utils.py
+tests/cut/454.fa
+tests/cut/SRR2040271_1.fastq
+tests/cut/anchored-back.fasta
+tests/cut/anchored.fasta
+tests/cut/anchored_no_indels.fasta
+tests/cut/anchored_no_indels_wildcard.fasta
+tests/cut/anywhere_repeat.fastq
+tests/cut/discard-untrimmed.fastq
+tests/cut/discard.fastq
+tests/cut/dos.fastq
+tests/cut/empty.fastq
+tests/cut/example.fa
+tests/cut/examplefront.fa
+tests/cut/illumina.fastq
+tests/cut/illumina.info.txt
+tests/cut/illumina5.fastq
+tests/cut/illumina5.info.txt
+tests/cut/illumina64.fastq
+tests/cut/interleaved.fastq
+tests/cut/issue46.fasta
+tests/cut/linked.fasta
+tests/cut/lowercase.fastq
+tests/cut/lowqual.fastq
+tests/cut/maxlen.fa
+tests/cut/maxn0.2.fasta
+tests/cut/maxn0.4.fasta
+tests/cut/maxn0.fasta
+tests/cut/maxn1.fasta
+tests/cut/maxn2.fasta
+tests/cut/minlen.fa
+tests/cut/minlen.noprimer.fa
+tests/cut/nextseq.fastq
+tests/cut/no-trim.fastq
+tests/cut/no_indels.fasta
+tests/cut/overlapa.fa
+tests/cut/overlapb.fa
+tests/cut/paired-filterboth.1.fastq
+tests/cut/paired-filterboth.2.fastq
+tests/cut/paired-m27.1.fastq
+tests/cut/paired-m27.2.fastq
+tests/cut/paired-onlyA.1.fastq
+tests/cut/paired-onlyA.2.fastq
+tests/cut/paired-separate.1.fastq
+tests/cut/paired-separate.2.fastq
+tests/cut/paired-too-short.1.fastq
+tests/cut/paired-too-short.2.fastq
+tests/cut/paired-trimmed.1.fastq
+tests/cut/paired-trimmed.2.fastq
+tests/cut/paired-untrimmed.1.fastq
+tests/cut/paired-untrimmed.2.fastq
+tests/cut/paired.1.fastq
+tests/cut/paired.2.fastq
+tests/cut/paired.m14.1.fastq
+tests/cut/paired.m14.2.fastq
+tests/cut/pairedq.1.fastq
+tests/cut/pairedq.2.fastq
+tests/cut/pairedu.1.fastq
+tests/cut/pairedu.2.fastq
+tests/cut/plus.fastq
+tests/cut/polya.fasta
+tests/cut/rest.fa
+tests/cut/restfront.fa
+tests/cut/s_1_sequence.txt
+tests/cut/small.fasta
+tests/cut/small.fastq
+tests/cut/small.trimmed.fastq
+tests/cut/small.untrimmed.fastq
+tests/cut/solid-no-zerocap.fastq
+tests/cut/solid.fasta
+tests/cut/solid.fastq
+tests/cut/solid5p-anchored.fasta
+tests/cut/solid5p-anchored.fastq
+tests/cut/solid5p-anchored.notrim.fasta
+tests/cut/solid5p-anchored.notrim.fastq
+tests/cut/solid5p.fasta
+tests/cut/solid5p.fastq
+tests/cut/solidbfast.fastq
+tests/cut/solidmaq.fastq
+tests/cut/solidqual.fastq
+tests/cut/sra.fastq
+tests/cut/stripped.fasta
+tests/cut/suffix.fastq
+tests/cut/trimN3.fasta
+tests/cut/trimN5.fasta
+tests/cut/twoadapters.fasta
+tests/cut/twoadapters.first.fasta
+tests/cut/twoadapters.second.fasta
+tests/cut/twoadapters.unknown.fasta
+tests/cut/unconditional-back.fastq
+tests/cut/unconditional-both.fastq
+tests/cut/unconditional-front.fastq
+tests/cut/wildcard.fa
+tests/cut/wildcardN.fa
+tests/cut/wildcard_adapter.fa
+tests/cut/wildcard_adapter_anywhere.fa
+tests/data/454.fa
+tests/data/E3M.fasta
+tests/data/E3M.qual
+tests/data/SRR2040271_1.fastq
+tests/data/adapter.fasta
+tests/data/anchored-back.fasta
+tests/data/anchored.fasta
+tests/data/anchored_no_indels.fasta
+tests/data/anywhere_repeat.fastq
+tests/data/dos.fastq
+tests/data/empty.fastq
+tests/data/example.fa
+tests/data/illumina.fastq.gz
+tests/data/illumina5.fastq
+tests/data/illumina64.fastq
+tests/data/interleaved.fastq
+tests/data/issue46.fasta
+tests/data/lengths.fa
+tests/data/linked.fasta
+tests/data/lowqual.fastq
+tests/data/maxn.fasta
+tests/data/multiblock.fastq.gz
+tests/data/nextseq.fastq
+tests/data/no_indels.fasta
+tests/data/overlapa.fa
+tests/data/overlapb.fa
+tests/data/paired.1.fastq
+tests/data/paired.2.fastq
+tests/data/plus.fastq
+tests/data/polya.fasta
+tests/data/prefix-adapter.fasta
+tests/data/rest.fa
+tests/data/rest.txt
+tests/data/restfront.txt
+tests/data/s_1_sequence.txt.gz
+tests/data/simple.fasta
+tests/data/simple.fastq
+tests/data/small.fastq
+tests/data/small.fastq.bz2
+tests/data/small.fastq.gz
+tests/data/small.fastq.xz
+tests/data/small.myownextension
+tests/data/solid.csfasta
+tests/data/solid.fasta
+tests/data/solid.fastq
+tests/data/solid.qual
+tests/data/solid5p.fasta
+tests/data/solid5p.fastq
+tests/data/sra.fastq
+tests/data/suffix-adapter.fasta
+tests/data/toolong.fa
+tests/data/tooshort.fa
+tests/data/tooshort.noprimer.fa
+tests/data/trimN3.fasta
+tests/data/trimN5.fasta
+tests/data/twoadapters.fasta
+tests/data/wildcard.fa
+tests/data/wildcardN.fa
+tests/data/wildcard_adapter.fa
+tests/data/withplus.fastq
\ No newline at end of file
diff --git a/cutadapt.egg-info/dependency_links.txt b/cutadapt.egg-info/dependency_links.txt
new file mode 100644
index 0000000..8b13789
--- /dev/null
+++ b/cutadapt.egg-info/dependency_links.txt
@@ -0,0 +1 @@
+
diff --git a/cutadapt.egg-info/top_level.txt b/cutadapt.egg-info/top_level.txt
new file mode 100644
index 0000000..0340b3c
--- /dev/null
+++ b/cutadapt.egg-info/top_level.txt
@@ -0,0 +1 @@
+cutadapt
diff --git a/cutadapt/__init__.py b/cutadapt/__init__.py
index e3422c7..b2fcf94 100644
--- a/cutadapt/__init__.py
+++ b/cutadapt/__init__.py
@@ -2,7 +2,9 @@
from __future__ import print_function, division, absolute_import
import sys
-__version__ = '1.10'
+from ._version import get_versions
+__version__ = get_versions()['version']
+del get_versions
def check_importability(): # pragma: no cover
try:
diff --git a/cutadapt/_seqio.c b/cutadapt/_seqio.c
index f82cc40..5f491dc 100644
--- a/cutadapt/_seqio.c
+++ b/cutadapt/_seqio.c
@@ -1,4 +1,4 @@
-/* Generated by Cython 0.23.4 */
+/* Generated by Cython 0.24 */
/* BEGIN: Cython Metadata
{
@@ -13,10 +13,10 @@ END: Cython Metadata */
#elif PY_VERSION_HEX < 0x02060000 || (0x03000000 <= PY_VERSION_HEX && PY_VERSION_HEX < 0x03020000)
#error Cython requires Python 2.6+ or Python 3.2+.
#else
-#define CYTHON_ABI "0_23_4"
+#define CYTHON_ABI "0_24"
#include <stddef.h>
#ifndef offsetof
-#define offsetof(type, member) ( (size_t) & ((type*)0) -> member )
+ #define offsetof(type, member) ( (size_t) & ((type*)0) -> member )
#endif
#if !defined(WIN32) && !defined(MS_WINDOWS)
#ifndef __stdcall
@@ -42,17 +42,23 @@ END: Cython Metadata */
#define Py_HUGE_VAL HUGE_VAL
#endif
#ifdef PYPY_VERSION
-#define CYTHON_COMPILING_IN_PYPY 1
-#define CYTHON_COMPILING_IN_CPYTHON 0
+ #define CYTHON_COMPILING_IN_PYPY 1
+ #define CYTHON_COMPILING_IN_CPYTHON 0
#else
-#define CYTHON_COMPILING_IN_PYPY 0
-#define CYTHON_COMPILING_IN_CPYTHON 1
+ #define CYTHON_COMPILING_IN_PYPY 0
+ #define CYTHON_COMPILING_IN_CPYTHON 1
#endif
#if !defined(CYTHON_USE_PYLONG_INTERNALS) && CYTHON_COMPILING_IN_CPYTHON && PY_VERSION_HEX >= 0x02070000
-#define CYTHON_USE_PYLONG_INTERNALS 1
+ #define CYTHON_USE_PYLONG_INTERNALS 1
+#endif
+#if CYTHON_USE_PYLONG_INTERNALS
+ #include "longintrepr.h"
+ #undef SHIFT
+ #undef BASE
+ #undef MASK
#endif
#if CYTHON_COMPILING_IN_PYPY && PY_VERSION_HEX < 0x02070600 && !defined(Py_OptimizeFlag)
-#define Py_OptimizeFlag 0
+ #define Py_OptimizeFlag 0
#endif
#define __PYX_BUILD_PY_SSIZE_T "n"
#define CYTHON_FORMAT_SSIZE_T "z"
@@ -88,6 +94,7 @@ END: Cython Metadata */
#define __Pyx_PyUnicode_KIND(u) PyUnicode_KIND(u)
#define __Pyx_PyUnicode_DATA(u) PyUnicode_DATA(u)
#define __Pyx_PyUnicode_READ(k, d, i) PyUnicode_READ(k, d, i)
+ #define __Pyx_PyUnicode_IS_TRUE(u) (0 != (likely(PyUnicode_IS_READY(u)) ? PyUnicode_GET_LENGTH(u) : PyUnicode_GET_SIZE(u)))
#else
#define CYTHON_PEP393_ENABLED 0
#define __Pyx_PyUnicode_READY(op) (0)
@@ -96,6 +103,7 @@ END: Cython Metadata */
#define __Pyx_PyUnicode_KIND(u) (sizeof(Py_UNICODE))
#define __Pyx_PyUnicode_DATA(u) ((void*)PyUnicode_AS_UNICODE(u))
#define __Pyx_PyUnicode_READ(k, d, i) ((void)(k), (Py_UCS4)(((Py_UNICODE*)d)[i]))
+ #define __Pyx_PyUnicode_IS_TRUE(u) (0 != PyUnicode_GET_SIZE(u))
#endif
#if CYTHON_COMPILING_IN_PYPY
#define __Pyx_PyUnicode_Concat(a, b) PyNumber_Add(a, b)
@@ -108,6 +116,14 @@ END: Cython Metadata */
#if CYTHON_COMPILING_IN_PYPY && !defined(PyUnicode_Contains)
#define PyUnicode_Contains(u, s) PySequence_Contains(u, s)
#endif
+#if CYTHON_COMPILING_IN_PYPY && !defined(PyObject_Format)
+ #define PyObject_Format(obj, fmt) PyObject_CallMethod(obj, "__format__", "O", fmt)
+#endif
+#if CYTHON_COMPILING_IN_PYPY && !defined(PyObject_Malloc)
+ #define PyObject_Malloc(s) PyMem_Malloc(s)
+ #define PyObject_Free(p) PyMem_Free(p)
+ #define PyObject_Realloc(p) PyMem_Realloc(p)
+#endif
#define __Pyx_PyString_FormatSafe(a, b) ((unlikely((a) == Py_None)) ? PyNumber_Remainder(a, b) : __Pyx_PyString_Format(a, b))
#define __Pyx_PyUnicode_FormatSafe(a, b) ((unlikely((a) == Py_None)) ? PyNumber_Remainder(a, b) : PyUnicode_Format(a, b))
#if PY_MAJOR_VERSION >= 3
@@ -115,6 +131,9 @@ END: Cython Metadata */
#else
#define __Pyx_PyString_Format(a, b) PyString_Format(a, b)
#endif
+#if PY_MAJOR_VERSION < 3 && !defined(PyObject_ASCII)
+ #define PyObject_ASCII(o) PyObject_Repr(o)
+#endif
#if PY_MAJOR_VERSION >= 3
#define PyBaseString_Type PyUnicode_Type
#define PyStringObject PyUnicodeObject
@@ -224,6 +243,11 @@ static CYTHON_INLINE float __PYX_NAN() {
#endif
+#define __PYX_ERR(f_index, lineno, Ln_error) \
+{ \
+ __pyx_filename = __pyx_f[f_index]; __pyx_lineno = lineno; __pyx_clineno = __LINE__; goto Ln_error; \
+}
+
#if PY_MAJOR_VERSION >= 3
#define __Pyx_PyNumber_Divide(x,y) PyNumber_TrueDivide(x,y)
#define __Pyx_PyNumber_InPlaceDivide(x,y) PyNumber_InPlaceTrueDivide(x,y)
@@ -270,7 +294,7 @@ static CYTHON_INLINE float __PYX_NAN() {
# define CYTHON_NCP_UNUSED CYTHON_UNUSED
# endif
#endif
-typedef struct {PyObject **p; char *s; const Py_ssize_t n; const char* encoding;
+typedef struct {PyObject **p; const char *s; const Py_ssize_t n; const char* encoding;
const char is_unicode; const char is_str; const char intern; } __Pyx_StringTabEntry;
#define __PYX_DEFAULT_STRING_ENCODING_IS_ASCII 0
@@ -344,7 +368,7 @@ static CYTHON_INLINE size_t __Pyx_Py_UNICODE_strlen(const Py_UNICODE *u)
#define __Pyx_Owned_Py_None(b) __Pyx_NewRef(Py_None)
#define __Pyx_PyBool_FromLong(b) ((b) ? __Pyx_NewRef(Py_True) : __Pyx_NewRef(Py_False))
static CYTHON_INLINE int __Pyx_PyObject_IsTrue(PyObject*);
-static CYTHON_INLINE PyObject* __Pyx_PyNumber_Int(PyObject* x);
+static CYTHON_INLINE PyObject* __Pyx_PyNumber_IntOrLong(PyObject* x);
static CYTHON_INLINE Py_ssize_t __Pyx_PyIndex_AsSsize_t(PyObject*);
static CYTHON_INLINE PyObject * __Pyx_PyInt_FromSize_t(size_t);
#if CYTHON_COMPILING_IN_CPYTHON
@@ -353,6 +377,12 @@ static CYTHON_INLINE PyObject * __Pyx_PyInt_FromSize_t(size_t);
#define __pyx_PyFloat_AsDouble(x) PyFloat_AsDouble(x)
#endif
#define __pyx_PyFloat_AsFloat(x) ((float) __pyx_PyFloat_AsDouble(x))
+#if PY_MAJOR_VERSION >= 3
+#define __Pyx_PyNumber_Int(x) (PyLong_CheckExact(x) ? __Pyx_NewRef(x) : PyNumber_Long(x))
+#else
+#define __Pyx_PyNumber_Int(x) (PyInt_CheckExact(x) ? __Pyx_NewRef(x) : PyNumber_Int(x))
+#endif
+#define __Pyx_PyNumber_Float(x) (PyFloat_CheckExact(x) ? __Pyx_NewRef(x) : PyNumber_Float(x))
#if PY_MAJOR_VERSION < 3 && __PYX_DEFAULT_STRING_ENCODING_IS_ASCII
static int __Pyx_sys_getdefaultencoding_not_ascii;
static int __Pyx_init_sys_getdefaultencoding_params(void) {
@@ -443,6 +473,7 @@ static PyObject *__pyx_d;
static PyObject *__pyx_b;
static PyObject *__pyx_empty_tuple;
static PyObject *__pyx_empty_bytes;
+static PyObject *__pyx_empty_unicode;
static int __pyx_lineno;
static int __pyx_clineno = 0;
static const char * __pyx_cfilenm= __FILE__;
@@ -462,31 +493,17 @@ struct __pyx_defaults {
PyObject *__pyx_arg_sequence_class;
};
-/* "cutadapt/_seqio.pyx":8
- *
- *
- * cdef class Sequence(object): # <<<<<<<<<<<<<<
- * """
- * A record in a FASTQ file. Also used for FASTA (then the qualities attribute
- */
struct __pyx_obj_8cutadapt_6_seqio_Sequence {
PyObject_HEAD
PyObject *name;
PyObject *sequence;
PyObject *qualities;
- PyObject *name2;
+ int second_header;
PyObject *match;
PyObject *match_info;
};
-/* "cutadapt/_seqio.pyx":88
- * self.delivers_qualities = True
- *
- * def __iter__(self): # <<<<<<<<<<<<<<
- * """
- * Yield Sequence objects
- */
struct __pyx_obj_8cutadapt_6_seqio___pyx_scope_struct____iter__ {
PyObject_HEAD
int __pyx_v_i;
@@ -495,6 +512,7 @@ struct __pyx_obj_8cutadapt_6_seqio___pyx_scope_struct____iter__ {
PyObject *__pyx_v_name;
PyObject *__pyx_v_name2;
PyObject *__pyx_v_qualities;
+ int __pyx_v_second_header;
PyObject *__pyx_v_self;
PyObject *__pyx_v_sequence;
PyObject *__pyx_v_sequence_class;
@@ -506,6 +524,7 @@ struct __pyx_obj_8cutadapt_6_seqio___pyx_scope_struct____iter__ {
/* --- Runtime support code (head) --- */
+/* Refnanny.proto */
#ifndef CYTHON_REFNANNY
#define CYTHON_REFNANNY 0
#endif
@@ -568,6 +587,7 @@ struct __pyx_obj_8cutadapt_6_seqio___pyx_scope_struct____iter__ {
#define __Pyx_CLEAR(r) do { PyObject* tmp = ((PyObject*)(r)); r = NULL; __Pyx_DECREF(tmp);} while(0)
#define __Pyx_XCLEAR(r) do { if((r) != NULL) {PyObject* tmp = ((PyObject*)(r)); r = NULL; __Pyx_DECREF(tmp);}} while(0)
+/* PyObjectGetAttrStr.proto */
#if CYTHON_COMPILING_IN_CPYTHON
static CYTHON_INLINE PyObject* __Pyx_PyObject_GetAttrStr(PyObject* obj, PyObject* attr_name) {
PyTypeObject* tp = Py_TYPE(obj);
@@ -583,45 +603,78 @@ static CYTHON_INLINE PyObject* __Pyx_PyObject_GetAttrStr(PyObject* obj, PyObject
#define __Pyx_PyObject_GetAttrStr(o,n) PyObject_GetAttr(o,n)
#endif
+/* GetBuiltinName.proto */
static PyObject *__Pyx_GetBuiltinName(PyObject *name);
+/* RaiseArgTupleInvalid.proto */
static void __Pyx_RaiseArgtupleInvalid(const char* func_name, int exact,
Py_ssize_t num_min, Py_ssize_t num_max, Py_ssize_t num_found);
+/* RaiseDoubleKeywords.proto */
static void __Pyx_RaiseDoubleKeywordsError(const char* func_name, PyObject* kw_name);
+/* ParseKeywords.proto */
static int __Pyx_ParseOptionalKeywords(PyObject *kwds, PyObject **argnames[],\
PyObject *kwds2, PyObject *values[], Py_ssize_t num_pos_args,\
const char* function_name);
+/* ArgTypeTest.proto */
static CYTHON_INLINE int __Pyx_ArgTypeTest(PyObject *obj, PyTypeObject *type, int none_allowed,
const char *name, int exact);
+/* GetModuleGlobalName.proto */
static CYTHON_INLINE PyObject *__Pyx_GetModuleGlobalName(PyObject *name);
+/* PyObjectCall.proto */
#if CYTHON_COMPILING_IN_CPYTHON
static CYTHON_INLINE PyObject* __Pyx_PyObject_Call(PyObject *func, PyObject *arg, PyObject *kw);
#else
#define __Pyx_PyObject_Call(func, arg, kw) PyObject_Call(func, arg, kw)
#endif
+/* PyObjectCallMethO.proto */
#if CYTHON_COMPILING_IN_CPYTHON
static CYTHON_INLINE PyObject* __Pyx_PyObject_CallMethO(PyObject *func, PyObject *arg);
#endif
+/* PyObjectCallOneArg.proto */
static CYTHON_INLINE PyObject* __Pyx_PyObject_CallOneArg(PyObject *func, PyObject *arg);
-static CYTHON_INLINE void __Pyx_ErrRestore(PyObject *type, PyObject *value, PyObject *tb);
-static CYTHON_INLINE void __Pyx_ErrFetch(PyObject **type, PyObject **value, PyObject **tb);
+/* PyThreadStateGet.proto */
+#if CYTHON_COMPILING_IN_CPYTHON
+#define __Pyx_PyThreadState_declare PyThreadState *__pyx_tstate;
+#define __Pyx_PyThreadState_assign __pyx_tstate = PyThreadState_GET();
+#else
+#define __Pyx_PyThreadState_declare
+#define __Pyx_PyThreadState_assign
+#endif
+
+/* PyErrFetchRestore.proto */
+#if CYTHON_COMPILING_IN_CPYTHON
+#define __Pyx_ErrRestoreWithState(type, value, tb) __Pyx_ErrRestoreInState(PyThreadState_GET(), type, value, tb)
+#define __Pyx_ErrFetchWithState(type, value, tb) __Pyx_ErrFetchInState(PyThreadState_GET(), type, value, tb)
+#define __Pyx_ErrRestore(type, value, tb) __Pyx_ErrRestoreInState(__pyx_tstate, type, value, tb)
+#define __Pyx_ErrFetch(type, value, tb) __Pyx_ErrFetchInState(__pyx_tstate, type, value, tb)
+static CYTHON_INLINE void __Pyx_ErrRestoreInState(PyThreadState *tstate, PyObject *type, PyObject *value, PyObject *tb);
+static CYTHON_INLINE void __Pyx_ErrFetchInState(PyThreadState *tstate, PyObject **type, PyObject **value, PyObject **tb);
+#else
+#define __Pyx_ErrRestoreWithState(type, value, tb) PyErr_Restore(type, value, tb)
+#define __Pyx_ErrFetchWithState(type, value, tb) PyErr_Fetch(type, value, tb)
+#define __Pyx_ErrRestore(type, value, tb) PyErr_Restore(type, value, tb)
+#define __Pyx_ErrFetch(type, value, tb) PyErr_Fetch(type, value, tb)
+#endif
+/* RaiseException.proto */
static void __Pyx_Raise(PyObject *type, PyObject *value, PyObject *tb, PyObject *cause);
+/* PyObjectCallNoArg.proto */
#if CYTHON_COMPILING_IN_CPYTHON
static CYTHON_INLINE PyObject* __Pyx_PyObject_CallNoArg(PyObject *func);
#else
#define __Pyx_PyObject_CallNoArg(func) __Pyx_PyObject_Call(func, __pyx_empty_tuple, NULL)
#endif
+/* PyObjectSetAttrStr.proto */
#if CYTHON_COMPILING_IN_CPYTHON
#define __Pyx_PyObject_DelAttrStr(o,n) __Pyx_PyObject_SetAttrStr(o,n,NULL)
static CYTHON_INLINE int __Pyx_PyObject_SetAttrStr(PyObject* obj, PyObject* attr_name, PyObject* value) {
@@ -639,9 +692,11 @@ static CYTHON_INLINE int __Pyx_PyObject_SetAttrStr(PyObject* obj, PyObject* attr
#define __Pyx_PyObject_SetAttrStr(o,n,v) PyObject_SetAttr(o,n,v)
#endif
+/* IterNext.proto */
#define __Pyx_PyIter_Next(obj) __Pyx_PyIter_Next2(obj, NULL)
static CYTHON_INLINE PyObject *__Pyx_PyIter_Next2(PyObject *, PyObject *);
+/* GetItemInt.proto */
#define __Pyx_GetItemInt(o, i, type, is_signed, to_py_func, is_list, wraparound, boundscheck)\
(__Pyx_fits_Py_ssize_t(i, type, is_signed) ?\
__Pyx_GetItemInt_Fast(o, (Py_ssize_t)i, is_list, wraparound, boundscheck) :\
@@ -663,41 +718,55 @@ static CYTHON_INLINE PyObject *__Pyx_GetItemInt_Generic(PyObject *o, PyObject* j
static CYTHON_INLINE PyObject *__Pyx_GetItemInt_Fast(PyObject *o, Py_ssize_t i,
int is_list, int wraparound, int boundscheck);
+/* IncludeStringH.proto */
#include <string.h>
+/* BytesEquals.proto */
static CYTHON_INLINE int __Pyx_PyBytes_Equals(PyObject* s1, PyObject* s2, int equals);
+/* UnicodeEquals.proto */
static CYTHON_INLINE int __Pyx_PyUnicode_Equals(PyObject* s1, PyObject* s2, int equals);
+/* StrEquals.proto */
#if PY_MAJOR_VERSION >= 3
#define __Pyx_PyString_Equals __Pyx_PyUnicode_Equals
#else
#define __Pyx_PyString_Equals __Pyx_PyBytes_Equals
#endif
+/* bytes_tailmatch.proto */
static int __Pyx_PyBytes_SingleTailmatch(PyObject* self, PyObject* arg,
Py_ssize_t start, Py_ssize_t end, int direction);
static int __Pyx_PyBytes_Tailmatch(PyObject* self, PyObject* substr,
Py_ssize_t start, Py_ssize_t end, int direction);
+/* unicode_tailmatch.proto */
static int __Pyx_PyUnicode_Tailmatch(PyObject* s, PyObject* substr,
Py_ssize_t start, Py_ssize_t end, int direction);
+/* str_tailmatch.proto */
static CYTHON_INLINE int __Pyx_PyStr_Tailmatch(PyObject* self, PyObject* arg, Py_ssize_t start,
Py_ssize_t end, int direction);
+/* None.proto */
static CYTHON_INLINE void __Pyx_RaiseUnboundLocalError(const char *varname);
+/* None.proto */
static CYTHON_INLINE long __Pyx_mod_long(long, long);
+/* Import.proto */
static PyObject *__Pyx_Import(PyObject *name, PyObject *from_list, int level);
+/* ImportFrom.proto */
static PyObject* __Pyx_ImportFrom(PyObject* module, PyObject* name);
+/* CalculateMetaclass.proto */
static PyObject *__Pyx_CalculateMetaclass(PyTypeObject *metaclass, PyObject *bases);
+/* FetchCommonType.proto */
static PyTypeObject* __Pyx_FetchCommonType(PyTypeObject* type);
+/* CythonFunction.proto */
#define __Pyx_CyFunction_USED 1
#include <structmember.h>
#define __Pyx_CYFUNCTION_STATICMETHOD 0x01
@@ -751,14 +820,16 @@ static CYTHON_INLINE void __Pyx_CyFunction_SetAnnotationsDict(PyObject *m,
PyObject *dict);
static int __pyx_CyFunction_init(void);
+/* Py3ClassCreate.proto */
static PyObject *__Pyx_Py3MetaclassPrepare(PyObject *metaclass, PyObject *bases, PyObject *name, PyObject *qualname,
PyObject *mkw, PyObject *modname, PyObject *doc);
static PyObject *__Pyx_Py3ClassCreate(PyObject *metaclass, PyObject *name, PyObject *bases, PyObject *dict,
PyObject *mkw, int calculate_metaclass, int allow_py2_metaclass);
+/* CodeObjectCache.proto */
typedef struct {
- int code_line;
PyCodeObject* code_object;
+ int code_line;
} __Pyx_CodeObjectCacheEntry;
struct __Pyx_CodeObjectCache {
int count;
@@ -770,19 +841,31 @@ static int __pyx_bisect_code_objects(__Pyx_CodeObjectCacheEntry* entries, int co
static PyCodeObject *__pyx_find_code_object(int code_line);
static void __pyx_insert_code_object(int code_line, PyCodeObject* code_object);
+/* AddTraceback.proto */
static void __Pyx_AddTraceback(const char *funcname, int c_line,
int py_line, const char *filename);
-static CYTHON_INLINE int __Pyx_PyInt_As_int(PyObject *);
-
+/* CIntToPy.proto */
static CYTHON_INLINE PyObject* __Pyx_PyInt_From_long(long value);
+/* CIntFromPy.proto */
+static CYTHON_INLINE int __Pyx_PyInt_As_int(PyObject *);
+
+/* CIntFromPy.proto */
static CYTHON_INLINE long __Pyx_PyInt_As_long(PyObject *);
+/* SwapException.proto */
+#if CYTHON_COMPILING_IN_CPYTHON
+#define __Pyx_ExceptionSwap(type, value, tb) __Pyx__ExceptionSwap(__pyx_tstate, type, value, tb)
+static CYTHON_INLINE void __Pyx__ExceptionSwap(PyThreadState *tstate, PyObject **type, PyObject **value, PyObject **tb);
+#else
static CYTHON_INLINE void __Pyx_ExceptionSwap(PyObject **type, PyObject **value, PyObject **tb);
+#endif
+/* PyObjectCallMethod1.proto */
static PyObject* __Pyx_PyObject_CallMethod1(PyObject* obj, PyObject* method_name, PyObject* arg);
+/* CoroutineBase.proto */
typedef PyObject *(*__pyx_coroutine_body_t)(PyObject *, PyObject *);
typedef struct {
PyObject_HEAD
@@ -808,10 +891,13 @@ static int __Pyx_PyGen_FetchStopIterationValue(PyObject **pvalue);
#define __Pyx_PyGen_FetchStopIterationValue(pvalue) PyGen_FetchStopIterationValue(pvalue)
#endif
+/* PatchModuleWithCoroutine.proto */
static PyObject* __Pyx_Coroutine_patch_module(PyObject* module, const char* py_code);
+/* PatchGeneratorABC.proto */
static int __Pyx_patch_abc(void);
+/* Generator.proto */
#define __Pyx_Generator_USED
static PyTypeObject *__pyx_GeneratorType = 0;
#define __Pyx_Generator_CheckExact(obj) (Py_TYPE(obj) == __pyx_GeneratorType)
@@ -820,8 +906,10 @@ static PyTypeObject *__pyx_GeneratorType = 0;
static PyObject *__Pyx_Generator_Next(PyObject *self);
static int __pyx_Generator_init(void);
+/* CheckBinaryVersion.proto */
static int __Pyx_check_binary_version(void);
+/* InitStrings.proto */
static int __Pyx_InitStrings(__Pyx_StringTabEntry *t);
@@ -834,63 +922,64 @@ int __pyx_module_is_main_cutadapt___seqio = 0;
/* Implementation of 'cutadapt._seqio' */
static PyObject *__pyx_builtin_NotImplementedError;
static PyObject *__pyx_builtin_super;
-static char __pyx_k_[] = "";
-static char __pyx_k_i[] = "i";
-static char __pyx_k__2[] = "@";
-static char __pyx_k__3[] = "\r\n";
-static char __pyx_k__4[] = "+\n";
-static char __pyx_k__5[] = "+";
-static char __pyx_k_it[] = "it";
-static char __pyx_k_doc[] = "__doc__";
-static char __pyx_k_args[] = "args";
-static char __pyx_k_file[] = "file";
-static char __pyx_k_init[] = "__init__";
-static char __pyx_k_iter[] = "__iter__";
-static char __pyx_k_line[] = "line";
-static char __pyx_k_main[] = "__main__";
-static char __pyx_k_name[] = "name";
-static char __pyx_k_self[] = "self";
-static char __pyx_k_send[] = "send";
-static char __pyx_k_test[] = "__test__";
-static char __pyx_k_class[] = "__class__";
-static char __pyx_k_close[] = "close";
-static char __pyx_k_match[] = "match";
-static char __pyx_k_name2[] = "name2";
-static char __pyx_k_seqio[] = "seqio";
-static char __pyx_k_strip[] = "strip";
-static char __pyx_k_super[] = "super";
-static char __pyx_k_throw[] = "throw";
-static char __pyx_k_xopen[] = "xopen";
-static char __pyx_k_file_2[] = "_file";
-static char __pyx_k_format[] = "format";
-static char __pyx_k_import[] = "__import__";
-static char __pyx_k_module[] = "__module__";
-static char __pyx_k_rstrip[] = "rstrip";
-static char __pyx_k_prepare[] = "__prepare__";
-static char __pyx_k_shorten[] = "_shorten";
-static char __pyx_k_qualname[] = "__qualname__";
-static char __pyx_k_sequence[] = "sequence";
-static char __pyx_k_metaclass[] = "__metaclass__";
-static char __pyx_k_qualities[] = "qualities";
-static char __pyx_k_match_info[] = "match_info";
-static char __pyx_k_FastqReader[] = "FastqReader";
-static char __pyx_k_FormatError[] = "FormatError";
-static char __pyx_k_qualities_0_r[] = ", qualities={0!r}";
-static char __pyx_k_SequenceReader[] = "SequenceReader";
-static char __pyx_k_sequence_class[] = "sequence_class";
-static char __pyx_k_cutadapt__seqio[] = "cutadapt._seqio";
-static char __pyx_k_FastqReader___init[] = "FastqReader.__init__";
-static char __pyx_k_FastqReader___iter[] = "FastqReader.__iter__";
-static char __pyx_k_delivers_qualities[] = "delivers_qualities";
-static char __pyx_k_NotImplementedError[] = "NotImplementedError";
-static char __pyx_k_FASTQ_file_ended_prematurely[] = "FASTQ file ended prematurely";
-static char __pyx_k_Sequence_name_0_r_sequence_1_r[] = "<Sequence(name={0!r}, sequence={1!r}{2})>";
-static char __pyx_k_At_line_0_Sequence_descriptions[] = "At line {0}: Sequence descriptions in the FASTQ file don't match ({1!r} != {2!r}).\nThe second sequence description must be either empty or equal to the first description.";
-static char __pyx_k_Reader_for_FASTQ_files_Does_not[] = "\n\tReader for FASTQ files. Does not support multi-line FASTQ files.\n\t";
-static char __pyx_k_home_marcel_scm_cutadapt_cutada[] = "/home/marcel/scm/cutadapt/cutadapt/_seqio.pyx";
-static char __pyx_k_In_read_named_0_r_length_of_qual[] = "In read named {0!r}: length of quality sequence ({1}) and length of read ({2}) do not match";
-static char __pyx_k_Line_0_in_FASTQ_file_is_expected[] = "Line {0} in FASTQ file is expected to start with '@', but found {1!r}";
-static char __pyx_k_Line_0_in_FASTQ_file_is_expected_2[] = "Line {0} in FASTQ file is expected to start with '+', but found {1!r}";
+static const char __pyx_k_[] = "";
+static const char __pyx_k_i[] = "i";
+static const char __pyx_k__2[] = "@";
+static const char __pyx_k__3[] = "\r\n";
+static const char __pyx_k__4[] = "+\n";
+static const char __pyx_k__5[] = "+";
+static const char __pyx_k_it[] = "it";
+static const char __pyx_k_doc[] = "__doc__";
+static const char __pyx_k_args[] = "args";
+static const char __pyx_k_file[] = "file";
+static const char __pyx_k_init[] = "__init__";
+static const char __pyx_k_iter[] = "__iter__";
+static const char __pyx_k_line[] = "line";
+static const char __pyx_k_main[] = "__main__";
+static const char __pyx_k_name[] = "name";
+static const char __pyx_k_self[] = "self";
+static const char __pyx_k_send[] = "send";
+static const char __pyx_k_test[] = "__test__";
+static const char __pyx_k_class[] = "__class__";
+static const char __pyx_k_close[] = "close";
+static const char __pyx_k_match[] = "match";
+static const char __pyx_k_name2[] = "name2";
+static const char __pyx_k_seqio[] = "seqio";
+static const char __pyx_k_strip[] = "strip";
+static const char __pyx_k_super[] = "super";
+static const char __pyx_k_throw[] = "throw";
+static const char __pyx_k_xopen[] = "xopen";
+static const char __pyx_k_file_2[] = "_file";
+static const char __pyx_k_format[] = "format";
+static const char __pyx_k_import[] = "__import__";
+static const char __pyx_k_module[] = "__module__";
+static const char __pyx_k_rstrip[] = "rstrip";
+static const char __pyx_k_prepare[] = "__prepare__";
+static const char __pyx_k_shorten[] = "_shorten";
+static const char __pyx_k_qualname[] = "__qualname__";
+static const char __pyx_k_sequence[] = "sequence";
+static const char __pyx_k_metaclass[] = "__metaclass__";
+static const char __pyx_k_qualities[] = "qualities";
+static const char __pyx_k_match_info[] = "match_info";
+static const char __pyx_k_FastqReader[] = "FastqReader";
+static const char __pyx_k_FormatError[] = "FormatError";
+static const char __pyx_k_qualities_0_r[] = ", qualities={0!r}";
+static const char __pyx_k_second_header[] = "second_header";
+static const char __pyx_k_SequenceReader[] = "SequenceReader";
+static const char __pyx_k_sequence_class[] = "sequence_class";
+static const char __pyx_k_cutadapt__seqio[] = "cutadapt._seqio";
+static const char __pyx_k_FastqReader___init[] = "FastqReader.__init__";
+static const char __pyx_k_FastqReader___iter[] = "FastqReader.__iter__";
+static const char __pyx_k_delivers_qualities[] = "delivers_qualities";
+static const char __pyx_k_NotImplementedError[] = "NotImplementedError";
+static const char __pyx_k_FASTQ_file_ended_prematurely[] = "FASTQ file ended prematurely";
+static const char __pyx_k_Sequence_name_0_r_sequence_1_r[] = "<Sequence(name={0!r}, sequence={1!r}{2})>";
+static const char __pyx_k_At_line_0_Sequence_descriptions[] = "At line {0}: Sequence descriptions in the FASTQ file don't match ({1!r} != {2!r}).\nThe second sequence description must be either empty or equal to the first description.";
+static const char __pyx_k_Reader_for_FASTQ_files_Does_not[] = "\n\tReader for FASTQ files. Does not support multi-line FASTQ files.\n\t";
+static const char __pyx_k_home_marcel_scm_cutadapt_cutada[] = "/home/marcel/scm/cutadapt/cutadapt/_seqio.pyx";
+static const char __pyx_k_In_read_named_0_r_length_of_qual[] = "In read named {0!r}: length of quality sequence ({1}) and length of read ({2}) do not match";
+static const char __pyx_k_Line_0_in_FASTQ_file_is_expected[] = "Line {0} in FASTQ file is expected to start with '@', but found {1!r}";
+static const char __pyx_k_Line_0_in_FASTQ_file_is_expected_2[] = "Line {0} in FASTQ file is expected to start with '+', but found {1!r}";
static PyObject *__pyx_kp_s_;
static PyObject *__pyx_kp_s_At_line_0_Sequence_descriptions;
static PyObject *__pyx_kp_s_FASTQ_file_ended_prematurely;
@@ -937,6 +1026,7 @@ static PyObject *__pyx_n_s_qualities;
static PyObject *__pyx_kp_s_qualities_0_r;
static PyObject *__pyx_n_s_qualname;
static PyObject *__pyx_n_s_rstrip;
+static PyObject *__pyx_n_s_second_header;
static PyObject *__pyx_n_s_self;
static PyObject *__pyx_n_s_send;
static PyObject *__pyx_n_s_seqio;
@@ -948,7 +1038,7 @@ static PyObject *__pyx_n_s_super;
static PyObject *__pyx_n_s_test;
static PyObject *__pyx_n_s_throw;
static PyObject *__pyx_n_s_xopen;
-static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self, PyObject *__pyx_v_name, PyObject *__pyx_v_sequence, PyObject *__pyx_v_qualities, PyObject *__pyx_v_name2, PyObject *__pyx_v_match, PyObject *__pyx_v_match_info); /* proto */
+static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self, PyObject *__pyx_v_name, PyObject *__pyx_v_sequence, PyObject *__pyx_v_qualities, int __pyx_v_second_header, PyObject *__pyx_v_match, PyObject *__pyx_v_match_info); /* proto */
static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_2__getitem__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self, PyObject *__pyx_v_key); /* proto */
static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_4__repr__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self); /* proto */
static Py_ssize_t __pyx_pf_8cutadapt_6_seqio_8Sequence_6__len__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self); /* proto */
@@ -963,9 +1053,8 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence_8sequence_4__del__(struct __pyx_
static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_9qualities___get__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self); /* proto */
static int __pyx_pf_8cutadapt_6_seqio_8Sequence_9qualities_2__set__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self, PyObject *__pyx_v_value); /* proto */
static int __pyx_pf_8cutadapt_6_seqio_8Sequence_9qualities_4__del__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self); /* proto */
-static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_5name2___get__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self); /* proto */
-static int __pyx_pf_8cutadapt_6_seqio_8Sequence_5name2_2__set__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self, PyObject *__pyx_v_value); /* proto */
-static int __pyx_pf_8cutadapt_6_seqio_8Sequence_5name2_4__del__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self); /* proto */
+static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_13second_header___get__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self); /* proto */
+static int __pyx_pf_8cutadapt_6_seqio_8Sequence_13second_header_2__set__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self, PyObject *__pyx_v_value); /* proto */
static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_5match___get__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self); /* proto */
static int __pyx_pf_8cutadapt_6_seqio_8Sequence_5match_2__set__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self, PyObject *__pyx_v_value); /* proto */
static int __pyx_pf_8cutadapt_6_seqio_8Sequence_5match_4__del__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self); /* proto */
@@ -984,13 +1073,6 @@ static PyObject *__pyx_tuple__10;
static PyObject *__pyx_codeobj__9;
static PyObject *__pyx_codeobj__11;
-/* "cutadapt/_seqio.pyx":25
- * public object match_info
- *
- * def __init__(self, str name, str sequence, str qualities=None, str name2='', match=None, # <<<<<<<<<<<<<<
- * match_info=None):
- * """Set qualities to None if there are no quality values"""
- */
/* Python wrapper */
static int __pyx_pw_8cutadapt_6_seqio_8Sequence_1__init__(PyObject *__pyx_v_self, PyObject *__pyx_args, PyObject *__pyx_kwds); /*proto*/
@@ -1002,29 +1084,18 @@ static int __pyx_pw_8cutadapt_6_seqio_8Sequence_1__init__(PyObject *__pyx_v_self
PyObject *__pyx_v_name = 0;
PyObject *__pyx_v_sequence = 0;
PyObject *__pyx_v_qualities = 0;
- PyObject *__pyx_v_name2 = 0;
+ int __pyx_v_second_header;
PyObject *__pyx_v_match = 0;
PyObject *__pyx_v_match_info = 0;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
int __pyx_r;
__Pyx_RefNannyDeclarations
__Pyx_RefNannySetupContext("__init__ (wrapper)", 0);
{
- static PyObject **__pyx_pyargnames[] = {&__pyx_n_s_name,&__pyx_n_s_sequence,&__pyx_n_s_qualities,&__pyx_n_s_name2,&__pyx_n_s_match,&__pyx_n_s_match_info,0};
+ static PyObject **__pyx_pyargnames[] = {&__pyx_n_s_name,&__pyx_n_s_sequence,&__pyx_n_s_qualities,&__pyx_n_s_second_header,&__pyx_n_s_match,&__pyx_n_s_match_info,0};
PyObject* values[6] = {0,0,0,0,0,0};
values[2] = ((PyObject*)Py_None);
- values[3] = ((PyObject*)__pyx_kp_s_);
values[4] = ((PyObject *)Py_None);
- /* "cutadapt/_seqio.pyx":26
- *
- * def __init__(self, str name, str sequence, str qualities=None, str name2='', match=None,
- * match_info=None): # <<<<<<<<<<<<<<
- * """Set qualities to None if there are no quality values"""
- * self.name = name
- */
values[5] = ((PyObject *)Py_None);
if (unlikely(__pyx_kwds)) {
Py_ssize_t kw_args;
@@ -1047,7 +1118,7 @@ static int __pyx_pw_8cutadapt_6_seqio_8Sequence_1__init__(PyObject *__pyx_v_self
case 1:
if (likely((values[1] = PyDict_GetItem(__pyx_kwds, __pyx_n_s_sequence)) != 0)) kw_args--;
else {
- __Pyx_RaiseArgtupleInvalid("__init__", 0, 2, 6, 1); {__pyx_filename = __pyx_f[0]; __pyx_lineno = 25; __pyx_clineno = __LINE__; goto __pyx_L3_error;}
+ __Pyx_RaiseArgtupleInvalid("__init__", 0, 2, 6, 1); __PYX_ERR(0, 25, __pyx_L3_error)
}
case 2:
if (kw_args > 0) {
@@ -1056,7 +1127,7 @@ static int __pyx_pw_8cutadapt_6_seqio_8Sequence_1__init__(PyObject *__pyx_v_self
}
case 3:
if (kw_args > 0) {
- PyObject* value = PyDict_GetItem(__pyx_kwds, __pyx_n_s_name2);
+ PyObject* value = PyDict_GetItem(__pyx_kwds, __pyx_n_s_second_header);
if (value) { values[3] = value; kw_args--; }
}
case 4:
@@ -1071,7 +1142,7 @@ static int __pyx_pw_8cutadapt_6_seqio_8Sequence_1__init__(PyObject *__pyx_v_self
}
}
if (unlikely(kw_args > 0)) {
- if (unlikely(__Pyx_ParseOptionalKeywords(__pyx_kwds, __pyx_pyargnames, 0, values, pos_args, "__init__") < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 25; __pyx_clineno = __LINE__; goto __pyx_L3_error;}
+ if (unlikely(__Pyx_ParseOptionalKeywords(__pyx_kwds, __pyx_pyargnames, 0, values, pos_args, "__init__") < 0)) __PYX_ERR(0, 25, __pyx_L3_error)
}
} else {
switch (PyTuple_GET_SIZE(__pyx_args)) {
@@ -1088,31 +1159,27 @@ static int __pyx_pw_8cutadapt_6_seqio_8Sequence_1__init__(PyObject *__pyx_v_self
__pyx_v_name = ((PyObject*)values[0]);
__pyx_v_sequence = ((PyObject*)values[1]);
__pyx_v_qualities = ((PyObject*)values[2]);
- __pyx_v_name2 = ((PyObject*)values[3]);
+ if (values[3]) {
+ __pyx_v_second_header = __Pyx_PyObject_IsTrue(values[3]); if (unlikely((__pyx_v_second_header == (int)-1) && PyErr_Occurred())) __PYX_ERR(0, 25, __pyx_L3_error)
+ } else {
+
+ __pyx_v_second_header = ((int)0);
+ }
__pyx_v_match = values[4];
__pyx_v_match_info = values[5];
}
goto __pyx_L4_argument_unpacking_done;
__pyx_L5_argtuple_error:;
- __Pyx_RaiseArgtupleInvalid("__init__", 0, 2, 6, PyTuple_GET_SIZE(__pyx_args)); {__pyx_filename = __pyx_f[0]; __pyx_lineno = 25; __pyx_clineno = __LINE__; goto __pyx_L3_error;}
+ __Pyx_RaiseArgtupleInvalid("__init__", 0, 2, 6, PyTuple_GET_SIZE(__pyx_args)); __PYX_ERR(0, 25, __pyx_L3_error)
__pyx_L3_error:;
__Pyx_AddTraceback("cutadapt._seqio.Sequence.__init__", __pyx_clineno, __pyx_lineno, __pyx_filename);
__Pyx_RefNannyFinishContext();
return -1;
__pyx_L4_argument_unpacking_done:;
- if (unlikely(!__Pyx_ArgTypeTest(((PyObject *)__pyx_v_name), (&PyString_Type), 1, "name", 1))) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 25; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- if (unlikely(!__Pyx_ArgTypeTest(((PyObject *)__pyx_v_sequence), (&PyString_Type), 1, "sequence", 1))) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 25; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- if (unlikely(!__Pyx_ArgTypeTest(((PyObject *)__pyx_v_qualities), (&PyString_Type), 1, "qualities", 1))) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 25; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- if (unlikely(!__Pyx_ArgTypeTest(((PyObject *)__pyx_v_name2), (&PyString_Type), 1, "name2", 1))) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 25; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __pyx_r = __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(((struct __pyx_obj_8cutadapt_6_seqio_Sequence *)__pyx_v_self), __pyx_v_name, __pyx_v_sequence, __pyx_v_qualities, __pyx_v_name2, __pyx_v_match, __pyx_v_match_info);
-
- /* "cutadapt/_seqio.pyx":25
- * public object match_info
- *
- * def __init__(self, str name, str sequence, str qualities=None, str name2='', match=None, # <<<<<<<<<<<<<<
- * match_info=None):
- * """Set qualities to None if there are no quality values"""
- */
+ if (unlikely(!__Pyx_ArgTypeTest(((PyObject *)__pyx_v_name), (&PyString_Type), 1, "name", 1))) __PYX_ERR(0, 25, __pyx_L1_error)
+ if (unlikely(!__Pyx_ArgTypeTest(((PyObject *)__pyx_v_sequence), (&PyString_Type), 1, "sequence", 1))) __PYX_ERR(0, 25, __pyx_L1_error)
+ if (unlikely(!__Pyx_ArgTypeTest(((PyObject *)__pyx_v_qualities), (&PyString_Type), 1, "qualities", 1))) __PYX_ERR(0, 25, __pyx_L1_error)
+ __pyx_r = __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(((struct __pyx_obj_8cutadapt_6_seqio_Sequence *)__pyx_v_self), __pyx_v_name, __pyx_v_sequence, __pyx_v_qualities, __pyx_v_second_header, __pyx_v_match, __pyx_v_match_info);
/* function exit code */
goto __pyx_L0;
@@ -1123,7 +1190,7 @@ static int __pyx_pw_8cutadapt_6_seqio_8Sequence_1__init__(PyObject *__pyx_v_self
return __pyx_r;
}
-static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self, PyObject *__pyx_v_name, PyObject *__pyx_v_sequence, PyObject *__pyx_v_qualities, PyObject *__pyx_v_name2, PyObject *__pyx_v_match, PyObject *__pyx_v_match_info) {
+static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self, PyObject *__pyx_v_name, PyObject *__pyx_v_sequence, PyObject *__pyx_v_qualities, int __pyx_v_second_header, PyObject *__pyx_v_match, PyObject *__pyx_v_match_info) {
PyObject *__pyx_v_rname = NULL;
int __pyx_r;
__Pyx_RefNannyDeclarations
@@ -1140,96 +1207,40 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutad
PyObject *__pyx_t_11 = NULL;
PyObject *__pyx_t_12 = NULL;
PyObject *__pyx_t_13 = NULL;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannySetupContext("__init__", 0);
- /* "cutadapt/_seqio.pyx":28
- * match_info=None):
- * """Set qualities to None if there are no quality values"""
- * self.name = name # <<<<<<<<<<<<<<
- * self.sequence = sequence
- * self.qualities = qualities
- */
__Pyx_INCREF(__pyx_v_name);
__Pyx_GIVEREF(__pyx_v_name);
__Pyx_GOTREF(__pyx_v_self->name);
__Pyx_DECREF(__pyx_v_self->name);
__pyx_v_self->name = __pyx_v_name;
- /* "cutadapt/_seqio.pyx":29
- * """Set qualities to None if there are no quality values"""
- * self.name = name
- * self.sequence = sequence # <<<<<<<<<<<<<<
- * self.qualities = qualities
- * self.name2 = name2
- */
__Pyx_INCREF(__pyx_v_sequence);
__Pyx_GIVEREF(__pyx_v_sequence);
__Pyx_GOTREF(__pyx_v_self->sequence);
__Pyx_DECREF(__pyx_v_self->sequence);
__pyx_v_self->sequence = __pyx_v_sequence;
- /* "cutadapt/_seqio.pyx":30
- * self.name = name
- * self.sequence = sequence
- * self.qualities = qualities # <<<<<<<<<<<<<<
- * self.name2 = name2
- * self.match = match
- */
__Pyx_INCREF(__pyx_v_qualities);
__Pyx_GIVEREF(__pyx_v_qualities);
__Pyx_GOTREF(__pyx_v_self->qualities);
__Pyx_DECREF(__pyx_v_self->qualities);
__pyx_v_self->qualities = __pyx_v_qualities;
- /* "cutadapt/_seqio.pyx":31
- * self.sequence = sequence
- * self.qualities = qualities
- * self.name2 = name2 # <<<<<<<<<<<<<<
- * self.match = match
- * self.match_info = match_info
- */
- __Pyx_INCREF(__pyx_v_name2);
- __Pyx_GIVEREF(__pyx_v_name2);
- __Pyx_GOTREF(__pyx_v_self->name2);
- __Pyx_DECREF(__pyx_v_self->name2);
- __pyx_v_self->name2 = __pyx_v_name2;
-
- /* "cutadapt/_seqio.pyx":32
- * self.qualities = qualities
- * self.name2 = name2
- * self.match = match # <<<<<<<<<<<<<<
- * self.match_info = match_info
- * if qualities is not None and len(qualities) != len(sequence):
- */
+ __pyx_v_self->second_header = __pyx_v_second_header;
+
__Pyx_INCREF(__pyx_v_match);
__Pyx_GIVEREF(__pyx_v_match);
__Pyx_GOTREF(__pyx_v_self->match);
__Pyx_DECREF(__pyx_v_self->match);
__pyx_v_self->match = __pyx_v_match;
- /* "cutadapt/_seqio.pyx":33
- * self.name2 = name2
- * self.match = match
- * self.match_info = match_info # <<<<<<<<<<<<<<
- * if qualities is not None and len(qualities) != len(sequence):
- * rname = _shorten(name)
- */
__Pyx_INCREF(__pyx_v_match_info);
__Pyx_GIVEREF(__pyx_v_match_info);
__Pyx_GOTREF(__pyx_v_self->match_info);
__Pyx_DECREF(__pyx_v_self->match_info);
__pyx_v_self->match_info = __pyx_v_match_info;
- /* "cutadapt/_seqio.pyx":34
- * self.match = match
- * self.match_info = match_info
- * if qualities is not None and len(qualities) != len(sequence): # <<<<<<<<<<<<<<
- * rname = _shorten(name)
- * raise FormatError("In read named {0!r}: length of quality sequence ({1}) and length "
- */
__pyx_t_2 = (__pyx_v_qualities != ((PyObject*)Py_None));
__pyx_t_3 = (__pyx_t_2 != 0);
if (__pyx_t_3) {
@@ -1237,21 +1248,14 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutad
__pyx_t_1 = __pyx_t_3;
goto __pyx_L4_bool_binop_done;
}
- __pyx_t_4 = PyObject_Length(__pyx_v_qualities); if (unlikely(__pyx_t_4 == -1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 34; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __pyx_t_5 = PyObject_Length(__pyx_v_sequence); if (unlikely(__pyx_t_5 == -1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 34; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = PyObject_Length(__pyx_v_qualities); if (unlikely(__pyx_t_4 == -1)) __PYX_ERR(0, 34, __pyx_L1_error)
+ __pyx_t_5 = PyObject_Length(__pyx_v_sequence); if (unlikely(__pyx_t_5 == -1)) __PYX_ERR(0, 34, __pyx_L1_error)
__pyx_t_3 = ((__pyx_t_4 != __pyx_t_5) != 0);
__pyx_t_1 = __pyx_t_3;
__pyx_L4_bool_binop_done:;
if (__pyx_t_1) {
- /* "cutadapt/_seqio.pyx":35
- * self.match_info = match_info
- * if qualities is not None and len(qualities) != len(sequence):
- * rname = _shorten(name) # <<<<<<<<<<<<<<
- * raise FormatError("In read named {0!r}: length of quality sequence ({1}) and length "
- * "of read ({2}) do not match".format(
- */
- __pyx_t_7 = __Pyx_GetModuleGlobalName(__pyx_n_s_shorten); if (unlikely(!__pyx_t_7)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 35; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_7 = __Pyx_GetModuleGlobalName(__pyx_n_s_shorten); if (unlikely(!__pyx_t_7)) __PYX_ERR(0, 35, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_7);
__pyx_t_8 = NULL;
if (CYTHON_COMPILING_IN_CPYTHON && unlikely(PyMethod_Check(__pyx_t_7))) {
@@ -1264,16 +1268,16 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutad
}
}
if (!__pyx_t_8) {
- __pyx_t_6 = __Pyx_PyObject_CallOneArg(__pyx_t_7, __pyx_v_name); if (unlikely(!__pyx_t_6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 35; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = __Pyx_PyObject_CallOneArg(__pyx_t_7, __pyx_v_name); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 35, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_6);
} else {
- __pyx_t_9 = PyTuple_New(1+1); if (unlikely(!__pyx_t_9)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 35; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_9 = PyTuple_New(1+1); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 35, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_9);
__Pyx_GIVEREF(__pyx_t_8); PyTuple_SET_ITEM(__pyx_t_9, 0, __pyx_t_8); __pyx_t_8 = NULL;
__Pyx_INCREF(__pyx_v_name);
__Pyx_GIVEREF(__pyx_v_name);
PyTuple_SET_ITEM(__pyx_t_9, 0+1, __pyx_v_name);
- __pyx_t_6 = __Pyx_PyObject_Call(__pyx_t_7, __pyx_t_9, NULL); if (unlikely(!__pyx_t_6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 35; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = __Pyx_PyObject_Call(__pyx_t_7, __pyx_t_9, NULL); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 35, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_6);
__Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
}
@@ -1281,38 +1285,17 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutad
__pyx_v_rname = __pyx_t_6;
__pyx_t_6 = 0;
- /* "cutadapt/_seqio.pyx":36
- * if qualities is not None and len(qualities) != len(sequence):
- * rname = _shorten(name)
- * raise FormatError("In read named {0!r}: length of quality sequence ({1}) and length " # <<<<<<<<<<<<<<
- * "of read ({2}) do not match".format(
- * rname, len(qualities), len(sequence)))
- */
- __pyx_t_7 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_7)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 36; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_7 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_7)) __PYX_ERR(0, 36, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_7);
- /* "cutadapt/_seqio.pyx":37
- * rname = _shorten(name)
- * raise FormatError("In read named {0!r}: length of quality sequence ({1}) and length "
- * "of read ({2}) do not match".format( # <<<<<<<<<<<<<<
- * rname, len(qualities), len(sequence)))
- *
- */
- __pyx_t_8 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_In_read_named_0_r_length_of_qual, __pyx_n_s_format); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 37; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_8 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_In_read_named_0_r_length_of_qual, __pyx_n_s_format); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 37, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_8);
- /* "cutadapt/_seqio.pyx":38
- * raise FormatError("In read named {0!r}: length of quality sequence ({1}) and length "
- * "of read ({2}) do not match".format(
- * rname, len(qualities), len(sequence))) # <<<<<<<<<<<<<<
- *
- * def __getitem__(self, key):
- */
- __pyx_t_5 = PyObject_Length(__pyx_v_qualities); if (unlikely(__pyx_t_5 == -1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 38; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __pyx_t_10 = PyInt_FromSsize_t(__pyx_t_5); if (unlikely(!__pyx_t_10)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 38; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = PyObject_Length(__pyx_v_qualities); if (unlikely(__pyx_t_5 == -1)) __PYX_ERR(0, 38, __pyx_L1_error)
+ __pyx_t_10 = PyInt_FromSsize_t(__pyx_t_5); if (unlikely(!__pyx_t_10)) __PYX_ERR(0, 38, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_10);
- __pyx_t_5 = PyObject_Length(__pyx_v_sequence); if (unlikely(__pyx_t_5 == -1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 38; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __pyx_t_11 = PyInt_FromSsize_t(__pyx_t_5); if (unlikely(!__pyx_t_11)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 38; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = PyObject_Length(__pyx_v_sequence); if (unlikely(__pyx_t_5 == -1)) __PYX_ERR(0, 38, __pyx_L1_error)
+ __pyx_t_11 = PyInt_FromSsize_t(__pyx_t_5); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 38, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_11);
__pyx_t_12 = NULL;
__pyx_t_5 = 0;
@@ -1326,7 +1309,7 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutad
__pyx_t_5 = 1;
}
}
- __pyx_t_13 = PyTuple_New(3+__pyx_t_5); if (unlikely(!__pyx_t_13)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 37; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_13 = PyTuple_New(3+__pyx_t_5); if (unlikely(!__pyx_t_13)) __PYX_ERR(0, 37, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_13);
if (__pyx_t_12) {
__Pyx_GIVEREF(__pyx_t_12); PyTuple_SET_ITEM(__pyx_t_13, 0, __pyx_t_12); __pyx_t_12 = NULL;
@@ -1340,7 +1323,7 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutad
PyTuple_SET_ITEM(__pyx_t_13, 2+__pyx_t_5, __pyx_t_11);
__pyx_t_10 = 0;
__pyx_t_11 = 0;
- __pyx_t_9 = __Pyx_PyObject_Call(__pyx_t_8, __pyx_t_13, NULL); if (unlikely(!__pyx_t_9)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 37; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_9 = __Pyx_PyObject_Call(__pyx_t_8, __pyx_t_13, NULL); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 37, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_9);
__Pyx_DECREF(__pyx_t_13); __pyx_t_13 = 0;
__Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
@@ -1355,41 +1338,27 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutad
}
}
if (!__pyx_t_8) {
- __pyx_t_6 = __Pyx_PyObject_CallOneArg(__pyx_t_7, __pyx_t_9); if (unlikely(!__pyx_t_6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 36; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = __Pyx_PyObject_CallOneArg(__pyx_t_7, __pyx_t_9); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 36, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
__Pyx_GOTREF(__pyx_t_6);
} else {
- __pyx_t_13 = PyTuple_New(1+1); if (unlikely(!__pyx_t_13)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 36; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_13 = PyTuple_New(1+1); if (unlikely(!__pyx_t_13)) __PYX_ERR(0, 36, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_13);
__Pyx_GIVEREF(__pyx_t_8); PyTuple_SET_ITEM(__pyx_t_13, 0, __pyx_t_8); __pyx_t_8 = NULL;
__Pyx_GIVEREF(__pyx_t_9);
PyTuple_SET_ITEM(__pyx_t_13, 0+1, __pyx_t_9);
__pyx_t_9 = 0;
- __pyx_t_6 = __Pyx_PyObject_Call(__pyx_t_7, __pyx_t_13, NULL); if (unlikely(!__pyx_t_6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 36; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = __Pyx_PyObject_Call(__pyx_t_7, __pyx_t_13, NULL); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 36, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_6);
__Pyx_DECREF(__pyx_t_13); __pyx_t_13 = 0;
}
__Pyx_DECREF(__pyx_t_7); __pyx_t_7 = 0;
__Pyx_Raise(__pyx_t_6, 0, 0, 0);
__Pyx_DECREF(__pyx_t_6); __pyx_t_6 = 0;
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 36; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
-
- /* "cutadapt/_seqio.pyx":34
- * self.match = match
- * self.match_info = match_info
- * if qualities is not None and len(qualities) != len(sequence): # <<<<<<<<<<<<<<
- * rname = _shorten(name)
- * raise FormatError("In read named {0!r}: length of quality sequence ({1}) and length "
- */
+ __PYX_ERR(0, 36, __pyx_L1_error)
+
}
- /* "cutadapt/_seqio.pyx":25
- * public object match_info
- *
- * def __init__(self, str name, str sequence, str qualities=None, str name2='', match=None, # <<<<<<<<<<<<<<
- * match_info=None):
- * """Set qualities to None if there are no quality values"""
- */
/* function exit code */
__pyx_r = 0;
@@ -1411,13 +1380,6 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence___init__(struct __pyx_obj_8cutad
return __pyx_r;
}
-/* "cutadapt/_seqio.pyx":40
- * rname, len(qualities), len(sequence)))
- *
- * def __getitem__(self, key): # <<<<<<<<<<<<<<
- * """slicing"""
- * return self.__class__(
- */
/* Python wrapper */
static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_3__getitem__(PyObject *__pyx_v_self, PyObject *__pyx_v_key); /*proto*/
@@ -1445,44 +1407,21 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_2__getitem__(struct __pyx_
PyObject *__pyx_t_4 = NULL;
int __pyx_t_5;
PyObject *__pyx_t_6 = NULL;
- Py_ssize_t __pyx_t_7;
- PyObject *__pyx_t_8 = NULL;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
+ PyObject *__pyx_t_7 = NULL;
+ Py_ssize_t __pyx_t_8;
+ PyObject *__pyx_t_9 = NULL;
__Pyx_RefNannySetupContext("__getitem__", 0);
- /* "cutadapt/_seqio.pyx":42
- * def __getitem__(self, key):
- * """slicing"""
- * return self.__class__( # <<<<<<<<<<<<<<
- * self.name,
- * self.sequence[key],
- */
__Pyx_XDECREF(__pyx_r);
- __pyx_t_2 = __Pyx_PyObject_GetAttrStr(((PyObject *)__pyx_v_self), __pyx_n_s_class); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 42; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_PyObject_GetAttrStr(((PyObject *)__pyx_v_self), __pyx_n_s_class); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 42, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
- /* "cutadapt/_seqio.pyx":44
- * return self.__class__(
- * self.name,
- * self.sequence[key], # <<<<<<<<<<<<<<
- * self.qualities[key] if self.qualities is not None else None,
- * self.name2,
- */
- __pyx_t_3 = PyObject_GetItem(__pyx_v_self->sequence, __pyx_v_key); if (unlikely(__pyx_t_3 == NULL)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 44; __pyx_clineno = __LINE__; goto __pyx_L1_error;};
+ __pyx_t_3 = PyObject_GetItem(__pyx_v_self->sequence, __pyx_v_key); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 44, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_3);
- /* "cutadapt/_seqio.pyx":45
- * self.name,
- * self.sequence[key],
- * self.qualities[key] if self.qualities is not None else None, # <<<<<<<<<<<<<<
- * self.name2,
- * self.match,
- */
__pyx_t_5 = (__pyx_v_self->qualities != ((PyObject*)Py_None));
if ((__pyx_t_5 != 0)) {
- __pyx_t_6 = PyObject_GetItem(__pyx_v_self->qualities, __pyx_v_key); if (unlikely(__pyx_t_6 == NULL)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 45; __pyx_clineno = __LINE__; goto __pyx_L1_error;};
+ __pyx_t_6 = PyObject_GetItem(__pyx_v_self->qualities, __pyx_v_key); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 45, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_6);
__pyx_t_4 = __pyx_t_6;
__pyx_t_6 = 0;
@@ -1491,63 +1430,52 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_2__getitem__(struct __pyx_
__pyx_t_4 = Py_None;
}
- /* "cutadapt/_seqio.pyx":48
- * self.name2,
- * self.match,
- * self.match_info) # <<<<<<<<<<<<<<
- *
- * def __repr__(self):
- */
- __pyx_t_6 = NULL;
- __pyx_t_7 = 0;
+ __pyx_t_6 = __Pyx_PyBool_FromLong(__pyx_v_self->second_header); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 46, __pyx_L1_error)
+ __Pyx_GOTREF(__pyx_t_6);
+
+ __pyx_t_7 = NULL;
+ __pyx_t_8 = 0;
if (CYTHON_COMPILING_IN_CPYTHON && likely(PyMethod_Check(__pyx_t_2))) {
- __pyx_t_6 = PyMethod_GET_SELF(__pyx_t_2);
- if (likely(__pyx_t_6)) {
+ __pyx_t_7 = PyMethod_GET_SELF(__pyx_t_2);
+ if (likely(__pyx_t_7)) {
PyObject* function = PyMethod_GET_FUNCTION(__pyx_t_2);
- __Pyx_INCREF(__pyx_t_6);
+ __Pyx_INCREF(__pyx_t_7);
__Pyx_INCREF(function);
__Pyx_DECREF_SET(__pyx_t_2, function);
- __pyx_t_7 = 1;
+ __pyx_t_8 = 1;
}
}
- __pyx_t_8 = PyTuple_New(6+__pyx_t_7); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 42; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __Pyx_GOTREF(__pyx_t_8);
- if (__pyx_t_6) {
- __Pyx_GIVEREF(__pyx_t_6); PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_6); __pyx_t_6 = NULL;
+ __pyx_t_9 = PyTuple_New(6+__pyx_t_8); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 42, __pyx_L1_error)
+ __Pyx_GOTREF(__pyx_t_9);
+ if (__pyx_t_7) {
+ __Pyx_GIVEREF(__pyx_t_7); PyTuple_SET_ITEM(__pyx_t_9, 0, __pyx_t_7); __pyx_t_7 = NULL;
}
__Pyx_INCREF(__pyx_v_self->name);
__Pyx_GIVEREF(__pyx_v_self->name);
- PyTuple_SET_ITEM(__pyx_t_8, 0+__pyx_t_7, __pyx_v_self->name);
+ PyTuple_SET_ITEM(__pyx_t_9, 0+__pyx_t_8, __pyx_v_self->name);
__Pyx_GIVEREF(__pyx_t_3);
- PyTuple_SET_ITEM(__pyx_t_8, 1+__pyx_t_7, __pyx_t_3);
+ PyTuple_SET_ITEM(__pyx_t_9, 1+__pyx_t_8, __pyx_t_3);
__Pyx_GIVEREF(__pyx_t_4);
- PyTuple_SET_ITEM(__pyx_t_8, 2+__pyx_t_7, __pyx_t_4);
- __Pyx_INCREF(__pyx_v_self->name2);
- __Pyx_GIVEREF(__pyx_v_self->name2);
- PyTuple_SET_ITEM(__pyx_t_8, 3+__pyx_t_7, __pyx_v_self->name2);
+ PyTuple_SET_ITEM(__pyx_t_9, 2+__pyx_t_8, __pyx_t_4);
+ __Pyx_GIVEREF(__pyx_t_6);
+ PyTuple_SET_ITEM(__pyx_t_9, 3+__pyx_t_8, __pyx_t_6);
__Pyx_INCREF(__pyx_v_self->match);
__Pyx_GIVEREF(__pyx_v_self->match);
- PyTuple_SET_ITEM(__pyx_t_8, 4+__pyx_t_7, __pyx_v_self->match);
+ PyTuple_SET_ITEM(__pyx_t_9, 4+__pyx_t_8, __pyx_v_self->match);
__Pyx_INCREF(__pyx_v_self->match_info);
__Pyx_GIVEREF(__pyx_v_self->match_info);
- PyTuple_SET_ITEM(__pyx_t_8, 5+__pyx_t_7, __pyx_v_self->match_info);
+ PyTuple_SET_ITEM(__pyx_t_9, 5+__pyx_t_8, __pyx_v_self->match_info);
__pyx_t_3 = 0;
__pyx_t_4 = 0;
- __pyx_t_1 = __Pyx_PyObject_Call(__pyx_t_2, __pyx_t_8, NULL); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 42; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = 0;
+ __pyx_t_1 = __Pyx_PyObject_Call(__pyx_t_2, __pyx_t_9, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 42, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
- __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
+ __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
__pyx_r = __pyx_t_1;
__pyx_t_1 = 0;
goto __pyx_L0;
- /* "cutadapt/_seqio.pyx":40
- * rname, len(qualities), len(sequence)))
- *
- * def __getitem__(self, key): # <<<<<<<<<<<<<<
- * """slicing"""
- * return self.__class__(
- */
/* function exit code */
__pyx_L1_error:;
@@ -1556,7 +1484,8 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_2__getitem__(struct __pyx_
__Pyx_XDECREF(__pyx_t_3);
__Pyx_XDECREF(__pyx_t_4);
__Pyx_XDECREF(__pyx_t_6);
- __Pyx_XDECREF(__pyx_t_8);
+ __Pyx_XDECREF(__pyx_t_7);
+ __Pyx_XDECREF(__pyx_t_9);
__Pyx_AddTraceback("cutadapt._seqio.Sequence.__getitem__", __pyx_clineno, __pyx_lineno, __pyx_filename);
__pyx_r = NULL;
__pyx_L0:;
@@ -1565,13 +1494,6 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_2__getitem__(struct __pyx_
return __pyx_r;
}
-/* "cutadapt/_seqio.pyx":50
- * self.match_info)
- *
- * def __repr__(self): # <<<<<<<<<<<<<<
- * qstr = ''
- * if self.qualities is not None:
- */
/* Python wrapper */
static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_5__repr__(PyObject *__pyx_v_self); /*proto*/
@@ -1600,42 +1522,18 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_4__repr__(struct __pyx_obj
PyObject *__pyx_t_8 = NULL;
PyObject *__pyx_t_9 = NULL;
Py_ssize_t __pyx_t_10;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannySetupContext("__repr__", 0);
- /* "cutadapt/_seqio.pyx":51
- *
- * def __repr__(self):
- * qstr = '' # <<<<<<<<<<<<<<
- * if self.qualities is not None:
- * qstr = ', qualities={0!r}'.format(_shorten(self.qualities))
- */
__Pyx_INCREF(__pyx_kp_s_);
__pyx_v_qstr = __pyx_kp_s_;
- /* "cutadapt/_seqio.pyx":52
- * def __repr__(self):
- * qstr = ''
- * if self.qualities is not None: # <<<<<<<<<<<<<<
- * qstr = ', qualities={0!r}'.format(_shorten(self.qualities))
- * return '<Sequence(name={0!r}, sequence={1!r}{2})>'.format(_shorten(self.name), _shorten(self.sequence), qstr)
- */
__pyx_t_1 = (__pyx_v_self->qualities != ((PyObject*)Py_None));
__pyx_t_2 = (__pyx_t_1 != 0);
if (__pyx_t_2) {
- /* "cutadapt/_seqio.pyx":53
- * qstr = ''
- * if self.qualities is not None:
- * qstr = ', qualities={0!r}'.format(_shorten(self.qualities)) # <<<<<<<<<<<<<<
- * return '<Sequence(name={0!r}, sequence={1!r}{2})>'.format(_shorten(self.name), _shorten(self.sequence), qstr)
- *
- */
- __pyx_t_4 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_qualities_0_r, __pyx_n_s_format); if (unlikely(!__pyx_t_4)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 53; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_qualities_0_r, __pyx_n_s_format); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 53, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_4);
- __pyx_t_6 = __Pyx_GetModuleGlobalName(__pyx_n_s_shorten); if (unlikely(!__pyx_t_6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 53; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = __Pyx_GetModuleGlobalName(__pyx_n_s_shorten); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 53, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_6);
__pyx_t_7 = NULL;
if (CYTHON_COMPILING_IN_CPYTHON && unlikely(PyMethod_Check(__pyx_t_6))) {
@@ -1648,16 +1546,16 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_4__repr__(struct __pyx_obj
}
}
if (!__pyx_t_7) {
- __pyx_t_5 = __Pyx_PyObject_CallOneArg(__pyx_t_6, __pyx_v_self->qualities); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 53; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_PyObject_CallOneArg(__pyx_t_6, __pyx_v_self->qualities); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 53, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
} else {
- __pyx_t_8 = PyTuple_New(1+1); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 53; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_8 = PyTuple_New(1+1); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 53, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_8);
__Pyx_GIVEREF(__pyx_t_7); PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_7); __pyx_t_7 = NULL;
__Pyx_INCREF(__pyx_v_self->qualities);
__Pyx_GIVEREF(__pyx_v_self->qualities);
PyTuple_SET_ITEM(__pyx_t_8, 0+1, __pyx_v_self->qualities);
- __pyx_t_5 = __Pyx_PyObject_Call(__pyx_t_6, __pyx_t_8, NULL); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 53; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_PyObject_Call(__pyx_t_6, __pyx_t_8, NULL); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 53, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
__Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
}
@@ -1673,17 +1571,17 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_4__repr__(struct __pyx_obj
}
}
if (!__pyx_t_6) {
- __pyx_t_3 = __Pyx_PyObject_CallOneArg(__pyx_t_4, __pyx_t_5); if (unlikely(!__pyx_t_3)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 53; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = __Pyx_PyObject_CallOneArg(__pyx_t_4, __pyx_t_5); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 53, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
__Pyx_GOTREF(__pyx_t_3);
} else {
- __pyx_t_8 = PyTuple_New(1+1); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 53; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_8 = PyTuple_New(1+1); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 53, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_8);
__Pyx_GIVEREF(__pyx_t_6); PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_6); __pyx_t_6 = NULL;
__Pyx_GIVEREF(__pyx_t_5);
PyTuple_SET_ITEM(__pyx_t_8, 0+1, __pyx_t_5);
__pyx_t_5 = 0;
- __pyx_t_3 = __Pyx_PyObject_Call(__pyx_t_4, __pyx_t_8, NULL); if (unlikely(!__pyx_t_3)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 53; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = __Pyx_PyObject_Call(__pyx_t_4, __pyx_t_8, NULL); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 53, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_3);
__Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
}
@@ -1691,26 +1589,12 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_4__repr__(struct __pyx_obj
__Pyx_DECREF_SET(__pyx_v_qstr, __pyx_t_3);
__pyx_t_3 = 0;
- /* "cutadapt/_seqio.pyx":52
- * def __repr__(self):
- * qstr = ''
- * if self.qualities is not None: # <<<<<<<<<<<<<<
- * qstr = ', qualities={0!r}'.format(_shorten(self.qualities))
- * return '<Sequence(name={0!r}, sequence={1!r}{2})>'.format(_shorten(self.name), _shorten(self.sequence), qstr)
- */
}
- /* "cutadapt/_seqio.pyx":54
- * if self.qualities is not None:
- * qstr = ', qualities={0!r}'.format(_shorten(self.qualities))
- * return '<Sequence(name={0!r}, sequence={1!r}{2})>'.format(_shorten(self.name), _shorten(self.sequence), qstr) # <<<<<<<<<<<<<<
- *
- * def __len__(self):
- */
__Pyx_XDECREF(__pyx_r);
- __pyx_t_4 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_Sequence_name_0_r_sequence_1_r, __pyx_n_s_format); if (unlikely(!__pyx_t_4)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 54; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_Sequence_name_0_r_sequence_1_r, __pyx_n_s_format); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 54, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_4);
- __pyx_t_5 = __Pyx_GetModuleGlobalName(__pyx_n_s_shorten); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 54; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_GetModuleGlobalName(__pyx_n_s_shorten); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 54, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
__pyx_t_6 = NULL;
if (CYTHON_COMPILING_IN_CPYTHON && unlikely(PyMethod_Check(__pyx_t_5))) {
@@ -1723,21 +1607,21 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_4__repr__(struct __pyx_obj
}
}
if (!__pyx_t_6) {
- __pyx_t_8 = __Pyx_PyObject_CallOneArg(__pyx_t_5, __pyx_v_self->name); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 54; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_8 = __Pyx_PyObject_CallOneArg(__pyx_t_5, __pyx_v_self->name); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 54, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_8);
} else {
- __pyx_t_7 = PyTuple_New(1+1); if (unlikely(!__pyx_t_7)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 54; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_7 = PyTuple_New(1+1); if (unlikely(!__pyx_t_7)) __PYX_ERR(0, 54, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_7);
__Pyx_GIVEREF(__pyx_t_6); PyTuple_SET_ITEM(__pyx_t_7, 0, __pyx_t_6); __pyx_t_6 = NULL;
__Pyx_INCREF(__pyx_v_self->name);
__Pyx_GIVEREF(__pyx_v_self->name);
PyTuple_SET_ITEM(__pyx_t_7, 0+1, __pyx_v_self->name);
- __pyx_t_8 = __Pyx_PyObject_Call(__pyx_t_5, __pyx_t_7, NULL); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 54; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_8 = __Pyx_PyObject_Call(__pyx_t_5, __pyx_t_7, NULL); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 54, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_8);
__Pyx_DECREF(__pyx_t_7); __pyx_t_7 = 0;
}
__Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
- __pyx_t_7 = __Pyx_GetModuleGlobalName(__pyx_n_s_shorten); if (unlikely(!__pyx_t_7)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 54; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_7 = __Pyx_GetModuleGlobalName(__pyx_n_s_shorten); if (unlikely(!__pyx_t_7)) __PYX_ERR(0, 54, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_7);
__pyx_t_6 = NULL;
if (CYTHON_COMPILING_IN_CPYTHON && unlikely(PyMethod_Check(__pyx_t_7))) {
@@ -1750,16 +1634,16 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_4__repr__(struct __pyx_obj
}
}
if (!__pyx_t_6) {
- __pyx_t_5 = __Pyx_PyObject_CallOneArg(__pyx_t_7, __pyx_v_self->sequence); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 54; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_PyObject_CallOneArg(__pyx_t_7, __pyx_v_self->sequence); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 54, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
} else {
- __pyx_t_9 = PyTuple_New(1+1); if (unlikely(!__pyx_t_9)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 54; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_9 = PyTuple_New(1+1); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 54, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_9);
__Pyx_GIVEREF(__pyx_t_6); PyTuple_SET_ITEM(__pyx_t_9, 0, __pyx_t_6); __pyx_t_6 = NULL;
__Pyx_INCREF(__pyx_v_self->sequence);
__Pyx_GIVEREF(__pyx_v_self->sequence);
PyTuple_SET_ITEM(__pyx_t_9, 0+1, __pyx_v_self->sequence);
- __pyx_t_5 = __Pyx_PyObject_Call(__pyx_t_7, __pyx_t_9, NULL); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 54; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_PyObject_Call(__pyx_t_7, __pyx_t_9, NULL); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 54, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
__Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
}
@@ -1776,7 +1660,7 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_4__repr__(struct __pyx_obj
__pyx_t_10 = 1;
}
}
- __pyx_t_9 = PyTuple_New(3+__pyx_t_10); if (unlikely(!__pyx_t_9)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 54; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_9 = PyTuple_New(3+__pyx_t_10); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 54, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_9);
if (__pyx_t_7) {
__Pyx_GIVEREF(__pyx_t_7); PyTuple_SET_ITEM(__pyx_t_9, 0, __pyx_t_7); __pyx_t_7 = NULL;
@@ -1790,7 +1674,7 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_4__repr__(struct __pyx_obj
PyTuple_SET_ITEM(__pyx_t_9, 2+__pyx_t_10, __pyx_v_qstr);
__pyx_t_8 = 0;
__pyx_t_5 = 0;
- __pyx_t_3 = __Pyx_PyObject_Call(__pyx_t_4, __pyx_t_9, NULL); if (unlikely(!__pyx_t_3)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 54; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = __Pyx_PyObject_Call(__pyx_t_4, __pyx_t_9, NULL); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 54, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_3);
__Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
__Pyx_DECREF(__pyx_t_4); __pyx_t_4 = 0;
@@ -1798,13 +1682,6 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_4__repr__(struct __pyx_obj
__pyx_t_3 = 0;
goto __pyx_L0;
- /* "cutadapt/_seqio.pyx":50
- * self.match_info)
- *
- * def __repr__(self): # <<<<<<<<<<<<<<
- * qstr = ''
- * if self.qualities is not None:
- */
/* function exit code */
__pyx_L1_error:;
@@ -1824,13 +1701,6 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_4__repr__(struct __pyx_obj
return __pyx_r;
}
-/* "cutadapt/_seqio.pyx":56
- * return '<Sequence(name={0!r}, sequence={1!r}{2})>'.format(_shorten(self.name), _shorten(self.sequence), qstr)
- *
- * def __len__(self): # <<<<<<<<<<<<<<
- * return len(self.sequence)
- *
- */
/* Python wrapper */
static Py_ssize_t __pyx_pw_8cutadapt_6_seqio_8Sequence_7__len__(PyObject *__pyx_v_self); /*proto*/
@@ -1850,32 +1720,15 @@ static Py_ssize_t __pyx_pf_8cutadapt_6_seqio_8Sequence_6__len__(struct __pyx_obj
__Pyx_RefNannyDeclarations
PyObject *__pyx_t_1 = NULL;
Py_ssize_t __pyx_t_2;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannySetupContext("__len__", 0);
- /* "cutadapt/_seqio.pyx":57
- *
- * def __len__(self):
- * return len(self.sequence) # <<<<<<<<<<<<<<
- *
- * def __richcmp__(self, other, int op):
- */
__pyx_t_1 = __pyx_v_self->sequence;
__Pyx_INCREF(__pyx_t_1);
- __pyx_t_2 = PyObject_Length(__pyx_t_1); if (unlikely(__pyx_t_2 == -1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 57; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = PyObject_Length(__pyx_t_1); if (unlikely(__pyx_t_2 == -1)) __PYX_ERR(0, 57, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
__pyx_r = __pyx_t_2;
goto __pyx_L0;
- /* "cutadapt/_seqio.pyx":56
- * return '<Sequence(name={0!r}, sequence={1!r}{2})>'.format(_shorten(self.name), _shorten(self.sequence), qstr)
- *
- * def __len__(self): # <<<<<<<<<<<<<<
- * return len(self.sequence)
- *
- */
/* function exit code */
__pyx_L1_error:;
@@ -1887,13 +1740,6 @@ static Py_ssize_t __pyx_pf_8cutadapt_6_seqio_8Sequence_6__len__(struct __pyx_obj
return __pyx_r;
}
-/* "cutadapt/_seqio.pyx":59
- * return len(self.sequence)
- *
- * def __richcmp__(self, other, int op): # <<<<<<<<<<<<<<
- * if 2 <= op <= 3:
- * eq = self.name == other.name and \
- */
/* Python wrapper */
static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_9__richcmp__(PyObject *__pyx_v_self, PyObject *__pyx_v_other, int __pyx_v_op); /*proto*/
@@ -1918,18 +1764,8 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_8__richcmp__(PyObject *__p
PyObject *__pyx_t_4 = NULL;
PyObject *__pyx_t_5 = NULL;
PyObject *__pyx_t_6 = NULL;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannySetupContext("__richcmp__", 0);
- /* "cutadapt/_seqio.pyx":60
- *
- * def __richcmp__(self, other, int op):
- * if 2 <= op <= 3: # <<<<<<<<<<<<<<
- * eq = self.name == other.name and \
- * self.sequence == other.sequence and \
- */
__pyx_t_1 = (2 <= __pyx_v_op);
if (__pyx_t_1) {
__pyx_t_1 = (__pyx_v_op <= 3);
@@ -1937,21 +1773,14 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_8__richcmp__(PyObject *__p
__pyx_t_2 = (__pyx_t_1 != 0);
if (__pyx_t_2) {
- /* "cutadapt/_seqio.pyx":61
- * def __richcmp__(self, other, int op):
- * if 2 <= op <= 3:
- * eq = self.name == other.name and \ # <<<<<<<<<<<<<<
- * self.sequence == other.sequence and \
- * self.qualities == other.qualities
- */
- __pyx_t_4 = __Pyx_PyObject_GetAttrStr(__pyx_v_self, __pyx_n_s_name); if (unlikely(!__pyx_t_4)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 61; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = __Pyx_PyObject_GetAttrStr(__pyx_v_self, __pyx_n_s_name); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 61, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_4);
- __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_v_other, __pyx_n_s_name); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 61; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_v_other, __pyx_n_s_name); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 61, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
- __pyx_t_6 = PyObject_RichCompare(__pyx_t_4, __pyx_t_5, Py_EQ); __Pyx_XGOTREF(__pyx_t_6); if (unlikely(!__pyx_t_6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 61; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = PyObject_RichCompare(__pyx_t_4, __pyx_t_5, Py_EQ); __Pyx_XGOTREF(__pyx_t_6); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 61, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_4); __pyx_t_4 = 0;
__Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
- __pyx_t_2 = __Pyx_PyObject_IsTrue(__pyx_t_6); if (unlikely(__pyx_t_2 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 61; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_PyObject_IsTrue(__pyx_t_6); if (unlikely(__pyx_t_2 < 0)) __PYX_ERR(0, 61, __pyx_L1_error)
if (__pyx_t_2) {
__Pyx_DECREF(__pyx_t_6); __pyx_t_6 = 0;
} else {
@@ -1961,21 +1790,14 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_8__richcmp__(PyObject *__p
goto __pyx_L4_bool_binop_done;
}
- /* "cutadapt/_seqio.pyx":62
- * if 2 <= op <= 3:
- * eq = self.name == other.name and \
- * self.sequence == other.sequence and \ # <<<<<<<<<<<<<<
- * self.qualities == other.qualities
- * if op == 2:
- */
- __pyx_t_6 = __Pyx_PyObject_GetAttrStr(__pyx_v_self, __pyx_n_s_sequence); if (unlikely(!__pyx_t_6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 62; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = __Pyx_PyObject_GetAttrStr(__pyx_v_self, __pyx_n_s_sequence); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 62, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_6);
- __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_v_other, __pyx_n_s_sequence); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 62; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_v_other, __pyx_n_s_sequence); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 62, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
- __pyx_t_4 = PyObject_RichCompare(__pyx_t_6, __pyx_t_5, Py_EQ); __Pyx_XGOTREF(__pyx_t_4); if (unlikely(!__pyx_t_4)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 62; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = PyObject_RichCompare(__pyx_t_6, __pyx_t_5, Py_EQ); __Pyx_XGOTREF(__pyx_t_4); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 62, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_6); __pyx_t_6 = 0;
__Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
- __pyx_t_2 = __Pyx_PyObject_IsTrue(__pyx_t_4); if (unlikely(__pyx_t_2 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 62; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_PyObject_IsTrue(__pyx_t_4); if (unlikely(__pyx_t_2 < 0)) __PYX_ERR(0, 62, __pyx_L1_error)
if (__pyx_t_2) {
__Pyx_DECREF(__pyx_t_4); __pyx_t_4 = 0;
} else {
@@ -1985,18 +1807,11 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_8__richcmp__(PyObject *__p
goto __pyx_L4_bool_binop_done;
}
- /* "cutadapt/_seqio.pyx":63
- * eq = self.name == other.name and \
- * self.sequence == other.sequence and \
- * self.qualities == other.qualities # <<<<<<<<<<<<<<
- * if op == 2:
- * return eq
- */
- __pyx_t_4 = __Pyx_PyObject_GetAttrStr(__pyx_v_self, __pyx_n_s_qualities); if (unlikely(!__pyx_t_4)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 63; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = __Pyx_PyObject_GetAttrStr(__pyx_v_self, __pyx_n_s_qualities); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 63, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_4);
- __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_v_other, __pyx_n_s_qualities); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 63; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_v_other, __pyx_n_s_qualities); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 63, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
- __pyx_t_6 = PyObject_RichCompare(__pyx_t_4, __pyx_t_5, Py_EQ); __Pyx_XGOTREF(__pyx_t_6); if (unlikely(!__pyx_t_6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 63; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = PyObject_RichCompare(__pyx_t_4, __pyx_t_5, Py_EQ); __Pyx_XGOTREF(__pyx_t_6); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 63, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_4); __pyx_t_4 = 0;
__Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
__Pyx_INCREF(__pyx_t_6);
@@ -2006,85 +1821,36 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_8__richcmp__(PyObject *__p
__pyx_v_eq = __pyx_t_3;
__pyx_t_3 = 0;
- /* "cutadapt/_seqio.pyx":64
- * self.sequence == other.sequence and \
- * self.qualities == other.qualities
- * if op == 2: # <<<<<<<<<<<<<<
- * return eq
- * else:
- */
__pyx_t_2 = ((__pyx_v_op == 2) != 0);
if (__pyx_t_2) {
- /* "cutadapt/_seqio.pyx":65
- * self.qualities == other.qualities
- * if op == 2:
- * return eq # <<<<<<<<<<<<<<
- * else:
- * return not eq
- */
__Pyx_XDECREF(__pyx_r);
__Pyx_INCREF(__pyx_v_eq);
__pyx_r = __pyx_v_eq;
goto __pyx_L0;
- /* "cutadapt/_seqio.pyx":64
- * self.sequence == other.sequence and \
- * self.qualities == other.qualities
- * if op == 2: # <<<<<<<<<<<<<<
- * return eq
- * else:
- */
- }
-
- /* "cutadapt/_seqio.pyx":67
- * return eq
- * else:
- * return not eq # <<<<<<<<<<<<<<
- * else:
- * raise NotImplementedError()
- */
+ }
+
/*else*/ {
__Pyx_XDECREF(__pyx_r);
- __pyx_t_2 = __Pyx_PyObject_IsTrue(__pyx_v_eq); if (unlikely(__pyx_t_2 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 67; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __pyx_t_3 = __Pyx_PyBool_FromLong((!__pyx_t_2)); if (unlikely(!__pyx_t_3)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 67; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_PyObject_IsTrue(__pyx_v_eq); if (unlikely(__pyx_t_2 < 0)) __PYX_ERR(0, 67, __pyx_L1_error)
+ __pyx_t_3 = __Pyx_PyBool_FromLong((!__pyx_t_2)); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 67, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_3);
__pyx_r = __pyx_t_3;
__pyx_t_3 = 0;
goto __pyx_L0;
}
- /* "cutadapt/_seqio.pyx":60
- *
- * def __richcmp__(self, other, int op):
- * if 2 <= op <= 3: # <<<<<<<<<<<<<<
- * eq = self.name == other.name and \
- * self.sequence == other.sequence and \
- */
}
- /* "cutadapt/_seqio.pyx":69
- * return not eq
- * else:
- * raise NotImplementedError() # <<<<<<<<<<<<<<
- *
- * def __reduce__(self):
- */
/*else*/ {
- __pyx_t_3 = __Pyx_PyObject_CallNoArg(__pyx_builtin_NotImplementedError); if (unlikely(!__pyx_t_3)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 69; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = __Pyx_PyObject_CallNoArg(__pyx_builtin_NotImplementedError); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 69, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_3);
__Pyx_Raise(__pyx_t_3, 0, 0, 0);
__Pyx_DECREF(__pyx_t_3); __pyx_t_3 = 0;
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 69; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __PYX_ERR(0, 69, __pyx_L1_error)
}
- /* "cutadapt/_seqio.pyx":59
- * return len(self.sequence)
- *
- * def __richcmp__(self, other, int op): # <<<<<<<<<<<<<<
- * if 2 <= op <= 3:
- * eq = self.name == other.name and \
- */
/* function exit code */
__pyx_L1_error:;
@@ -2101,13 +1867,6 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_8__richcmp__(PyObject *__p
return __pyx_r;
}
-/* "cutadapt/_seqio.pyx":71
- * raise NotImplementedError()
- *
- * def __reduce__(self): # <<<<<<<<<<<<<<
- * return (Sequence, (self.name, self.sequence, self.qualities, self.name2))
- *
- */
/* Python wrapper */
static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_11__reduce__(PyObject *__pyx_v_self, CYTHON_UNUSED PyObject *unused); /*proto*/
@@ -2127,52 +1886,37 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_10__reduce__(struct __pyx_
__Pyx_RefNannyDeclarations
PyObject *__pyx_t_1 = NULL;
PyObject *__pyx_t_2 = NULL;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannySetupContext("__reduce__", 0);
- /* "cutadapt/_seqio.pyx":72
- *
- * def __reduce__(self):
- * return (Sequence, (self.name, self.sequence, self.qualities, self.name2)) # <<<<<<<<<<<<<<
- *
- *
- */
__Pyx_XDECREF(__pyx_r);
- __pyx_t_1 = PyTuple_New(4); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 72; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyBool_FromLong(__pyx_v_self->second_header); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 72, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
+ __pyx_t_2 = PyTuple_New(4); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 72, __pyx_L1_error)
+ __Pyx_GOTREF(__pyx_t_2);
__Pyx_INCREF(__pyx_v_self->name);
__Pyx_GIVEREF(__pyx_v_self->name);
- PyTuple_SET_ITEM(__pyx_t_1, 0, __pyx_v_self->name);
+ PyTuple_SET_ITEM(__pyx_t_2, 0, __pyx_v_self->name);
__Pyx_INCREF(__pyx_v_self->sequence);
__Pyx_GIVEREF(__pyx_v_self->sequence);
- PyTuple_SET_ITEM(__pyx_t_1, 1, __pyx_v_self->sequence);
+ PyTuple_SET_ITEM(__pyx_t_2, 1, __pyx_v_self->sequence);
__Pyx_INCREF(__pyx_v_self->qualities);
__Pyx_GIVEREF(__pyx_v_self->qualities);
- PyTuple_SET_ITEM(__pyx_t_1, 2, __pyx_v_self->qualities);
- __Pyx_INCREF(__pyx_v_self->name2);
- __Pyx_GIVEREF(__pyx_v_self->name2);
- PyTuple_SET_ITEM(__pyx_t_1, 3, __pyx_v_self->name2);
- __pyx_t_2 = PyTuple_New(2); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 72; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __Pyx_GOTREF(__pyx_t_2);
- __Pyx_INCREF(((PyObject *)__pyx_ptype_8cutadapt_6_seqio_Sequence));
- __Pyx_GIVEREF(((PyObject *)__pyx_ptype_8cutadapt_6_seqio_Sequence));
- PyTuple_SET_ITEM(__pyx_t_2, 0, ((PyObject *)__pyx_ptype_8cutadapt_6_seqio_Sequence));
+ PyTuple_SET_ITEM(__pyx_t_2, 2, __pyx_v_self->qualities);
__Pyx_GIVEREF(__pyx_t_1);
- PyTuple_SET_ITEM(__pyx_t_2, 1, __pyx_t_1);
+ PyTuple_SET_ITEM(__pyx_t_2, 3, __pyx_t_1);
__pyx_t_1 = 0;
- __pyx_r = __pyx_t_2;
+ __pyx_t_1 = PyTuple_New(2); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 72, __pyx_L1_error)
+ __Pyx_GOTREF(__pyx_t_1);
+ __Pyx_INCREF(((PyObject *)__pyx_ptype_8cutadapt_6_seqio_Sequence));
+ __Pyx_GIVEREF(((PyObject *)__pyx_ptype_8cutadapt_6_seqio_Sequence));
+ PyTuple_SET_ITEM(__pyx_t_1, 0, ((PyObject *)__pyx_ptype_8cutadapt_6_seqio_Sequence));
+ __Pyx_GIVEREF(__pyx_t_2);
+ PyTuple_SET_ITEM(__pyx_t_1, 1, __pyx_t_2);
__pyx_t_2 = 0;
+ __pyx_r = __pyx_t_1;
+ __pyx_t_1 = 0;
goto __pyx_L0;
- /* "cutadapt/_seqio.pyx":71
- * raise NotImplementedError()
- *
- * def __reduce__(self): # <<<<<<<<<<<<<<
- * return (Sequence, (self.name, self.sequence, self.qualities, self.name2))
- *
- */
/* function exit code */
__pyx_L1_error:;
@@ -2186,13 +1930,6 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_10__reduce__(struct __pyx_
return __pyx_r;
}
-/* "cutadapt/_seqio.pyx":18
- * """
- * cdef:
- * public str name # <<<<<<<<<<<<<<
- * public str sequence
- * public str qualities
- */
/* Python wrapper */
static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_4name_1__get__(PyObject *__pyx_v_self); /*proto*/
@@ -2240,11 +1977,8 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence_4name_2__set__(struct __pyx_obj_
int __pyx_r;
__Pyx_RefNannyDeclarations
PyObject *__pyx_t_1 = NULL;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannySetupContext("__set__", 0);
- if (!(likely(PyString_CheckExact(__pyx_v_value))||((__pyx_v_value) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_v_value)->tp_name), 0))) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 18; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (!(likely(PyString_CheckExact(__pyx_v_value))||((__pyx_v_value) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_v_value)->tp_name), 0))) __PYX_ERR(0, 18, __pyx_L1_error)
__pyx_t_1 = __pyx_v_value;
__Pyx_INCREF(__pyx_t_1);
__Pyx_GIVEREF(__pyx_t_1);
@@ -2294,13 +2028,6 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence_4name_4__del__(struct __pyx_obj_
return __pyx_r;
}
-/* "cutadapt/_seqio.pyx":19
- * cdef:
- * public str name
- * public str sequence # <<<<<<<<<<<<<<
- * public str qualities
- * public str name2
- */
/* Python wrapper */
static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_8sequence_1__get__(PyObject *__pyx_v_self); /*proto*/
@@ -2348,11 +2075,8 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence_8sequence_2__set__(struct __pyx_
int __pyx_r;
__Pyx_RefNannyDeclarations
PyObject *__pyx_t_1 = NULL;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannySetupContext("__set__", 0);
- if (!(likely(PyString_CheckExact(__pyx_v_value))||((__pyx_v_value) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_v_value)->tp_name), 0))) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 19; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (!(likely(PyString_CheckExact(__pyx_v_value))||((__pyx_v_value) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_v_value)->tp_name), 0))) __PYX_ERR(0, 19, __pyx_L1_error)
__pyx_t_1 = __pyx_v_value;
__Pyx_INCREF(__pyx_t_1);
__Pyx_GIVEREF(__pyx_t_1);
@@ -2402,13 +2126,6 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence_8sequence_4__del__(struct __pyx_
return __pyx_r;
}
-/* "cutadapt/_seqio.pyx":20
- * public str name
- * public str sequence
- * public str qualities # <<<<<<<<<<<<<<
- * public str name2
- * public object match
- */
/* Python wrapper */
static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_9qualities_1__get__(PyObject *__pyx_v_self); /*proto*/
@@ -2456,11 +2173,8 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence_9qualities_2__set__(struct __pyx
int __pyx_r;
__Pyx_RefNannyDeclarations
PyObject *__pyx_t_1 = NULL;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannySetupContext("__set__", 0);
- if (!(likely(PyString_CheckExact(__pyx_v_value))||((__pyx_v_value) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_v_value)->tp_name), 0))) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 20; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (!(likely(PyString_CheckExact(__pyx_v_value))||((__pyx_v_value) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_v_value)->tp_name), 0))) __PYX_ERR(0, 20, __pyx_L1_error)
__pyx_t_1 = __pyx_v_value;
__Pyx_INCREF(__pyx_t_1);
__Pyx_GIVEREF(__pyx_t_1);
@@ -2510,37 +2224,37 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence_9qualities_4__del__(struct __pyx
return __pyx_r;
}
-/* "cutadapt/_seqio.pyx":21
- * public str sequence
- * public str qualities
- * public str name2 # <<<<<<<<<<<<<<
- * public object match
- * public object match_info
- */
/* Python wrapper */
-static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_5name2_1__get__(PyObject *__pyx_v_self); /*proto*/
-static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_5name2_1__get__(PyObject *__pyx_v_self) {
+static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_13second_header_1__get__(PyObject *__pyx_v_self); /*proto*/
+static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_13second_header_1__get__(PyObject *__pyx_v_self) {
PyObject *__pyx_r = 0;
__Pyx_RefNannyDeclarations
__Pyx_RefNannySetupContext("__get__ (wrapper)", 0);
- __pyx_r = __pyx_pf_8cutadapt_6_seqio_8Sequence_5name2___get__(((struct __pyx_obj_8cutadapt_6_seqio_Sequence *)__pyx_v_self));
+ __pyx_r = __pyx_pf_8cutadapt_6_seqio_8Sequence_13second_header___get__(((struct __pyx_obj_8cutadapt_6_seqio_Sequence *)__pyx_v_self));
/* function exit code */
__Pyx_RefNannyFinishContext();
return __pyx_r;
}
-static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_5name2___get__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self) {
+static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_13second_header___get__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self) {
PyObject *__pyx_r = NULL;
__Pyx_RefNannyDeclarations
+ PyObject *__pyx_t_1 = NULL;
__Pyx_RefNannySetupContext("__get__", 0);
__Pyx_XDECREF(__pyx_r);
- __Pyx_INCREF(__pyx_v_self->name2);
- __pyx_r = __pyx_v_self->name2;
+ __pyx_t_1 = __Pyx_PyBool_FromLong(__pyx_v_self->second_header); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 21, __pyx_L1_error)
+ __Pyx_GOTREF(__pyx_t_1);
+ __pyx_r = __pyx_t_1;
+ __pyx_t_1 = 0;
goto __pyx_L0;
/* function exit code */
+ __pyx_L1_error:;
+ __Pyx_XDECREF(__pyx_t_1);
+ __Pyx_AddTraceback("cutadapt._seqio.Sequence.second_header.__get__", __pyx_clineno, __pyx_lineno, __pyx_filename);
+ __pyx_r = NULL;
__pyx_L0:;
__Pyx_XGIVEREF(__pyx_r);
__Pyx_RefNannyFinishContext();
@@ -2548,83 +2262,37 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_8Sequence_5name2___get__(struct __py
}
/* Python wrapper */
-static int __pyx_pw_8cutadapt_6_seqio_8Sequence_5name2_3__set__(PyObject *__pyx_v_self, PyObject *__pyx_v_value); /*proto*/
-static int __pyx_pw_8cutadapt_6_seqio_8Sequence_5name2_3__set__(PyObject *__pyx_v_self, PyObject *__pyx_v_value) {
+static int __pyx_pw_8cutadapt_6_seqio_8Sequence_13second_header_3__set__(PyObject *__pyx_v_self, PyObject *__pyx_v_value); /*proto*/
+static int __pyx_pw_8cutadapt_6_seqio_8Sequence_13second_header_3__set__(PyObject *__pyx_v_self, PyObject *__pyx_v_value) {
int __pyx_r;
__Pyx_RefNannyDeclarations
__Pyx_RefNannySetupContext("__set__ (wrapper)", 0);
- __pyx_r = __pyx_pf_8cutadapt_6_seqio_8Sequence_5name2_2__set__(((struct __pyx_obj_8cutadapt_6_seqio_Sequence *)__pyx_v_self), ((PyObject *)__pyx_v_value));
+ __pyx_r = __pyx_pf_8cutadapt_6_seqio_8Sequence_13second_header_2__set__(((struct __pyx_obj_8cutadapt_6_seqio_Sequence *)__pyx_v_self), ((PyObject *)__pyx_v_value));
/* function exit code */
__Pyx_RefNannyFinishContext();
return __pyx_r;
}
-static int __pyx_pf_8cutadapt_6_seqio_8Sequence_5name2_2__set__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self, PyObject *__pyx_v_value) {
+static int __pyx_pf_8cutadapt_6_seqio_8Sequence_13second_header_2__set__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self, PyObject *__pyx_v_value) {
int __pyx_r;
__Pyx_RefNannyDeclarations
- PyObject *__pyx_t_1 = NULL;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
+ int __pyx_t_1;
__Pyx_RefNannySetupContext("__set__", 0);
- if (!(likely(PyString_CheckExact(__pyx_v_value))||((__pyx_v_value) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_v_value)->tp_name), 0))) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 21; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __pyx_t_1 = __pyx_v_value;
- __Pyx_INCREF(__pyx_t_1);
- __Pyx_GIVEREF(__pyx_t_1);
- __Pyx_GOTREF(__pyx_v_self->name2);
- __Pyx_DECREF(__pyx_v_self->name2);
- __pyx_v_self->name2 = ((PyObject*)__pyx_t_1);
- __pyx_t_1 = 0;
+ __pyx_t_1 = __Pyx_PyObject_IsTrue(__pyx_v_value); if (unlikely((__pyx_t_1 == (int)-1) && PyErr_Occurred())) __PYX_ERR(0, 21, __pyx_L1_error)
+ __pyx_v_self->second_header = __pyx_t_1;
/* function exit code */
__pyx_r = 0;
goto __pyx_L0;
__pyx_L1_error:;
- __Pyx_XDECREF(__pyx_t_1);
- __Pyx_AddTraceback("cutadapt._seqio.Sequence.name2.__set__", __pyx_clineno, __pyx_lineno, __pyx_filename);
+ __Pyx_AddTraceback("cutadapt._seqio.Sequence.second_header.__set__", __pyx_clineno, __pyx_lineno, __pyx_filename);
__pyx_r = -1;
__pyx_L0:;
__Pyx_RefNannyFinishContext();
return __pyx_r;
}
-/* Python wrapper */
-static int __pyx_pw_8cutadapt_6_seqio_8Sequence_5name2_5__del__(PyObject *__pyx_v_self); /*proto*/
-static int __pyx_pw_8cutadapt_6_seqio_8Sequence_5name2_5__del__(PyObject *__pyx_v_self) {
- int __pyx_r;
- __Pyx_RefNannyDeclarations
- __Pyx_RefNannySetupContext("__del__ (wrapper)", 0);
- __pyx_r = __pyx_pf_8cutadapt_6_seqio_8Sequence_5name2_4__del__(((struct __pyx_obj_8cutadapt_6_seqio_Sequence *)__pyx_v_self));
-
- /* function exit code */
- __Pyx_RefNannyFinishContext();
- return __pyx_r;
-}
-
-static int __pyx_pf_8cutadapt_6_seqio_8Sequence_5name2_4__del__(struct __pyx_obj_8cutadapt_6_seqio_Sequence *__pyx_v_self) {
- int __pyx_r;
- __Pyx_RefNannyDeclarations
- __Pyx_RefNannySetupContext("__del__", 0);
- __Pyx_INCREF(Py_None);
- __Pyx_GIVEREF(Py_None);
- __Pyx_GOTREF(__pyx_v_self->name2);
- __Pyx_DECREF(__pyx_v_self->name2);
- __pyx_v_self->name2 = ((PyObject*)Py_None);
-
- /* function exit code */
- __pyx_r = 0;
- __Pyx_RefNannyFinishContext();
- return __pyx_r;
-}
-
-/* "cutadapt/_seqio.pyx":22
- * public str qualities
- * public str name2
- * public object match # <<<<<<<<<<<<<<
- * public object match_info
- *
- */
/* Python wrapper */
static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_5match_1__get__(PyObject *__pyx_v_self); /*proto*/
@@ -2713,13 +2381,6 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence_5match_4__del__(struct __pyx_obj
return __pyx_r;
}
-/* "cutadapt/_seqio.pyx":23
- * public str name2
- * public object match
- * public object match_info # <<<<<<<<<<<<<<
- *
- * def __init__(self, str name, str sequence, str qualities=None, str name2='', match=None,
- */
/* Python wrapper */
static PyObject *__pyx_pw_8cutadapt_6_seqio_8Sequence_10match_info_1__get__(PyObject *__pyx_v_self); /*proto*/
@@ -2808,30 +2469,20 @@ static int __pyx_pf_8cutadapt_6_seqio_8Sequence_10match_info_4__del__(struct __p
return __pyx_r;
}
-/* "cutadapt/_seqio.pyx":79
- * Reader for FASTQ files. Does not support multi-line FASTQ files.
- * """
- * def __init__(self, file, sequence_class=Sequence): # <<<<<<<<<<<<<<
- * """
- * file is a filename or a file-like object.
- */
static PyObject *__pyx_pf_8cutadapt_6_seqio_11FastqReader_5__defaults__(CYTHON_UNUSED PyObject *__pyx_self) {
PyObject *__pyx_r = NULL;
__Pyx_RefNannyDeclarations
PyObject *__pyx_t_1 = NULL;
PyObject *__pyx_t_2 = NULL;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannySetupContext("__defaults__", 0);
__Pyx_XDECREF(__pyx_r);
- __pyx_t_1 = PyTuple_New(1); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 79; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PyTuple_New(1); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 79, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_INCREF(__Pyx_CyFunction_Defaults(__pyx_defaults, __pyx_self)->__pyx_arg_sequence_class);
__Pyx_GIVEREF(__Pyx_CyFunction_Defaults(__pyx_defaults, __pyx_self)->__pyx_arg_sequence_class);
PyTuple_SET_ITEM(__pyx_t_1, 0, __Pyx_CyFunction_Defaults(__pyx_defaults, __pyx_self)->__pyx_arg_sequence_class);
- __pyx_t_2 = PyTuple_New(2); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 79; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = PyTuple_New(2); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 79, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
__Pyx_GIVEREF(__pyx_t_1);
PyTuple_SET_ITEM(__pyx_t_2, 0, __pyx_t_1);
@@ -2863,9 +2514,6 @@ static PyObject *__pyx_pw_8cutadapt_6_seqio_11FastqReader_1__init__(PyObject *__
PyObject *__pyx_v_self = 0;
PyObject *__pyx_v_file = 0;
PyObject *__pyx_v_sequence_class = 0;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
PyObject *__pyx_r = 0;
__Pyx_RefNannyDeclarations
__Pyx_RefNannySetupContext("__init__ (wrapper)", 0);
@@ -2892,7 +2540,7 @@ static PyObject *__pyx_pw_8cutadapt_6_seqio_11FastqReader_1__init__(PyObject *__
case 1:
if (likely((values[1] = PyDict_GetItem(__pyx_kwds, __pyx_n_s_file)) != 0)) kw_args--;
else {
- __Pyx_RaiseArgtupleInvalid("__init__", 0, 2, 3, 1); {__pyx_filename = __pyx_f[0]; __pyx_lineno = 79; __pyx_clineno = __LINE__; goto __pyx_L3_error;}
+ __Pyx_RaiseArgtupleInvalid("__init__", 0, 2, 3, 1); __PYX_ERR(0, 79, __pyx_L3_error)
}
case 2:
if (kw_args > 0) {
@@ -2901,7 +2549,7 @@ static PyObject *__pyx_pw_8cutadapt_6_seqio_11FastqReader_1__init__(PyObject *__
}
}
if (unlikely(kw_args > 0)) {
- if (unlikely(__Pyx_ParseOptionalKeywords(__pyx_kwds, __pyx_pyargnames, 0, values, pos_args, "__init__") < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 79; __pyx_clineno = __LINE__; goto __pyx_L3_error;}
+ if (unlikely(__Pyx_ParseOptionalKeywords(__pyx_kwds, __pyx_pyargnames, 0, values, pos_args, "__init__") < 0)) __PYX_ERR(0, 79, __pyx_L3_error)
}
} else {
switch (PyTuple_GET_SIZE(__pyx_args)) {
@@ -2918,7 +2566,7 @@ static PyObject *__pyx_pw_8cutadapt_6_seqio_11FastqReader_1__init__(PyObject *__
}
goto __pyx_L4_argument_unpacking_done;
__pyx_L5_argtuple_error:;
- __Pyx_RaiseArgtupleInvalid("__init__", 0, 2, 3, PyTuple_GET_SIZE(__pyx_args)); {__pyx_filename = __pyx_f[0]; __pyx_lineno = 79; __pyx_clineno = __LINE__; goto __pyx_L3_error;}
+ __Pyx_RaiseArgtupleInvalid("__init__", 0, 2, 3, PyTuple_GET_SIZE(__pyx_args)); __PYX_ERR(0, 79, __pyx_L3_error)
__pyx_L3_error:;
__Pyx_AddTraceback("cutadapt._seqio.FastqReader.__init__", __pyx_clineno, __pyx_lineno, __pyx_filename);
__Pyx_RefNannyFinishContext();
@@ -2938,21 +2586,11 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_11FastqReader___init__(CYTHON_UNUSED
PyObject *__pyx_t_2 = NULL;
PyObject *__pyx_t_3 = NULL;
PyObject *__pyx_t_4 = NULL;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannySetupContext("__init__", 0);
- /* "cutadapt/_seqio.pyx":84
- * If file is a filename, then .gz files are supported.
- * """
- * super(FastqReader, self).__init__(file) # <<<<<<<<<<<<<<
- * self.sequence_class = sequence_class
- * self.delivers_qualities = True
- */
- __pyx_t_2 = __Pyx_GetModuleGlobalName(__pyx_n_s_FastqReader); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 84; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_GetModuleGlobalName(__pyx_n_s_FastqReader); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 84, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
- __pyx_t_3 = PyTuple_New(2); if (unlikely(!__pyx_t_3)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 84; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = PyTuple_New(2); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 84, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_3);
__Pyx_GIVEREF(__pyx_t_2);
PyTuple_SET_ITEM(__pyx_t_3, 0, __pyx_t_2);
@@ -2960,10 +2598,10 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_11FastqReader___init__(CYTHON_UNUSED
__Pyx_GIVEREF(__pyx_v_self);
PyTuple_SET_ITEM(__pyx_t_3, 1, __pyx_v_self);
__pyx_t_2 = 0;
- __pyx_t_2 = __Pyx_PyObject_Call(__pyx_builtin_super, __pyx_t_3, NULL); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 84; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_PyObject_Call(__pyx_builtin_super, __pyx_t_3, NULL); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 84, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
__Pyx_DECREF(__pyx_t_3); __pyx_t_3 = 0;
- __pyx_t_3 = __Pyx_PyObject_GetAttrStr(__pyx_t_2, __pyx_n_s_init); if (unlikely(!__pyx_t_3)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 84; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = __Pyx_PyObject_GetAttrStr(__pyx_t_2, __pyx_n_s_init); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 84, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_3);
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
__pyx_t_2 = NULL;
@@ -2977,47 +2615,26 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_11FastqReader___init__(CYTHON_UNUSED
}
}
if (!__pyx_t_2) {
- __pyx_t_1 = __Pyx_PyObject_CallOneArg(__pyx_t_3, __pyx_v_file); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 84; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyObject_CallOneArg(__pyx_t_3, __pyx_v_file); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 84, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
} else {
- __pyx_t_4 = PyTuple_New(1+1); if (unlikely(!__pyx_t_4)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 84; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = PyTuple_New(1+1); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 84, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_4);
__Pyx_GIVEREF(__pyx_t_2); PyTuple_SET_ITEM(__pyx_t_4, 0, __pyx_t_2); __pyx_t_2 = NULL;
__Pyx_INCREF(__pyx_v_file);
__Pyx_GIVEREF(__pyx_v_file);
PyTuple_SET_ITEM(__pyx_t_4, 0+1, __pyx_v_file);
- __pyx_t_1 = __Pyx_PyObject_Call(__pyx_t_3, __pyx_t_4, NULL); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 84; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyObject_Call(__pyx_t_3, __pyx_t_4, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 84, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_DECREF(__pyx_t_4); __pyx_t_4 = 0;
}
__Pyx_DECREF(__pyx_t_3); __pyx_t_3 = 0;
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
- /* "cutadapt/_seqio.pyx":85
- * """
- * super(FastqReader, self).__init__(file)
- * self.sequence_class = sequence_class # <<<<<<<<<<<<<<
- * self.delivers_qualities = True
- *
- */
- if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_sequence_class, __pyx_v_sequence_class) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 85; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
-
- /* "cutadapt/_seqio.pyx":86
- * super(FastqReader, self).__init__(file)
- * self.sequence_class = sequence_class
- * self.delivers_qualities = True # <<<<<<<<<<<<<<
- *
- * def __iter__(self):
- */
- if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_delivers_qualities, Py_True) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 86; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
-
- /* "cutadapt/_seqio.pyx":79
- * Reader for FASTQ files. Does not support multi-line FASTQ files.
- * """
- * def __init__(self, file, sequence_class=Sequence): # <<<<<<<<<<<<<<
- * """
- * file is a filename or a file-like object.
- */
+ if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_sequence_class, __pyx_v_sequence_class) < 0) __PYX_ERR(0, 85, __pyx_L1_error)
+
+ if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_delivers_qualities, Py_True) < 0) __PYX_ERR(0, 86, __pyx_L1_error)
+
/* function exit code */
__pyx_r = Py_None; __Pyx_INCREF(Py_None);
@@ -3036,13 +2653,6 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_11FastqReader___init__(CYTHON_UNUSED
}
static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_CoroutineObject *__pyx_generator, PyObject *__pyx_sent_value); /* proto */
-/* "cutadapt/_seqio.pyx":88
- * self.delivers_qualities = True
- *
- * def __iter__(self): # <<<<<<<<<<<<<<
- * """
- * Yield Sequence objects
- */
/* Python wrapper */
static PyObject *__pyx_pw_8cutadapt_6_seqio_11FastqReader_3__iter__(PyObject *__pyx_self, PyObject *__pyx_v_self); /*proto*/
@@ -3063,9 +2673,6 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_11FastqReader_2__iter__(CYTHON_UNUSE
struct __pyx_obj_8cutadapt_6_seqio___pyx_scope_struct____iter__ *__pyx_cur_scope;
PyObject *__pyx_r = NULL;
__Pyx_RefNannyDeclarations
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannySetupContext("__iter__", 0);
__pyx_cur_scope = (struct __pyx_obj_8cutadapt_6_seqio___pyx_scope_struct____iter__ *)__pyx_tp_new_8cutadapt_6_seqio___pyx_scope_struct____iter__(__pyx_ptype_8cutadapt_6_seqio___pyx_scope_struct____iter__, __pyx_empty_tuple, NULL);
if (unlikely(!__pyx_cur_scope)) {
@@ -3077,7 +2684,7 @@ static PyObject *__pyx_pf_8cutadapt_6_seqio_11FastqReader_2__iter__(CYTHON_UNUSE
__Pyx_INCREF(__pyx_cur_scope->__pyx_v_self);
__Pyx_GIVEREF(__pyx_cur_scope->__pyx_v_self);
{
- __pyx_CoroutineObject *gen = __Pyx_Generator_New((__pyx_coroutine_body_t) __pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator, (PyObject *) __pyx_cur_scope, __pyx_n_s_iter, __pyx_n_s_FastqReader___iter); if (unlikely(!gen)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 88; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_CoroutineObject *gen = __Pyx_Generator_New((__pyx_coroutine_body_t) __pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator, (PyObject *) __pyx_cur_scope, __pyx_n_s_iter, __pyx_n_s_FastqReader___iter); if (unlikely(!gen)) __PYX_ERR(0, 88, __pyx_L1_error)
__Pyx_DECREF(__pyx_cur_scope);
__Pyx_RefNannyFinishContext();
return (PyObject *) gen;
@@ -3113,9 +2720,6 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
Py_ssize_t __pyx_t_14;
PyObject *__pyx_t_15 = NULL;
Py_ssize_t __pyx_t_16;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannyDeclarations
__Pyx_RefNannySetupContext("None", 0);
switch (__pyx_generator->resume_label) {
@@ -3126,100 +2730,58 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
return NULL;
}
__pyx_L3_first_run:;
- if (unlikely(!__pyx_sent_value)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 88; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
-
- /* "cutadapt/_seqio.pyx":92
- * Yield Sequence objects
- * """
- * cdef int i = 0 # <<<<<<<<<<<<<<
- * cdef int strip
- * cdef str line, name, qualities, sequence, name2
- */
+ if (unlikely(!__pyx_sent_value)) __PYX_ERR(0, 88, __pyx_L1_error)
+
__pyx_cur_scope->__pyx_v_i = 0;
- /* "cutadapt/_seqio.pyx":95
- * cdef int strip
- * cdef str line, name, qualities, sequence, name2
- * sequence_class = self.sequence_class # <<<<<<<<<<<<<<
- *
- * it = iter(self._file)
- */
- __pyx_t_1 = __Pyx_PyObject_GetAttrStr(__pyx_cur_scope->__pyx_v_self, __pyx_n_s_sequence_class); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 95; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyObject_GetAttrStr(__pyx_cur_scope->__pyx_v_self, __pyx_n_s_sequence_class); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 95, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_GIVEREF(__pyx_t_1);
__pyx_cur_scope->__pyx_v_sequence_class = __pyx_t_1;
__pyx_t_1 = 0;
- /* "cutadapt/_seqio.pyx":97
- * sequence_class = self.sequence_class
- *
- * it = iter(self._file) # <<<<<<<<<<<<<<
- * line = next(it)
- * if not (line and line[0] == '@'):
- */
- __pyx_t_1 = __Pyx_PyObject_GetAttrStr(__pyx_cur_scope->__pyx_v_self, __pyx_n_s_file_2); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 97; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyObject_GetAttrStr(__pyx_cur_scope->__pyx_v_self, __pyx_n_s_file_2); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 97, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
- __pyx_t_2 = PyObject_GetIter(__pyx_t_1); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 97; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = PyObject_GetIter(__pyx_t_1); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 97, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
__Pyx_GIVEREF(__pyx_t_2);
__pyx_cur_scope->__pyx_v_it = __pyx_t_2;
__pyx_t_2 = 0;
- /* "cutadapt/_seqio.pyx":98
- *
- * it = iter(self._file)
- * line = next(it) # <<<<<<<<<<<<<<
- * if not (line and line[0] == '@'):
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- */
- __pyx_t_2 = __Pyx_PyIter_Next(__pyx_cur_scope->__pyx_v_it); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 98; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_PyIter_Next(__pyx_cur_scope->__pyx_v_it); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 98, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
- if (!(likely(PyString_CheckExact(__pyx_t_2))||((__pyx_t_2) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_t_2)->tp_name), 0))) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 98; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (!(likely(PyString_CheckExact(__pyx_t_2))||((__pyx_t_2) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_t_2)->tp_name), 0))) __PYX_ERR(0, 98, __pyx_L1_error)
__Pyx_GIVEREF(__pyx_t_2);
__pyx_cur_scope->__pyx_v_line = ((PyObject*)__pyx_t_2);
__pyx_t_2 = 0;
- /* "cutadapt/_seqio.pyx":99
- * it = iter(self._file)
- * line = next(it)
- * if not (line and line[0] == '@'): # <<<<<<<<<<<<<<
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- * strip = -2 if line.endswith('\r\n') else -1
- */
- __pyx_t_4 = __Pyx_PyObject_IsTrue(__pyx_cur_scope->__pyx_v_line); if (unlikely(__pyx_t_4 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 99; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = __Pyx_PyObject_IsTrue(__pyx_cur_scope->__pyx_v_line); if (unlikely(__pyx_t_4 < 0)) __PYX_ERR(0, 99, __pyx_L1_error)
if (__pyx_t_4) {
} else {
__pyx_t_3 = __pyx_t_4;
goto __pyx_L5_bool_binop_done;
}
- __pyx_t_2 = __Pyx_GetItemInt(__pyx_cur_scope->__pyx_v_line, 0, long, 1, __Pyx_PyInt_From_long, 0, 0, 1); if (unlikely(__pyx_t_2 == NULL)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 99; __pyx_clineno = __LINE__; goto __pyx_L1_error;};
+ __pyx_t_2 = __Pyx_GetItemInt(__pyx_cur_scope->__pyx_v_line, 0, long, 1, __Pyx_PyInt_From_long, 0, 0, 1); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 99, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
- __pyx_t_4 = (__Pyx_PyString_Equals(__pyx_t_2, __pyx_kp_s__2, Py_EQ)); if (unlikely(__pyx_t_4 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 99; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = (__Pyx_PyString_Equals(__pyx_t_2, __pyx_kp_s__2, Py_EQ)); if (unlikely(__pyx_t_4 < 0)) __PYX_ERR(0, 99, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
__pyx_t_3 = __pyx_t_4;
__pyx_L5_bool_binop_done:;
__pyx_t_4 = ((!__pyx_t_3) != 0);
if (__pyx_t_4) {
- /* "cutadapt/_seqio.pyx":100
- * line = next(it)
- * if not (line and line[0] == '@'):
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10])) # <<<<<<<<<<<<<<
- * strip = -2 if line.endswith('\r\n') else -1
- * name = line[1:strip]
- */
- __pyx_t_1 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 100; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 100, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
- __pyx_t_6 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_Line_0_in_FASTQ_file_is_expected, __pyx_n_s_format); if (unlikely(!__pyx_t_6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 100; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_Line_0_in_FASTQ_file_is_expected, __pyx_n_s_format); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 100, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_6);
- __pyx_t_7 = __Pyx_PyInt_From_long((__pyx_cur_scope->__pyx_v_i + 1)); if (unlikely(!__pyx_t_7)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 100; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_7 = __Pyx_PyInt_From_long((__pyx_cur_scope->__pyx_v_i + 1)); if (unlikely(!__pyx_t_7)) __PYX_ERR(0, 100, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_7);
if (unlikely(__pyx_cur_scope->__pyx_v_line == Py_None)) {
PyErr_SetString(PyExc_TypeError, "'NoneType' object is not subscriptable");
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 100; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __PYX_ERR(0, 100, __pyx_L1_error)
}
- __pyx_t_8 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, 10); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 100; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_8 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, 10); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 100, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_8);
__pyx_t_9 = NULL;
__pyx_t_10 = 0;
@@ -3233,7 +2795,7 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
__pyx_t_10 = 1;
}
}
- __pyx_t_11 = PyTuple_New(2+__pyx_t_10); if (unlikely(!__pyx_t_11)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 100; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_11 = PyTuple_New(2+__pyx_t_10); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 100, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_11);
if (__pyx_t_9) {
__Pyx_GIVEREF(__pyx_t_9); PyTuple_SET_ITEM(__pyx_t_11, 0, __pyx_t_9); __pyx_t_9 = NULL;
@@ -3244,7 +2806,7 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
PyTuple_SET_ITEM(__pyx_t_11, 1+__pyx_t_10, __pyx_t_8);
__pyx_t_7 = 0;
__pyx_t_8 = 0;
- __pyx_t_5 = __Pyx_PyObject_Call(__pyx_t_6, __pyx_t_11, NULL); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 100; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_PyObject_Call(__pyx_t_6, __pyx_t_11, NULL); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 100, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
__Pyx_DECREF(__pyx_t_11); __pyx_t_11 = 0;
__Pyx_DECREF(__pyx_t_6); __pyx_t_6 = 0;
@@ -3259,46 +2821,32 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
}
}
if (!__pyx_t_6) {
- __pyx_t_2 = __Pyx_PyObject_CallOneArg(__pyx_t_1, __pyx_t_5); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 100; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_PyObject_CallOneArg(__pyx_t_1, __pyx_t_5); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 100, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
__Pyx_GOTREF(__pyx_t_2);
} else {
- __pyx_t_11 = PyTuple_New(1+1); if (unlikely(!__pyx_t_11)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 100; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_11 = PyTuple_New(1+1); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 100, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_11);
__Pyx_GIVEREF(__pyx_t_6); PyTuple_SET_ITEM(__pyx_t_11, 0, __pyx_t_6); __pyx_t_6 = NULL;
__Pyx_GIVEREF(__pyx_t_5);
PyTuple_SET_ITEM(__pyx_t_11, 0+1, __pyx_t_5);
__pyx_t_5 = 0;
- __pyx_t_2 = __Pyx_PyObject_Call(__pyx_t_1, __pyx_t_11, NULL); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 100; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_PyObject_Call(__pyx_t_1, __pyx_t_11, NULL); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 100, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
__Pyx_DECREF(__pyx_t_11); __pyx_t_11 = 0;
}
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
__Pyx_Raise(__pyx_t_2, 0, 0, 0);
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 100; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
-
- /* "cutadapt/_seqio.pyx":99
- * it = iter(self._file)
- * line = next(it)
- * if not (line and line[0] == '@'): # <<<<<<<<<<<<<<
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- * strip = -2 if line.endswith('\r\n') else -1
- */
+ __PYX_ERR(0, 100, __pyx_L1_error)
+
}
- /* "cutadapt/_seqio.pyx":101
- * if not (line and line[0] == '@'):
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- * strip = -2 if line.endswith('\r\n') else -1 # <<<<<<<<<<<<<<
- * name = line[1:strip]
- *
- */
if (unlikely(__pyx_cur_scope->__pyx_v_line == Py_None)) {
PyErr_Format(PyExc_AttributeError, "'NoneType' object has no attribute '%s'", "endswith");
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 101; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __PYX_ERR(0, 101, __pyx_L1_error)
}
- __pyx_t_4 = __Pyx_PyStr_Tailmatch(__pyx_cur_scope->__pyx_v_line, __pyx_kp_s__3, 0, PY_SSIZE_T_MAX, 1); if (unlikely(__pyx_t_4 == -1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 101; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = __Pyx_PyStr_Tailmatch(__pyx_cur_scope->__pyx_v_line, __pyx_kp_s__3, 0, PY_SSIZE_T_MAX, 1); if (unlikely(__pyx_t_4 == -1)) __PYX_ERR(0, 101, __pyx_L1_error)
if ((__pyx_t_4 != 0)) {
__pyx_t_12 = -2;
} else {
@@ -3306,63 +2854,42 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
}
__pyx_cur_scope->__pyx_v_strip = __pyx_t_12;
- /* "cutadapt/_seqio.pyx":102
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- * strip = -2 if line.endswith('\r\n') else -1
- * name = line[1:strip] # <<<<<<<<<<<<<<
- *
- * i = 1
- */
if (unlikely(__pyx_cur_scope->__pyx_v_line == Py_None)) {
PyErr_SetString(PyExc_TypeError, "'NoneType' object is not subscriptable");
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 102; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __PYX_ERR(0, 102, __pyx_L1_error)
}
- __pyx_t_2 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 1, __pyx_cur_scope->__pyx_v_strip); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 102; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 1, __pyx_cur_scope->__pyx_v_strip); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 102, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
__Pyx_GIVEREF(__pyx_t_2);
__pyx_cur_scope->__pyx_v_name = ((PyObject*)__pyx_t_2);
__pyx_t_2 = 0;
- /* "cutadapt/_seqio.pyx":104
- * name = line[1:strip]
- *
- * i = 1 # <<<<<<<<<<<<<<
- * for line in it:
- * if i == 0:
- */
__pyx_cur_scope->__pyx_v_i = 1;
- /* "cutadapt/_seqio.pyx":105
- *
- * i = 1
- * for line in it: # <<<<<<<<<<<<<<
- * if i == 0:
- * if not (line and line[0] == '@'):
- */
if (likely(PyList_CheckExact(__pyx_cur_scope->__pyx_v_it)) || PyTuple_CheckExact(__pyx_cur_scope->__pyx_v_it)) {
__pyx_t_2 = __pyx_cur_scope->__pyx_v_it; __Pyx_INCREF(__pyx_t_2); __pyx_t_10 = 0;
__pyx_t_13 = NULL;
} else {
- __pyx_t_10 = -1; __pyx_t_2 = PyObject_GetIter(__pyx_cur_scope->__pyx_v_it); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 105; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_10 = -1; __pyx_t_2 = PyObject_GetIter(__pyx_cur_scope->__pyx_v_it); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 105, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
- __pyx_t_13 = Py_TYPE(__pyx_t_2)->tp_iternext; if (unlikely(!__pyx_t_13)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 105; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_13 = Py_TYPE(__pyx_t_2)->tp_iternext; if (unlikely(!__pyx_t_13)) __PYX_ERR(0, 105, __pyx_L1_error)
}
for (;;) {
if (likely(!__pyx_t_13)) {
if (likely(PyList_CheckExact(__pyx_t_2))) {
if (__pyx_t_10 >= PyList_GET_SIZE(__pyx_t_2)) break;
#if CYTHON_COMPILING_IN_CPYTHON
- __pyx_t_1 = PyList_GET_ITEM(__pyx_t_2, __pyx_t_10); __Pyx_INCREF(__pyx_t_1); __pyx_t_10++; if (unlikely(0 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 105; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PyList_GET_ITEM(__pyx_t_2, __pyx_t_10); __Pyx_INCREF(__pyx_t_1); __pyx_t_10++; if (unlikely(0 < 0)) __PYX_ERR(0, 105, __pyx_L1_error)
#else
- __pyx_t_1 = PySequence_ITEM(__pyx_t_2, __pyx_t_10); __pyx_t_10++; if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 105; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PySequence_ITEM(__pyx_t_2, __pyx_t_10); __pyx_t_10++; if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 105, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
#endif
} else {
if (__pyx_t_10 >= PyTuple_GET_SIZE(__pyx_t_2)) break;
#if CYTHON_COMPILING_IN_CPYTHON
- __pyx_t_1 = PyTuple_GET_ITEM(__pyx_t_2, __pyx_t_10); __Pyx_INCREF(__pyx_t_1); __pyx_t_10++; if (unlikely(0 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 105; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PyTuple_GET_ITEM(__pyx_t_2, __pyx_t_10); __Pyx_INCREF(__pyx_t_1); __pyx_t_10++; if (unlikely(0 < 0)) __PYX_ERR(0, 105, __pyx_L1_error)
#else
- __pyx_t_1 = PySequence_ITEM(__pyx_t_2, __pyx_t_10); __pyx_t_10++; if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 105; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PySequence_ITEM(__pyx_t_2, __pyx_t_10); __pyx_t_10++; if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 105, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
#endif
}
@@ -3372,68 +2899,47 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
PyObject* exc_type = PyErr_Occurred();
if (exc_type) {
if (likely(exc_type == PyExc_StopIteration || PyErr_GivenExceptionMatches(exc_type, PyExc_StopIteration))) PyErr_Clear();
- else {__pyx_filename = __pyx_f[0]; __pyx_lineno = 105; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ else __PYX_ERR(0, 105, __pyx_L1_error)
}
break;
}
__Pyx_GOTREF(__pyx_t_1);
}
- if (!(likely(PyString_CheckExact(__pyx_t_1))||((__pyx_t_1) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_t_1)->tp_name), 0))) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 105; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (!(likely(PyString_CheckExact(__pyx_t_1))||((__pyx_t_1) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_t_1)->tp_name), 0))) __PYX_ERR(0, 105, __pyx_L1_error)
__Pyx_GOTREF(__pyx_cur_scope->__pyx_v_line);
__Pyx_DECREF_SET(__pyx_cur_scope->__pyx_v_line, ((PyObject*)__pyx_t_1));
__Pyx_GIVEREF(__pyx_t_1);
__pyx_t_1 = 0;
- /* "cutadapt/_seqio.pyx":106
- * i = 1
- * for line in it:
- * if i == 0: # <<<<<<<<<<<<<<
- * if not (line and line[0] == '@'):
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- */
switch (__pyx_cur_scope->__pyx_v_i) {
case 0:
- /* "cutadapt/_seqio.pyx":107
- * for line in it:
- * if i == 0:
- * if not (line and line[0] == '@'): # <<<<<<<<<<<<<<
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- * name = line[1:strip]
- */
- __pyx_t_3 = __Pyx_PyObject_IsTrue(__pyx_cur_scope->__pyx_v_line); if (unlikely(__pyx_t_3 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 107; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = __Pyx_PyObject_IsTrue(__pyx_cur_scope->__pyx_v_line); if (unlikely(__pyx_t_3 < 0)) __PYX_ERR(0, 107, __pyx_L1_error)
if (__pyx_t_3) {
} else {
__pyx_t_4 = __pyx_t_3;
goto __pyx_L10_bool_binop_done;
}
- __pyx_t_1 = __Pyx_GetItemInt(__pyx_cur_scope->__pyx_v_line, 0, long, 1, __Pyx_PyInt_From_long, 0, 0, 1); if (unlikely(__pyx_t_1 == NULL)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 107; __pyx_clineno = __LINE__; goto __pyx_L1_error;};
+ __pyx_t_1 = __Pyx_GetItemInt(__pyx_cur_scope->__pyx_v_line, 0, long, 1, __Pyx_PyInt_From_long, 0, 0, 1); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 107, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
- __pyx_t_3 = (__Pyx_PyString_Equals(__pyx_t_1, __pyx_kp_s__2, Py_EQ)); if (unlikely(__pyx_t_3 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 107; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = (__Pyx_PyString_Equals(__pyx_t_1, __pyx_kp_s__2, Py_EQ)); if (unlikely(__pyx_t_3 < 0)) __PYX_ERR(0, 107, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
__pyx_t_4 = __pyx_t_3;
__pyx_L10_bool_binop_done:;
__pyx_t_3 = ((!__pyx_t_4) != 0);
if (__pyx_t_3) {
- /* "cutadapt/_seqio.pyx":108
- * if i == 0:
- * if not (line and line[0] == '@'):
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10])) # <<<<<<<<<<<<<<
- * name = line[1:strip]
- * elif i == 1:
- */
- __pyx_t_11 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_11)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 108; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_11 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 108, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_11);
- __pyx_t_6 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_Line_0_in_FASTQ_file_is_expected, __pyx_n_s_format); if (unlikely(!__pyx_t_6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 108; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_Line_0_in_FASTQ_file_is_expected, __pyx_n_s_format); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 108, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_6);
- __pyx_t_8 = __Pyx_PyInt_From_long((__pyx_cur_scope->__pyx_v_i + 1)); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 108; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_8 = __Pyx_PyInt_From_long((__pyx_cur_scope->__pyx_v_i + 1)); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 108, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_8);
if (unlikely(__pyx_cur_scope->__pyx_v_line == Py_None)) {
PyErr_SetString(PyExc_TypeError, "'NoneType' object is not subscriptable");
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 108; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __PYX_ERR(0, 108, __pyx_L1_error)
}
- __pyx_t_7 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, 10); if (unlikely(!__pyx_t_7)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 108; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_7 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, 10); if (unlikely(!__pyx_t_7)) __PYX_ERR(0, 108, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_7);
__pyx_t_9 = NULL;
__pyx_t_14 = 0;
@@ -3447,7 +2953,7 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
__pyx_t_14 = 1;
}
}
- __pyx_t_15 = PyTuple_New(2+__pyx_t_14); if (unlikely(!__pyx_t_15)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 108; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_15 = PyTuple_New(2+__pyx_t_14); if (unlikely(!__pyx_t_15)) __PYX_ERR(0, 108, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_15);
if (__pyx_t_9) {
__Pyx_GIVEREF(__pyx_t_9); PyTuple_SET_ITEM(__pyx_t_15, 0, __pyx_t_9); __pyx_t_9 = NULL;
@@ -3458,7 +2964,7 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
PyTuple_SET_ITEM(__pyx_t_15, 1+__pyx_t_14, __pyx_t_7);
__pyx_t_8 = 0;
__pyx_t_7 = 0;
- __pyx_t_5 = __Pyx_PyObject_Call(__pyx_t_6, __pyx_t_15, NULL); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 108; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_PyObject_Call(__pyx_t_6, __pyx_t_15, NULL); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 108, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
__Pyx_DECREF(__pyx_t_15); __pyx_t_15 = 0;
__Pyx_DECREF(__pyx_t_6); __pyx_t_6 = 0;
@@ -3473,194 +2979,103 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
}
}
if (!__pyx_t_6) {
- __pyx_t_1 = __Pyx_PyObject_CallOneArg(__pyx_t_11, __pyx_t_5); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 108; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyObject_CallOneArg(__pyx_t_11, __pyx_t_5); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 108, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
__Pyx_GOTREF(__pyx_t_1);
} else {
- __pyx_t_15 = PyTuple_New(1+1); if (unlikely(!__pyx_t_15)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 108; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_15 = PyTuple_New(1+1); if (unlikely(!__pyx_t_15)) __PYX_ERR(0, 108, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_15);
__Pyx_GIVEREF(__pyx_t_6); PyTuple_SET_ITEM(__pyx_t_15, 0, __pyx_t_6); __pyx_t_6 = NULL;
__Pyx_GIVEREF(__pyx_t_5);
PyTuple_SET_ITEM(__pyx_t_15, 0+1, __pyx_t_5);
__pyx_t_5 = 0;
- __pyx_t_1 = __Pyx_PyObject_Call(__pyx_t_11, __pyx_t_15, NULL); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 108; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyObject_Call(__pyx_t_11, __pyx_t_15, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 108, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_DECREF(__pyx_t_15); __pyx_t_15 = 0;
}
__Pyx_DECREF(__pyx_t_11); __pyx_t_11 = 0;
__Pyx_Raise(__pyx_t_1, 0, 0, 0);
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 108; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
-
- /* "cutadapt/_seqio.pyx":107
- * for line in it:
- * if i == 0:
- * if not (line and line[0] == '@'): # <<<<<<<<<<<<<<
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- * name = line[1:strip]
- */
+ __PYX_ERR(0, 108, __pyx_L1_error)
+
}
- /* "cutadapt/_seqio.pyx":109
- * if not (line and line[0] == '@'):
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- * name = line[1:strip] # <<<<<<<<<<<<<<
- * elif i == 1:
- * sequence = line[:strip]
- */
if (unlikely(__pyx_cur_scope->__pyx_v_line == Py_None)) {
PyErr_SetString(PyExc_TypeError, "'NoneType' object is not subscriptable");
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 109; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __PYX_ERR(0, 109, __pyx_L1_error)
}
- __pyx_t_1 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 1, __pyx_cur_scope->__pyx_v_strip); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 109; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 1, __pyx_cur_scope->__pyx_v_strip); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 109, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_GOTREF(__pyx_cur_scope->__pyx_v_name);
__Pyx_DECREF_SET(__pyx_cur_scope->__pyx_v_name, ((PyObject*)__pyx_t_1));
__Pyx_GIVEREF(__pyx_t_1);
__pyx_t_1 = 0;
- /* "cutadapt/_seqio.pyx":106
- * i = 1
- * for line in it:
- * if i == 0: # <<<<<<<<<<<<<<
- * if not (line and line[0] == '@'):
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- */
break;
- /* "cutadapt/_seqio.pyx":110
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- * name = line[1:strip]
- * elif i == 1: # <<<<<<<<<<<<<<
- * sequence = line[:strip]
- * elif i == 2:
- */
case 1:
- /* "cutadapt/_seqio.pyx":111
- * name = line[1:strip]
- * elif i == 1:
- * sequence = line[:strip] # <<<<<<<<<<<<<<
- * elif i == 2:
- * if line == '+\n': # check most common case first
- */
if (unlikely(__pyx_cur_scope->__pyx_v_line == Py_None)) {
PyErr_SetString(PyExc_TypeError, "'NoneType' object is not subscriptable");
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 111; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __PYX_ERR(0, 111, __pyx_L1_error)
}
- __pyx_t_1 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, __pyx_cur_scope->__pyx_v_strip); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 111; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, __pyx_cur_scope->__pyx_v_strip); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 111, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_XGOTREF(__pyx_cur_scope->__pyx_v_sequence);
__Pyx_XDECREF_SET(__pyx_cur_scope->__pyx_v_sequence, ((PyObject*)__pyx_t_1));
__Pyx_GIVEREF(__pyx_t_1);
__pyx_t_1 = 0;
- /* "cutadapt/_seqio.pyx":110
- * raise FormatError("Line {0} in FASTQ file is expected to start with '@', but found {1!r}".format(i+1, line[:10]))
- * name = line[1:strip]
- * elif i == 1: # <<<<<<<<<<<<<<
- * sequence = line[:strip]
- * elif i == 2:
- */
break;
- /* "cutadapt/_seqio.pyx":112
- * elif i == 1:
- * sequence = line[:strip]
- * elif i == 2: # <<<<<<<<<<<<<<
- * if line == '+\n': # check most common case first
- * name2 = ''
- */
case 2:
- /* "cutadapt/_seqio.pyx":113
- * sequence = line[:strip]
- * elif i == 2:
- * if line == '+\n': # check most common case first # <<<<<<<<<<<<<<
- * name2 = ''
- * else:
- */
- __pyx_t_3 = (__Pyx_PyString_Equals(__pyx_cur_scope->__pyx_v_line, __pyx_kp_s__4, Py_EQ)); if (unlikely(__pyx_t_3 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 113; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = (__Pyx_PyString_Equals(__pyx_cur_scope->__pyx_v_line, __pyx_kp_s__4, Py_EQ)); if (unlikely(__pyx_t_3 < 0)) __PYX_ERR(0, 113, __pyx_L1_error)
__pyx_t_4 = (__pyx_t_3 != 0);
if (__pyx_t_4) {
- /* "cutadapt/_seqio.pyx":114
- * elif i == 2:
- * if line == '+\n': # check most common case first
- * name2 = '' # <<<<<<<<<<<<<<
- * else:
- * line = line[:strip]
- */
__Pyx_INCREF(__pyx_kp_s_);
__Pyx_XGOTREF(__pyx_cur_scope->__pyx_v_name2);
__Pyx_XDECREF_SET(__pyx_cur_scope->__pyx_v_name2, __pyx_kp_s_);
__Pyx_GIVEREF(__pyx_kp_s_);
- /* "cutadapt/_seqio.pyx":113
- * sequence = line[:strip]
- * elif i == 2:
- * if line == '+\n': # check most common case first # <<<<<<<<<<<<<<
- * name2 = ''
- * else:
- */
goto __pyx_L12;
}
- /* "cutadapt/_seqio.pyx":116
- * name2 = ''
- * else:
- * line = line[:strip] # <<<<<<<<<<<<<<
- * if not (line and line[0] == '+'):
- * raise FormatError("Line {0} in FASTQ file is expected to start with '+', but found {1!r}".format(i+1, line[:10]))
- */
/*else*/ {
if (unlikely(__pyx_cur_scope->__pyx_v_line == Py_None)) {
PyErr_SetString(PyExc_TypeError, "'NoneType' object is not subscriptable");
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 116; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __PYX_ERR(0, 116, __pyx_L1_error)
}
- __pyx_t_1 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, __pyx_cur_scope->__pyx_v_strip); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 116; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, __pyx_cur_scope->__pyx_v_strip); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 116, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_GOTREF(__pyx_cur_scope->__pyx_v_line);
__Pyx_DECREF_SET(__pyx_cur_scope->__pyx_v_line, ((PyObject*)__pyx_t_1));
__Pyx_GIVEREF(__pyx_t_1);
__pyx_t_1 = 0;
- /* "cutadapt/_seqio.pyx":117
- * else:
- * line = line[:strip]
- * if not (line and line[0] == '+'): # <<<<<<<<<<<<<<
- * raise FormatError("Line {0} in FASTQ file is expected to start with '+', but found {1!r}".format(i+1, line[:10]))
- * if len(line) > 1:
- */
- __pyx_t_3 = __Pyx_PyObject_IsTrue(__pyx_cur_scope->__pyx_v_line); if (unlikely(__pyx_t_3 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 117; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = __Pyx_PyObject_IsTrue(__pyx_cur_scope->__pyx_v_line); if (unlikely(__pyx_t_3 < 0)) __PYX_ERR(0, 117, __pyx_L1_error)
if (__pyx_t_3) {
} else {
__pyx_t_4 = __pyx_t_3;
goto __pyx_L14_bool_binop_done;
}
- __pyx_t_1 = __Pyx_GetItemInt(__pyx_cur_scope->__pyx_v_line, 0, long, 1, __Pyx_PyInt_From_long, 0, 0, 1); if (unlikely(__pyx_t_1 == NULL)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 117; __pyx_clineno = __LINE__; goto __pyx_L1_error;};
+ __pyx_t_1 = __Pyx_GetItemInt(__pyx_cur_scope->__pyx_v_line, 0, long, 1, __Pyx_PyInt_From_long, 0, 0, 1); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 117, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
- __pyx_t_3 = (__Pyx_PyString_Equals(__pyx_t_1, __pyx_kp_s__5, Py_EQ)); if (unlikely(__pyx_t_3 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 117; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = (__Pyx_PyString_Equals(__pyx_t_1, __pyx_kp_s__5, Py_EQ)); if (unlikely(__pyx_t_3 < 0)) __PYX_ERR(0, 117, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
__pyx_t_4 = __pyx_t_3;
__pyx_L14_bool_binop_done:;
__pyx_t_3 = ((!__pyx_t_4) != 0);
if (__pyx_t_3) {
- /* "cutadapt/_seqio.pyx":118
- * line = line[:strip]
- * if not (line and line[0] == '+'):
- * raise FormatError("Line {0} in FASTQ file is expected to start with '+', but found {1!r}".format(i+1, line[:10])) # <<<<<<<<<<<<<<
- * if len(line) > 1:
- * if not line[1:] == name:
- */
- __pyx_t_11 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_11)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 118; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_11 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 118, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_11);
- __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_Line_0_in_FASTQ_file_is_expected_2, __pyx_n_s_format); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 118; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_Line_0_in_FASTQ_file_is_expected_2, __pyx_n_s_format); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 118, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
- __pyx_t_6 = __Pyx_PyInt_From_long((__pyx_cur_scope->__pyx_v_i + 1)); if (unlikely(!__pyx_t_6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 118; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_6 = __Pyx_PyInt_From_long((__pyx_cur_scope->__pyx_v_i + 1)); if (unlikely(!__pyx_t_6)) __PYX_ERR(0, 118, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_6);
- __pyx_t_7 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, 10); if (unlikely(!__pyx_t_7)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 118; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_7 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, 10); if (unlikely(!__pyx_t_7)) __PYX_ERR(0, 118, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_7);
__pyx_t_8 = NULL;
__pyx_t_14 = 0;
@@ -3674,7 +3089,7 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
__pyx_t_14 = 1;
}
}
- __pyx_t_9 = PyTuple_New(2+__pyx_t_14); if (unlikely(!__pyx_t_9)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 118; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_9 = PyTuple_New(2+__pyx_t_14); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 118, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_9);
if (__pyx_t_8) {
__Pyx_GIVEREF(__pyx_t_8); PyTuple_SET_ITEM(__pyx_t_9, 0, __pyx_t_8); __pyx_t_8 = NULL;
@@ -3685,7 +3100,7 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
PyTuple_SET_ITEM(__pyx_t_9, 1+__pyx_t_14, __pyx_t_7);
__pyx_t_6 = 0;
__pyx_t_7 = 0;
- __pyx_t_15 = __Pyx_PyObject_Call(__pyx_t_5, __pyx_t_9, NULL); if (unlikely(!__pyx_t_15)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 118; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_15 = __Pyx_PyObject_Call(__pyx_t_5, __pyx_t_9, NULL); if (unlikely(!__pyx_t_15)) __PYX_ERR(0, 118, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_15);
__Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
__Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
@@ -3700,89 +3115,47 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
}
}
if (!__pyx_t_5) {
- __pyx_t_1 = __Pyx_PyObject_CallOneArg(__pyx_t_11, __pyx_t_15); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 118; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyObject_CallOneArg(__pyx_t_11, __pyx_t_15); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 118, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_15); __pyx_t_15 = 0;
__Pyx_GOTREF(__pyx_t_1);
} else {
- __pyx_t_9 = PyTuple_New(1+1); if (unlikely(!__pyx_t_9)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 118; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_9 = PyTuple_New(1+1); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 118, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_9);
__Pyx_GIVEREF(__pyx_t_5); PyTuple_SET_ITEM(__pyx_t_9, 0, __pyx_t_5); __pyx_t_5 = NULL;
__Pyx_GIVEREF(__pyx_t_15);
PyTuple_SET_ITEM(__pyx_t_9, 0+1, __pyx_t_15);
__pyx_t_15 = 0;
- __pyx_t_1 = __Pyx_PyObject_Call(__pyx_t_11, __pyx_t_9, NULL); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 118; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyObject_Call(__pyx_t_11, __pyx_t_9, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 118, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
}
__Pyx_DECREF(__pyx_t_11); __pyx_t_11 = 0;
__Pyx_Raise(__pyx_t_1, 0, 0, 0);
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 118; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
-
- /* "cutadapt/_seqio.pyx":117
- * else:
- * line = line[:strip]
- * if not (line and line[0] == '+'): # <<<<<<<<<<<<<<
- * raise FormatError("Line {0} in FASTQ file is expected to start with '+', but found {1!r}".format(i+1, line[:10]))
- * if len(line) > 1:
- */
+ __PYX_ERR(0, 118, __pyx_L1_error)
+
}
- /* "cutadapt/_seqio.pyx":119
- * if not (line and line[0] == '+'):
- * raise FormatError("Line {0} in FASTQ file is expected to start with '+', but found {1!r}".format(i+1, line[:10]))
- * if len(line) > 1: # <<<<<<<<<<<<<<
- * if not line[1:] == name:
- * raise FormatError(
- */
- __pyx_t_14 = PyObject_Length(__pyx_cur_scope->__pyx_v_line); if (unlikely(__pyx_t_14 == -1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 119; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_14 = PyObject_Length(__pyx_cur_scope->__pyx_v_line); if (unlikely(__pyx_t_14 == -1)) __PYX_ERR(0, 119, __pyx_L1_error)
__pyx_t_3 = ((__pyx_t_14 > 1) != 0);
if (__pyx_t_3) {
- /* "cutadapt/_seqio.pyx":120
- * raise FormatError("Line {0} in FASTQ file is expected to start with '+', but found {1!r}".format(i+1, line[:10]))
- * if len(line) > 1:
- * if not line[1:] == name: # <<<<<<<<<<<<<<
- * raise FormatError(
- * "At line {0}: Sequence descriptions in the FASTQ file don't match "
- */
- __pyx_t_1 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 1, PY_SSIZE_T_MAX); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 120; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 1, PY_SSIZE_T_MAX); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 120, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
- __pyx_t_3 = (__Pyx_PyString_Equals(__pyx_t_1, __pyx_cur_scope->__pyx_v_name, Py_EQ)); if (unlikely(__pyx_t_3 < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 120; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = (__Pyx_PyString_Equals(__pyx_t_1, __pyx_cur_scope->__pyx_v_name, Py_EQ)); if (unlikely(__pyx_t_3 < 0)) __PYX_ERR(0, 120, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
__pyx_t_4 = ((!(__pyx_t_3 != 0)) != 0);
if (__pyx_t_4) {
- /* "cutadapt/_seqio.pyx":121
- * if len(line) > 1:
- * if not line[1:] == name:
- * raise FormatError( # <<<<<<<<<<<<<<
- * "At line {0}: Sequence descriptions in the FASTQ file don't match "
- * "({1!r} != {2!r}).\n"
- */
- __pyx_t_11 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_11)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 121; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_11 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 121, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_11);
- /* "cutadapt/_seqio.pyx":125
- * "({1!r} != {2!r}).\n"
- * "The second sequence description must be either empty "
- * "or equal to the first description.".format(i+1, # <<<<<<<<<<<<<<
- * name, line[1:]))
- * name2 = name
- */
- __pyx_t_15 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_At_line_0_Sequence_descriptions, __pyx_n_s_format); if (unlikely(!__pyx_t_15)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 125; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_15 = __Pyx_PyObject_GetAttrStr(__pyx_kp_s_At_line_0_Sequence_descriptions, __pyx_n_s_format); if (unlikely(!__pyx_t_15)) __PYX_ERR(0, 125, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_15);
- __pyx_t_5 = __Pyx_PyInt_From_long((__pyx_cur_scope->__pyx_v_i + 1)); if (unlikely(!__pyx_t_5)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 125; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_5 = __Pyx_PyInt_From_long((__pyx_cur_scope->__pyx_v_i + 1)); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 125, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_5);
- /* "cutadapt/_seqio.pyx":126
- * "The second sequence description must be either empty "
- * "or equal to the first description.".format(i+1,
- * name, line[1:])) # <<<<<<<<<<<<<<
- * name2 = name
- * else:
- */
- __pyx_t_7 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 1, PY_SSIZE_T_MAX); if (unlikely(!__pyx_t_7)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 126; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_7 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 1, PY_SSIZE_T_MAX); if (unlikely(!__pyx_t_7)) __PYX_ERR(0, 126, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_7);
__pyx_t_6 = NULL;
__pyx_t_14 = 0;
@@ -3796,7 +3169,7 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
__pyx_t_14 = 1;
}
}
- __pyx_t_8 = PyTuple_New(3+__pyx_t_14); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 125; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_8 = PyTuple_New(3+__pyx_t_14); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 125, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_8);
if (__pyx_t_6) {
__Pyx_GIVEREF(__pyx_t_6); PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_6); __pyx_t_6 = NULL;
@@ -3810,7 +3183,7 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
PyTuple_SET_ITEM(__pyx_t_8, 2+__pyx_t_14, __pyx_t_7);
__pyx_t_5 = 0;
__pyx_t_7 = 0;
- __pyx_t_9 = __Pyx_PyObject_Call(__pyx_t_15, __pyx_t_8, NULL); if (unlikely(!__pyx_t_9)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 125; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_9 = __Pyx_PyObject_Call(__pyx_t_15, __pyx_t_8, NULL); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 125, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_9);
__Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
__Pyx_DECREF(__pyx_t_15); __pyx_t_15 = 0;
@@ -3825,146 +3198,70 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
}
}
if (!__pyx_t_15) {
- __pyx_t_1 = __Pyx_PyObject_CallOneArg(__pyx_t_11, __pyx_t_9); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 121; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyObject_CallOneArg(__pyx_t_11, __pyx_t_9); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 121, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
__Pyx_GOTREF(__pyx_t_1);
} else {
- __pyx_t_8 = PyTuple_New(1+1); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 121; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_8 = PyTuple_New(1+1); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 121, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_8);
__Pyx_GIVEREF(__pyx_t_15); PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_15); __pyx_t_15 = NULL;
__Pyx_GIVEREF(__pyx_t_9);
PyTuple_SET_ITEM(__pyx_t_8, 0+1, __pyx_t_9);
__pyx_t_9 = 0;
- __pyx_t_1 = __Pyx_PyObject_Call(__pyx_t_11, __pyx_t_8, NULL); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 121; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyObject_Call(__pyx_t_11, __pyx_t_8, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 121, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
}
__Pyx_DECREF(__pyx_t_11); __pyx_t_11 = 0;
__Pyx_Raise(__pyx_t_1, 0, 0, 0);
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 121; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
-
- /* "cutadapt/_seqio.pyx":120
- * raise FormatError("Line {0} in FASTQ file is expected to start with '+', but found {1!r}".format(i+1, line[:10]))
- * if len(line) > 1:
- * if not line[1:] == name: # <<<<<<<<<<<<<<
- * raise FormatError(
- * "At line {0}: Sequence descriptions in the FASTQ file don't match "
- */
+ __PYX_ERR(0, 121, __pyx_L1_error)
+
}
- /* "cutadapt/_seqio.pyx":127
- * "or equal to the first description.".format(i+1,
- * name, line[1:]))
- * name2 = name # <<<<<<<<<<<<<<
- * else:
- * name2 = ''
- */
- __Pyx_INCREF(__pyx_cur_scope->__pyx_v_name);
- __Pyx_XGOTREF(__pyx_cur_scope->__pyx_v_name2);
- __Pyx_XDECREF_SET(__pyx_cur_scope->__pyx_v_name2, __pyx_cur_scope->__pyx_v_name);
- __Pyx_GIVEREF(__pyx_cur_scope->__pyx_v_name);
-
- /* "cutadapt/_seqio.pyx":119
- * if not (line and line[0] == '+'):
- * raise FormatError("Line {0} in FASTQ file is expected to start with '+', but found {1!r}".format(i+1, line[:10]))
- * if len(line) > 1: # <<<<<<<<<<<<<<
- * if not line[1:] == name:
- * raise FormatError(
- */
+ __pyx_cur_scope->__pyx_v_second_header = 1;
+
goto __pyx_L16;
}
- /* "cutadapt/_seqio.pyx":129
- * name2 = name
- * else:
- * name2 = '' # <<<<<<<<<<<<<<
- * elif i == 3:
- * if len(line) == len(sequence) - strip:
- */
/*else*/ {
- __Pyx_INCREF(__pyx_kp_s_);
- __Pyx_XGOTREF(__pyx_cur_scope->__pyx_v_name2);
- __Pyx_XDECREF_SET(__pyx_cur_scope->__pyx_v_name2, __pyx_kp_s_);
- __Pyx_GIVEREF(__pyx_kp_s_);
+ __pyx_cur_scope->__pyx_v_second_header = 0;
}
__pyx_L16:;
}
__pyx_L12:;
- /* "cutadapt/_seqio.pyx":112
- * elif i == 1:
- * sequence = line[:strip]
- * elif i == 2: # <<<<<<<<<<<<<<
- * if line == '+\n': # check most common case first
- * name2 = ''
- */
break;
- /* "cutadapt/_seqio.pyx":130
- * else:
- * name2 = ''
- * elif i == 3: # <<<<<<<<<<<<<<
- * if len(line) == len(sequence) - strip:
- * qualities = line[:strip]
- */
case 3:
- /* "cutadapt/_seqio.pyx":131
- * name2 = ''
- * elif i == 3:
- * if len(line) == len(sequence) - strip: # <<<<<<<<<<<<<<
- * qualities = line[:strip]
- * else:
- */
- __pyx_t_14 = PyObject_Length(__pyx_cur_scope->__pyx_v_line); if (unlikely(__pyx_t_14 == -1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 131; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- if (unlikely(!__pyx_cur_scope->__pyx_v_sequence)) { __Pyx_RaiseUnboundLocalError("sequence"); {__pyx_filename = __pyx_f[0]; __pyx_lineno = 131; __pyx_clineno = __LINE__; goto __pyx_L1_error;} }
- __pyx_t_16 = PyObject_Length(__pyx_cur_scope->__pyx_v_sequence); if (unlikely(__pyx_t_16 == -1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 131; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_14 = PyObject_Length(__pyx_cur_scope->__pyx_v_line); if (unlikely(__pyx_t_14 == -1)) __PYX_ERR(0, 131, __pyx_L1_error)
+ if (unlikely(!__pyx_cur_scope->__pyx_v_sequence)) { __Pyx_RaiseUnboundLocalError("sequence"); __PYX_ERR(0, 131, __pyx_L1_error) }
+ __pyx_t_16 = PyObject_Length(__pyx_cur_scope->__pyx_v_sequence); if (unlikely(__pyx_t_16 == -1)) __PYX_ERR(0, 131, __pyx_L1_error)
__pyx_t_4 = ((__pyx_t_14 == (__pyx_t_16 - __pyx_cur_scope->__pyx_v_strip)) != 0);
if (__pyx_t_4) {
- /* "cutadapt/_seqio.pyx":132
- * elif i == 3:
- * if len(line) == len(sequence) - strip:
- * qualities = line[:strip] # <<<<<<<<<<<<<<
- * else:
- * qualities = line.rstrip('\r\n')
- */
if (unlikely(__pyx_cur_scope->__pyx_v_line == Py_None)) {
PyErr_SetString(PyExc_TypeError, "'NoneType' object is not subscriptable");
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 132; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __PYX_ERR(0, 132, __pyx_L1_error)
}
- __pyx_t_1 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, __pyx_cur_scope->__pyx_v_strip); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 132; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PySequence_GetSlice(__pyx_cur_scope->__pyx_v_line, 0, __pyx_cur_scope->__pyx_v_strip); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 132, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_XGOTREF(__pyx_cur_scope->__pyx_v_qualities);
__Pyx_XDECREF_SET(__pyx_cur_scope->__pyx_v_qualities, ((PyObject*)__pyx_t_1));
__Pyx_GIVEREF(__pyx_t_1);
__pyx_t_1 = 0;
- /* "cutadapt/_seqio.pyx":131
- * name2 = ''
- * elif i == 3:
- * if len(line) == len(sequence) - strip: # <<<<<<<<<<<<<<
- * qualities = line[:strip]
- * else:
- */
goto __pyx_L18;
}
- /* "cutadapt/_seqio.pyx":134
- * qualities = line[:strip]
- * else:
- * qualities = line.rstrip('\r\n') # <<<<<<<<<<<<<<
- * yield sequence_class(name, sequence, qualities, name2=name2)
- * i = (i + 1) % 4
- */
/*else*/ {
- __pyx_t_1 = __Pyx_PyObject_GetAttrStr(__pyx_cur_scope->__pyx_v_line, __pyx_n_s_rstrip); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 134; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_PyObject_GetAttrStr(__pyx_cur_scope->__pyx_v_line, __pyx_n_s_rstrip); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 134, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
- __pyx_t_11 = __Pyx_PyObject_Call(__pyx_t_1, __pyx_tuple__6, NULL); if (unlikely(!__pyx_t_11)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 134; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_11 = __Pyx_PyObject_Call(__pyx_t_1, __pyx_tuple__6, NULL); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 134, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_11);
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
- if (!(likely(PyString_CheckExact(__pyx_t_11))||((__pyx_t_11) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_t_11)->tp_name), 0))) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 134; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (!(likely(PyString_CheckExact(__pyx_t_11))||((__pyx_t_11) == Py_None)||(PyErr_Format(PyExc_TypeError, "Expected %.16s, got %.200s", "str", Py_TYPE(__pyx_t_11)->tp_name), 0))) __PYX_ERR(0, 134, __pyx_L1_error)
__Pyx_XGOTREF(__pyx_cur_scope->__pyx_v_qualities);
__Pyx_XDECREF_SET(__pyx_cur_scope->__pyx_v_qualities, ((PyObject*)__pyx_t_11));
__Pyx_GIVEREF(__pyx_t_11);
@@ -3972,15 +3269,8 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
}
__pyx_L18:;
- /* "cutadapt/_seqio.pyx":135
- * else:
- * qualities = line.rstrip('\r\n')
- * yield sequence_class(name, sequence, qualities, name2=name2) # <<<<<<<<<<<<<<
- * i = (i + 1) % 4
- * if i != 0:
- */
- if (unlikely(!__pyx_cur_scope->__pyx_v_sequence)) { __Pyx_RaiseUnboundLocalError("sequence"); {__pyx_filename = __pyx_f[0]; __pyx_lineno = 135; __pyx_clineno = __LINE__; goto __pyx_L1_error;} }
- __pyx_t_11 = PyTuple_New(3); if (unlikely(!__pyx_t_11)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 135; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (unlikely(!__pyx_cur_scope->__pyx_v_sequence)) { __Pyx_RaiseUnboundLocalError("sequence"); __PYX_ERR(0, 135, __pyx_L1_error) }
+ __pyx_t_11 = PyTuple_New(3); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 135, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_11);
__Pyx_INCREF(__pyx_cur_scope->__pyx_v_name);
__Pyx_GIVEREF(__pyx_cur_scope->__pyx_v_name);
@@ -3991,11 +3281,13 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
__Pyx_INCREF(__pyx_cur_scope->__pyx_v_qualities);
__Pyx_GIVEREF(__pyx_cur_scope->__pyx_v_qualities);
PyTuple_SET_ITEM(__pyx_t_11, 2, __pyx_cur_scope->__pyx_v_qualities);
- __pyx_t_1 = PyDict_New(); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 135; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PyDict_New(); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 135, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
- if (unlikely(!__pyx_cur_scope->__pyx_v_name2)) { __Pyx_RaiseUnboundLocalError("name2"); {__pyx_filename = __pyx_f[0]; __pyx_lineno = 135; __pyx_clineno = __LINE__; goto __pyx_L1_error;} }
- if (PyDict_SetItem(__pyx_t_1, __pyx_n_s_name2, __pyx_cur_scope->__pyx_v_name2) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 135; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __pyx_t_8 = __Pyx_PyObject_Call(__pyx_cur_scope->__pyx_v_sequence_class, __pyx_t_11, __pyx_t_1); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 135; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_8 = __Pyx_PyBool_FromLong(__pyx_cur_scope->__pyx_v_second_header); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 135, __pyx_L1_error)
+ __Pyx_GOTREF(__pyx_t_8);
+ if (PyDict_SetItem(__pyx_t_1, __pyx_n_s_second_header, __pyx_t_8) < 0) __PYX_ERR(0, 135, __pyx_L1_error)
+ __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
+ __pyx_t_8 = __Pyx_PyObject_Call(__pyx_cur_scope->__pyx_v_sequence_class, __pyx_t_11, __pyx_t_1); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 135, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_8);
__Pyx_DECREF(__pyx_t_11); __pyx_t_11 = 0;
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
@@ -4016,76 +3308,31 @@ static PyObject *__pyx_gb_8cutadapt_6_seqio_11FastqReader_4generator(__pyx_Corou
__Pyx_XGOTREF(__pyx_t_2);
__pyx_t_10 = __pyx_cur_scope->__pyx_t_1;
__pyx_t_13 = __pyx_cur_scope->__pyx_t_2;
- if (unlikely(!__pyx_sent_value)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 135; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
-
- /* "cutadapt/_seqio.pyx":130
- * else:
- * name2 = ''
- * elif i == 3: # <<<<<<<<<<<<<<
- * if len(line) == len(sequence) - strip:
- * qualities = line[:strip]
- */
+ if (unlikely(!__pyx_sent_value)) __PYX_ERR(0, 135, __pyx_L1_error)
+
break;
default: break;
}
- /* "cutadapt/_seqio.pyx":136
- * qualities = line.rstrip('\r\n')
- * yield sequence_class(name, sequence, qualities, name2=name2)
- * i = (i + 1) % 4 # <<<<<<<<<<<<<<
- * if i != 0:
- * raise FormatError("FASTQ file ended prematurely")
- */
__pyx_cur_scope->__pyx_v_i = __Pyx_mod_long((__pyx_cur_scope->__pyx_v_i + 1), 4);
- /* "cutadapt/_seqio.pyx":105
- *
- * i = 1
- * for line in it: # <<<<<<<<<<<<<<
- * if i == 0:
- * if not (line and line[0] == '@'):
- */
}
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
- /* "cutadapt/_seqio.pyx":137
- * yield sequence_class(name, sequence, qualities, name2=name2)
- * i = (i + 1) % 4
- * if i != 0: # <<<<<<<<<<<<<<
- * raise FormatError("FASTQ file ended prematurely")
- */
__pyx_t_4 = ((__pyx_cur_scope->__pyx_v_i != 0) != 0);
if (__pyx_t_4) {
- /* "cutadapt/_seqio.pyx":138
- * i = (i + 1) % 4
- * if i != 0:
- * raise FormatError("FASTQ file ended prematurely") # <<<<<<<<<<<<<<
- */
- __pyx_t_2 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 138; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_GetModuleGlobalName(__pyx_n_s_FormatError); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 138, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
- __pyx_t_8 = __Pyx_PyObject_Call(__pyx_t_2, __pyx_tuple__7, NULL); if (unlikely(!__pyx_t_8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 138; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_8 = __Pyx_PyObject_Call(__pyx_t_2, __pyx_tuple__7, NULL); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 138, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_8);
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
__Pyx_Raise(__pyx_t_8, 0, 0, 0);
__Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
- {__pyx_filename = __pyx_f[0]; __pyx_lineno = 138; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
-
- /* "cutadapt/_seqio.pyx":137
- * yield sequence_class(name, sequence, qualities, name2=name2)
- * i = (i + 1) % 4
- * if i != 0: # <<<<<<<<<<<<<<
- * raise FormatError("FASTQ file ended prematurely")
- */
+ __PYX_ERR(0, 138, __pyx_L1_error)
+
}
- /* "cutadapt/_seqio.pyx":88
- * self.delivers_qualities = True
- *
- * def __iter__(self): # <<<<<<<<<<<<<<
- * """
- * Yield Sequence objects
- */
/* function exit code */
PyErr_SetNone(PyExc_StopIteration);
@@ -4122,7 +3369,6 @@ static PyObject *__pyx_tp_new_8cutadapt_6_seqio_Sequence(PyTypeObject *t, CYTHON
p->name = ((PyObject*)Py_None); Py_INCREF(Py_None);
p->sequence = ((PyObject*)Py_None); Py_INCREF(Py_None);
p->qualities = ((PyObject*)Py_None); Py_INCREF(Py_None);
- p->name2 = ((PyObject*)Py_None); Py_INCREF(Py_None);
p->match = Py_None; Py_INCREF(Py_None);
p->match_info = Py_None; Py_INCREF(Py_None);
return o;
@@ -4139,7 +3385,6 @@ static void __pyx_tp_dealloc_8cutadapt_6_seqio_Sequence(PyObject *o) {
Py_CLEAR(p->name);
Py_CLEAR(p->sequence);
Py_CLEAR(p->qualities);
- Py_CLEAR(p->name2);
Py_CLEAR(p->match);
Py_CLEAR(p->match_info);
(*Py_TYPE(o)->tp_free)(o);
@@ -4215,16 +3460,17 @@ static int __pyx_setprop_8cutadapt_6_seqio_8Sequence_qualities(PyObject *o, PyOb
}
}
-static PyObject *__pyx_getprop_8cutadapt_6_seqio_8Sequence_name2(PyObject *o, CYTHON_UNUSED void *x) {
- return __pyx_pw_8cutadapt_6_seqio_8Sequence_5name2_1__get__(o);
+static PyObject *__pyx_getprop_8cutadapt_6_seqio_8Sequence_second_header(PyObject *o, CYTHON_UNUSED void *x) {
+ return __pyx_pw_8cutadapt_6_seqio_8Sequence_13second_header_1__get__(o);
}
-static int __pyx_setprop_8cutadapt_6_seqio_8Sequence_name2(PyObject *o, PyObject *v, CYTHON_UNUSED void *x) {
+static int __pyx_setprop_8cutadapt_6_seqio_8Sequence_second_header(PyObject *o, PyObject *v, CYTHON_UNUSED void *x) {
if (v) {
- return __pyx_pw_8cutadapt_6_seqio_8Sequence_5name2_3__set__(o, v);
+ return __pyx_pw_8cutadapt_6_seqio_8Sequence_13second_header_3__set__(o, v);
}
else {
- return __pyx_pw_8cutadapt_6_seqio_8Sequence_5name2_5__del__(o);
+ PyErr_SetString(PyExc_NotImplementedError, "__del__");
+ return -1;
}
}
@@ -4260,12 +3506,12 @@ static PyMethodDef __pyx_methods_8cutadapt_6_seqio_Sequence[] = {
};
static struct PyGetSetDef __pyx_getsets_8cutadapt_6_seqio_Sequence[] = {
- {(char *)"name", __pyx_getprop_8cutadapt_6_seqio_8Sequence_name, __pyx_setprop_8cutadapt_6_seqio_8Sequence_name, 0, 0},
- {(char *)"sequence", __pyx_getprop_8cutadapt_6_seqio_8Sequence_sequence, __pyx_setprop_8cutadapt_6_seqio_8Sequence_sequence, 0, 0},
- {(char *)"qualities", __pyx_getprop_8cutadapt_6_seqio_8Sequence_qualities, __pyx_setprop_8cutadapt_6_seqio_8Sequence_qualities, 0, 0},
- {(char *)"name2", __pyx_getprop_8cutadapt_6_seqio_8Sequence_name2, __pyx_setprop_8cutadapt_6_seqio_8Sequence_name2, 0, 0},
- {(char *)"match", __pyx_getprop_8cutadapt_6_seqio_8Sequence_match, __pyx_setprop_8cutadapt_6_seqio_8Sequence_match, 0, 0},
- {(char *)"match_info", __pyx_getprop_8cutadapt_6_seqio_8Sequence_match_info, __pyx_setprop_8cutadapt_6_seqio_8Sequence_match_info, 0, 0},
+ {(char *)"name", __pyx_getprop_8cutadapt_6_seqio_8Sequence_name, __pyx_setprop_8cutadapt_6_seqio_8Sequence_name, (char *)0, 0},
+ {(char *)"sequence", __pyx_getprop_8cutadapt_6_seqio_8Sequence_sequence, __pyx_setprop_8cutadapt_6_seqio_8Sequence_sequence, (char *)0, 0},
+ {(char *)"qualities", __pyx_getprop_8cutadapt_6_seqio_8Sequence_qualities, __pyx_setprop_8cutadapt_6_seqio_8Sequence_qualities, (char *)0, 0},
+ {(char *)"second_header", __pyx_getprop_8cutadapt_6_seqio_8Sequence_second_header, __pyx_setprop_8cutadapt_6_seqio_8Sequence_second_header, (char *)0, 0},
+ {(char *)"match", __pyx_getprop_8cutadapt_6_seqio_8Sequence_match, __pyx_setprop_8cutadapt_6_seqio_8Sequence_match, (char *)0, 0},
+ {(char *)"match_info", __pyx_getprop_8cutadapt_6_seqio_8Sequence_match_info, __pyx_setprop_8cutadapt_6_seqio_8Sequence_match_info, (char *)0, 0},
{0, 0, 0, 0, 0}
};
@@ -4545,6 +3791,7 @@ static __Pyx_StringTabEntry __pyx_string_tab[] = {
{&__pyx_kp_s_qualities_0_r, __pyx_k_qualities_0_r, sizeof(__pyx_k_qualities_0_r), 0, 0, 1, 0},
{&__pyx_n_s_qualname, __pyx_k_qualname, sizeof(__pyx_k_qualname), 0, 0, 1, 1},
{&__pyx_n_s_rstrip, __pyx_k_rstrip, sizeof(__pyx_k_rstrip), 0, 0, 1, 1},
+ {&__pyx_n_s_second_header, __pyx_k_second_header, sizeof(__pyx_k_second_header), 0, 0, 1, 1},
{&__pyx_n_s_self, __pyx_k_self, sizeof(__pyx_k_self), 0, 0, 1, 1},
{&__pyx_n_s_send, __pyx_k_send, sizeof(__pyx_k_send), 0, 0, 1, 1},
{&__pyx_n_s_seqio, __pyx_k_seqio, sizeof(__pyx_k_seqio), 0, 0, 1, 1},
@@ -4559,8 +3806,8 @@ static __Pyx_StringTabEntry __pyx_string_tab[] = {
{0, 0, 0, 0, 0, 0, 0}
};
static int __Pyx_InitCachedBuiltins(void) {
- __pyx_builtin_NotImplementedError = __Pyx_GetBuiltinName(__pyx_n_s_NotImplementedError); if (!__pyx_builtin_NotImplementedError) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 69; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __pyx_builtin_super = __Pyx_GetBuiltinName(__pyx_n_s_super); if (!__pyx_builtin_super) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 84; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_builtin_NotImplementedError = __Pyx_GetBuiltinName(__pyx_n_s_NotImplementedError); if (!__pyx_builtin_NotImplementedError) __PYX_ERR(0, 69, __pyx_L1_error)
+ __pyx_builtin_super = __Pyx_GetBuiltinName(__pyx_n_s_super); if (!__pyx_builtin_super) __PYX_ERR(0, 84, __pyx_L1_error)
return 0;
__pyx_L1_error:;
return -1;
@@ -4570,49 +3817,23 @@ static int __Pyx_InitCachedConstants(void) {
__Pyx_RefNannyDeclarations
__Pyx_RefNannySetupContext("__Pyx_InitCachedConstants", 0);
- /* "cutadapt/_seqio.pyx":134
- * qualities = line[:strip]
- * else:
- * qualities = line.rstrip('\r\n') # <<<<<<<<<<<<<<
- * yield sequence_class(name, sequence, qualities, name2=name2)
- * i = (i + 1) % 4
- */
- __pyx_tuple__6 = PyTuple_Pack(1, __pyx_kp_s__3); if (unlikely(!__pyx_tuple__6)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 134; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_tuple__6 = PyTuple_Pack(1, __pyx_kp_s__3); if (unlikely(!__pyx_tuple__6)) __PYX_ERR(0, 134, __pyx_L1_error)
__Pyx_GOTREF(__pyx_tuple__6);
__Pyx_GIVEREF(__pyx_tuple__6);
- /* "cutadapt/_seqio.pyx":138
- * i = (i + 1) % 4
- * if i != 0:
- * raise FormatError("FASTQ file ended prematurely") # <<<<<<<<<<<<<<
- */
- __pyx_tuple__7 = PyTuple_Pack(1, __pyx_kp_s_FASTQ_file_ended_prematurely); if (unlikely(!__pyx_tuple__7)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 138; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_tuple__7 = PyTuple_Pack(1, __pyx_kp_s_FASTQ_file_ended_prematurely); if (unlikely(!__pyx_tuple__7)) __PYX_ERR(0, 138, __pyx_L1_error)
__Pyx_GOTREF(__pyx_tuple__7);
__Pyx_GIVEREF(__pyx_tuple__7);
- /* "cutadapt/_seqio.pyx":79
- * Reader for FASTQ files. Does not support multi-line FASTQ files.
- * """
- * def __init__(self, file, sequence_class=Sequence): # <<<<<<<<<<<<<<
- * """
- * file is a filename or a file-like object.
- */
- __pyx_tuple__8 = PyTuple_Pack(3, __pyx_n_s_self, __pyx_n_s_file, __pyx_n_s_sequence_class); if (unlikely(!__pyx_tuple__8)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 79; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_tuple__8 = PyTuple_Pack(3, __pyx_n_s_self, __pyx_n_s_file, __pyx_n_s_sequence_class); if (unlikely(!__pyx_tuple__8)) __PYX_ERR(0, 79, __pyx_L1_error)
__Pyx_GOTREF(__pyx_tuple__8);
__Pyx_GIVEREF(__pyx_tuple__8);
- __pyx_codeobj__9 = (PyObject*)__Pyx_PyCode_New(3, 0, 3, 0, 0, __pyx_empty_bytes, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_tuple__8, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_kp_s_home_marcel_scm_cutadapt_cutada, __pyx_n_s_init, 79, __pyx_empty_bytes); if (unlikely(!__pyx_codeobj__9)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 79; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
-
- /* "cutadapt/_seqio.pyx":88
- * self.delivers_qualities = True
- *
- * def __iter__(self): # <<<<<<<<<<<<<<
- * """
- * Yield Sequence objects
- */
- __pyx_tuple__10 = PyTuple_Pack(10, __pyx_n_s_self, __pyx_n_s_i, __pyx_n_s_strip, __pyx_n_s_line, __pyx_n_s_name, __pyx_n_s_qualities, __pyx_n_s_sequence, __pyx_n_s_name2, __pyx_n_s_sequence_class, __pyx_n_s_it); if (unlikely(!__pyx_tuple__10)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 88; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_codeobj__9 = (PyObject*)__Pyx_PyCode_New(3, 0, 3, 0, 0, __pyx_empty_bytes, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_tuple__8, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_kp_s_home_marcel_scm_cutadapt_cutada, __pyx_n_s_init, 79, __pyx_empty_bytes); if (unlikely(!__pyx_codeobj__9)) __PYX_ERR(0, 79, __pyx_L1_error)
+
+ __pyx_tuple__10 = PyTuple_Pack(11, __pyx_n_s_self, __pyx_n_s_i, __pyx_n_s_strip, __pyx_n_s_line, __pyx_n_s_name, __pyx_n_s_qualities, __pyx_n_s_sequence, __pyx_n_s_name2, __pyx_n_s_sequence_class, __pyx_n_s_it, __pyx_n_s_second_header); if (unlikely(!__pyx_tuple__10)) __PYX_ERR(0, 88, __pyx_L1_error)
__Pyx_GOTREF(__pyx_tuple__10);
__Pyx_GIVEREF(__pyx_tuple__10);
- __pyx_codeobj__11 = (PyObject*)__Pyx_PyCode_New(1, 0, 10, 0, 0, __pyx_empty_bytes, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_tuple__10, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_kp_s_home_marcel_scm_cutadapt_cutada, __pyx_n_s_iter, 88, __pyx_empty_bytes); if (unlikely(!__pyx_codeobj__11)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 88; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_codeobj__11 = (PyObject*)__Pyx_PyCode_New(1, 0, 11, 0, 0, __pyx_empty_bytes, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_tuple__10, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_kp_s_home_marcel_scm_cutadapt_cutada, __pyx_n_s_iter, 88, __pyx_empty_bytes); if (unlikely(!__pyx_codeobj__11)) __PYX_ERR(0, 88, __pyx_L1_error)
__Pyx_RefNannyFinishContext();
return 0;
__pyx_L1_error:;
@@ -4621,7 +3842,7 @@ static int __Pyx_InitCachedConstants(void) {
}
static int __Pyx_InitGlobals(void) {
- if (__Pyx_InitStrings(__pyx_string_tab) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;};
+ if (__Pyx_InitStrings(__pyx_string_tab) < 0) __PYX_ERR(0, 1, __pyx_L1_error);
return 0;
__pyx_L1_error:;
return -1;
@@ -4639,9 +3860,6 @@ PyMODINIT_FUNC PyInit__seqio(void)
PyObject *__pyx_t_2 = NULL;
PyObject *__pyx_t_3 = NULL;
PyObject *__pyx_t_4 = NULL;
- int __pyx_lineno = 0;
- const char *__pyx_filename = NULL;
- int __pyx_clineno = 0;
__Pyx_RefNannyDeclarations
#if CYTHON_REFNANNY
__Pyx_RefNanny = __Pyx_RefNannyImportAPI("refnanny");
@@ -4653,23 +3871,24 @@ PyMODINIT_FUNC PyInit__seqio(void)
}
#endif
__Pyx_RefNannySetupContext("PyMODINIT_FUNC PyInit__seqio(void)", 0);
- if (__Pyx_check_binary_version() < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __pyx_empty_tuple = PyTuple_New(0); if (unlikely(!__pyx_empty_tuple)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __pyx_empty_bytes = PyBytes_FromStringAndSize("", 0); if (unlikely(!__pyx_empty_bytes)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (__Pyx_check_binary_version() < 0) __PYX_ERR(0, 1, __pyx_L1_error)
+ __pyx_empty_tuple = PyTuple_New(0); if (unlikely(!__pyx_empty_tuple)) __PYX_ERR(0, 1, __pyx_L1_error)
+ __pyx_empty_bytes = PyBytes_FromStringAndSize("", 0); if (unlikely(!__pyx_empty_bytes)) __PYX_ERR(0, 1, __pyx_L1_error)
+ __pyx_empty_unicode = PyUnicode_FromStringAndSize("", 0); if (unlikely(!__pyx_empty_unicode)) __PYX_ERR(0, 1, __pyx_L1_error)
#ifdef __Pyx_CyFunction_USED
- if (__pyx_CyFunction_init() < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (__pyx_CyFunction_init() < 0) __PYX_ERR(0, 1, __pyx_L1_error)
#endif
#ifdef __Pyx_FusedFunction_USED
- if (__pyx_FusedFunction_init() < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (__pyx_FusedFunction_init() < 0) __PYX_ERR(0, 1, __pyx_L1_error)
#endif
#ifdef __Pyx_Coroutine_USED
- if (__pyx_Coroutine_init() < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (__pyx_Coroutine_init() < 0) __PYX_ERR(0, 1, __pyx_L1_error)
#endif
#ifdef __Pyx_Generator_USED
- if (__pyx_Generator_init() < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (__pyx_Generator_init() < 0) __PYX_ERR(0, 1, __pyx_L1_error)
#endif
#ifdef __Pyx_StopAsyncIteration_USED
- if (__pyx_StopAsyncIteration_init() < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (__pyx_StopAsyncIteration_init() < 0) __PYX_ERR(0, 1, __pyx_L1_error)
#endif
/*--- Library function declarations ---*/
/*--- Threads initialization code ---*/
@@ -4684,43 +3903,43 @@ PyMODINIT_FUNC PyInit__seqio(void)
#else
__pyx_m = PyModule_Create(&__pyx_moduledef);
#endif
- if (unlikely(!__pyx_m)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
- __pyx_d = PyModule_GetDict(__pyx_m); if (unlikely(!__pyx_d)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (unlikely(!__pyx_m)) __PYX_ERR(0, 1, __pyx_L1_error)
+ __pyx_d = PyModule_GetDict(__pyx_m); if (unlikely(!__pyx_d)) __PYX_ERR(0, 1, __pyx_L1_error)
Py_INCREF(__pyx_d);
- __pyx_b = PyImport_AddModule(__Pyx_BUILTIN_MODULE_NAME); if (unlikely(!__pyx_b)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_b = PyImport_AddModule(__Pyx_BUILTIN_MODULE_NAME); if (unlikely(!__pyx_b)) __PYX_ERR(0, 1, __pyx_L1_error)
#if CYTHON_COMPILING_IN_PYPY
Py_INCREF(__pyx_b);
#endif
- if (PyObject_SetAttrString(__pyx_m, "__builtins__", __pyx_b) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;};
+ if (PyObject_SetAttrString(__pyx_m, "__builtins__", __pyx_b) < 0) __PYX_ERR(0, 1, __pyx_L1_error);
/*--- Initialize various global constants etc. ---*/
- if (__Pyx_InitGlobals() < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (__Pyx_InitGlobals() < 0) __PYX_ERR(0, 1, __pyx_L1_error)
#if PY_MAJOR_VERSION < 3 && (__PYX_DEFAULT_STRING_ENCODING_IS_ASCII || __PYX_DEFAULT_STRING_ENCODING_IS_DEFAULT)
- if (__Pyx_init_sys_getdefaultencoding_params() < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (__Pyx_init_sys_getdefaultencoding_params() < 0) __PYX_ERR(0, 1, __pyx_L1_error)
#endif
if (__pyx_module_is_main_cutadapt___seqio) {
- if (PyObject_SetAttrString(__pyx_m, "__name__", __pyx_n_s_main) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyObject_SetAttrString(__pyx_m, "__name__", __pyx_n_s_main) < 0) __PYX_ERR(0, 1, __pyx_L1_error)
}
#if PY_MAJOR_VERSION >= 3
{
- PyObject *modules = PyImport_GetModuleDict(); if (unlikely(!modules)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ PyObject *modules = PyImport_GetModuleDict(); if (unlikely(!modules)) __PYX_ERR(0, 1, __pyx_L1_error)
if (!PyDict_GetItemString(modules, "cutadapt._seqio")) {
- if (unlikely(PyDict_SetItemString(modules, "cutadapt._seqio", __pyx_m) < 0)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (unlikely(PyDict_SetItemString(modules, "cutadapt._seqio", __pyx_m) < 0)) __PYX_ERR(0, 1, __pyx_L1_error)
}
}
#endif
/*--- Builtin init code ---*/
- if (__Pyx_InitCachedBuiltins() < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (__Pyx_InitCachedBuiltins() < 0) __PYX_ERR(0, 1, __pyx_L1_error)
/*--- Constants init code ---*/
- if (__Pyx_InitCachedConstants() < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (__Pyx_InitCachedConstants() < 0) __PYX_ERR(0, 1, __pyx_L1_error)
/*--- Global init code ---*/
/*--- Variable export code ---*/
/*--- Function export code ---*/
/*--- Type init code ---*/
- if (PyType_Ready(&__pyx_type_8cutadapt_6_seqio_Sequence) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 8; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyType_Ready(&__pyx_type_8cutadapt_6_seqio_Sequence) < 0) __PYX_ERR(0, 8, __pyx_L1_error)
__pyx_type_8cutadapt_6_seqio_Sequence.tp_print = 0;
#if CYTHON_COMPILING_IN_CPYTHON
{
- PyObject *wrapper = PyObject_GetAttrString((PyObject *)&__pyx_type_8cutadapt_6_seqio_Sequence, "__init__"); if (unlikely(!wrapper)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 8; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ PyObject *wrapper = PyObject_GetAttrString((PyObject *)&__pyx_type_8cutadapt_6_seqio_Sequence, "__init__"); if (unlikely(!wrapper)) __PYX_ERR(0, 8, __pyx_L1_error)
if (Py_TYPE(wrapper) == &PyWrapperDescr_Type) {
__pyx_wrapperbase_8cutadapt_6_seqio_8Sequence___init__ = *((PyWrapperDescrObject *)wrapper)->d_base;
__pyx_wrapperbase_8cutadapt_6_seqio_8Sequence___init__.doc = __pyx_doc_8cutadapt_6_seqio_8Sequence___init__;
@@ -4730,7 +3949,7 @@ PyMODINIT_FUNC PyInit__seqio(void)
#endif
#if CYTHON_COMPILING_IN_CPYTHON
{
- PyObject *wrapper = PyObject_GetAttrString((PyObject *)&__pyx_type_8cutadapt_6_seqio_Sequence, "__getitem__"); if (unlikely(!wrapper)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 8; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ PyObject *wrapper = PyObject_GetAttrString((PyObject *)&__pyx_type_8cutadapt_6_seqio_Sequence, "__getitem__"); if (unlikely(!wrapper)) __PYX_ERR(0, 8, __pyx_L1_error)
if (Py_TYPE(wrapper) == &PyWrapperDescr_Type) {
__pyx_wrapperbase_8cutadapt_6_seqio_8Sequence_2__getitem__ = *((PyWrapperDescrObject *)wrapper)->d_base;
__pyx_wrapperbase_8cutadapt_6_seqio_8Sequence_2__getitem__.doc = __pyx_doc_8cutadapt_6_seqio_8Sequence_2__getitem__;
@@ -4738,9 +3957,9 @@ PyMODINIT_FUNC PyInit__seqio(void)
}
}
#endif
- if (PyObject_SetAttrString(__pyx_m, "Sequence", (PyObject *)&__pyx_type_8cutadapt_6_seqio_Sequence) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 8; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyObject_SetAttrString(__pyx_m, "Sequence", (PyObject *)&__pyx_type_8cutadapt_6_seqio_Sequence) < 0) __PYX_ERR(0, 8, __pyx_L1_error)
__pyx_ptype_8cutadapt_6_seqio_Sequence = &__pyx_type_8cutadapt_6_seqio_Sequence;
- if (PyType_Ready(&__pyx_type_8cutadapt_6_seqio___pyx_scope_struct____iter__) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 88; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyType_Ready(&__pyx_type_8cutadapt_6_seqio___pyx_scope_struct____iter__) < 0) __PYX_ERR(0, 88, __pyx_L1_error)
__pyx_type_8cutadapt_6_seqio___pyx_scope_struct____iter__.tp_print = 0;
__pyx_ptype_8cutadapt_6_seqio___pyx_scope_struct____iter__ = &__pyx_type_8cutadapt_6_seqio___pyx_scope_struct____iter__;
/*--- Type import code ---*/
@@ -4748,38 +3967,24 @@ PyMODINIT_FUNC PyInit__seqio(void)
/*--- Function import code ---*/
/*--- Execution code ---*/
#if defined(__Pyx_Generator_USED) || defined(__Pyx_Coroutine_USED)
- if (__Pyx_patch_abc() < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (__Pyx_patch_abc() < 0) __PYX_ERR(0, 1, __pyx_L1_error)
#endif
- /* "cutadapt/_seqio.pyx":4
- * # cython: profile=False, emit_code_comments=False
- * from __future__ import print_function, division, absolute_import
- * from .xopen import xopen # <<<<<<<<<<<<<<
- * from .seqio import _shorten, FormatError, SequenceReader
- *
- */
- __pyx_t_1 = PyList_New(1); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 4; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = PyList_New(1); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 4, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_INCREF(__pyx_n_s_xopen);
__Pyx_GIVEREF(__pyx_n_s_xopen);
PyList_SET_ITEM(__pyx_t_1, 0, __pyx_n_s_xopen);
- __pyx_t_2 = __Pyx_Import(__pyx_n_s_xopen, __pyx_t_1, 1); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 4; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_Import(__pyx_n_s_xopen, __pyx_t_1, 1); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 4, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
- __pyx_t_1 = __Pyx_ImportFrom(__pyx_t_2, __pyx_n_s_xopen); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 4; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_ImportFrom(__pyx_t_2, __pyx_n_s_xopen); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 4, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
- if (PyDict_SetItem(__pyx_d, __pyx_n_s_xopen, __pyx_t_1) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 4; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyDict_SetItem(__pyx_d, __pyx_n_s_xopen, __pyx_t_1) < 0) __PYX_ERR(0, 4, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
- /* "cutadapt/_seqio.pyx":5
- * from __future__ import print_function, division, absolute_import
- * from .xopen import xopen
- * from .seqio import _shorten, FormatError, SequenceReader # <<<<<<<<<<<<<<
- *
- *
- */
- __pyx_t_2 = PyList_New(3); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 5; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = PyList_New(3); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 5, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
__Pyx_INCREF(__pyx_n_s_shorten);
__Pyx_GIVEREF(__pyx_n_s_shorten);
@@ -4790,94 +3995,61 @@ PyMODINIT_FUNC PyInit__seqio(void)
__Pyx_INCREF(__pyx_n_s_SequenceReader);
__Pyx_GIVEREF(__pyx_n_s_SequenceReader);
PyList_SET_ITEM(__pyx_t_2, 2, __pyx_n_s_SequenceReader);
- __pyx_t_1 = __Pyx_Import(__pyx_n_s_seqio, __pyx_t_2, 1); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 5; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_Import(__pyx_n_s_seqio, __pyx_t_2, 1); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 5, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
- __pyx_t_2 = __Pyx_ImportFrom(__pyx_t_1, __pyx_n_s_shorten); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 5; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_ImportFrom(__pyx_t_1, __pyx_n_s_shorten); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 5, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
- if (PyDict_SetItem(__pyx_d, __pyx_n_s_shorten, __pyx_t_2) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 5; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyDict_SetItem(__pyx_d, __pyx_n_s_shorten, __pyx_t_2) < 0) __PYX_ERR(0, 5, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
- __pyx_t_2 = __Pyx_ImportFrom(__pyx_t_1, __pyx_n_s_FormatError); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 5; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_ImportFrom(__pyx_t_1, __pyx_n_s_FormatError); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 5, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
- if (PyDict_SetItem(__pyx_d, __pyx_n_s_FormatError, __pyx_t_2) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 5; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyDict_SetItem(__pyx_d, __pyx_n_s_FormatError, __pyx_t_2) < 0) __PYX_ERR(0, 5, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
- __pyx_t_2 = __Pyx_ImportFrom(__pyx_t_1, __pyx_n_s_SequenceReader); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 5; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = __Pyx_ImportFrom(__pyx_t_1, __pyx_n_s_SequenceReader); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 5, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
- if (PyDict_SetItem(__pyx_d, __pyx_n_s_SequenceReader, __pyx_t_2) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 5; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyDict_SetItem(__pyx_d, __pyx_n_s_SequenceReader, __pyx_t_2) < 0) __PYX_ERR(0, 5, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
- /* "cutadapt/_seqio.pyx":75
- *
- *
- * class FastqReader(SequenceReader): # <<<<<<<<<<<<<<
- * """
- * Reader for FASTQ files. Does not support multi-line FASTQ files.
- */
- __pyx_t_1 = __Pyx_GetModuleGlobalName(__pyx_n_s_SequenceReader); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 75; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_GetModuleGlobalName(__pyx_n_s_SequenceReader); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 75, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
- __pyx_t_2 = PyTuple_New(1); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 75; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = PyTuple_New(1); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 75, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
__Pyx_GIVEREF(__pyx_t_1);
PyTuple_SET_ITEM(__pyx_t_2, 0, __pyx_t_1);
__pyx_t_1 = 0;
- __pyx_t_1 = __Pyx_CalculateMetaclass(NULL, __pyx_t_2); if (unlikely(!__pyx_t_1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 75; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_1 = __Pyx_CalculateMetaclass(NULL, __pyx_t_2); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 75, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_1);
- __pyx_t_3 = __Pyx_Py3MetaclassPrepare(__pyx_t_1, __pyx_t_2, __pyx_n_s_FastqReader, __pyx_n_s_FastqReader, (PyObject *) NULL, __pyx_n_s_cutadapt__seqio, __pyx_kp_s_Reader_for_FASTQ_files_Does_not); if (unlikely(!__pyx_t_3)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 75; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_3 = __Pyx_Py3MetaclassPrepare(__pyx_t_1, __pyx_t_2, __pyx_n_s_FastqReader, __pyx_n_s_FastqReader, (PyObject *) NULL, __pyx_n_s_cutadapt__seqio, __pyx_kp_s_Reader_for_FASTQ_files_Does_not); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 75, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_3);
- /* "cutadapt/_seqio.pyx":79
- * Reader for FASTQ files. Does not support multi-line FASTQ files.
- * """
- * def __init__(self, file, sequence_class=Sequence): # <<<<<<<<<<<<<<
- * """
- * file is a filename or a file-like object.
- */
- __pyx_t_4 = __Pyx_CyFunction_NewEx(&__pyx_mdef_8cutadapt_6_seqio_11FastqReader_1__init__, 0, __pyx_n_s_FastqReader___init, NULL, __pyx_n_s_cutadapt__seqio, __pyx_d, ((PyObject *)__pyx_codeobj__9)); if (unlikely(!__pyx_t_4)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 79; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = __Pyx_CyFunction_NewEx(&__pyx_mdef_8cutadapt_6_seqio_11FastqReader_1__init__, 0, __pyx_n_s_FastqReader___init, NULL, __pyx_n_s_cutadapt__seqio, __pyx_d, ((PyObject *)__pyx_codeobj__9)); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 79, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_4);
- if (!__Pyx_CyFunction_InitDefaults(__pyx_t_4, sizeof(__pyx_defaults), 1)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 79; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (!__Pyx_CyFunction_InitDefaults(__pyx_t_4, sizeof(__pyx_defaults), 1)) __PYX_ERR(0, 79, __pyx_L1_error)
__Pyx_INCREF(((PyObject *)__pyx_ptype_8cutadapt_6_seqio_Sequence));
__Pyx_CyFunction_Defaults(__pyx_defaults, __pyx_t_4)->__pyx_arg_sequence_class = ((PyObject *)__pyx_ptype_8cutadapt_6_seqio_Sequence);
__Pyx_GIVEREF(__pyx_ptype_8cutadapt_6_seqio_Sequence);
__Pyx_CyFunction_SetDefaultsGetter(__pyx_t_4, __pyx_pf_8cutadapt_6_seqio_11FastqReader_5__defaults__);
- if (PyObject_SetItem(__pyx_t_3, __pyx_n_s_init, __pyx_t_4) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 79; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyObject_SetItem(__pyx_t_3, __pyx_n_s_init, __pyx_t_4) < 0) __PYX_ERR(0, 79, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_4); __pyx_t_4 = 0;
- /* "cutadapt/_seqio.pyx":88
- * self.delivers_qualities = True
- *
- * def __iter__(self): # <<<<<<<<<<<<<<
- * """
- * Yield Sequence objects
- */
- __pyx_t_4 = __Pyx_CyFunction_NewEx(&__pyx_mdef_8cutadapt_6_seqio_11FastqReader_3__iter__, 0, __pyx_n_s_FastqReader___iter, NULL, __pyx_n_s_cutadapt__seqio, __pyx_d, ((PyObject *)__pyx_codeobj__11)); if (unlikely(!__pyx_t_4)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 88; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = __Pyx_CyFunction_NewEx(&__pyx_mdef_8cutadapt_6_seqio_11FastqReader_3__iter__, 0, __pyx_n_s_FastqReader___iter, NULL, __pyx_n_s_cutadapt__seqio, __pyx_d, ((PyObject *)__pyx_codeobj__11)); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 88, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_4);
- if (PyObject_SetItem(__pyx_t_3, __pyx_n_s_iter, __pyx_t_4) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 88; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyObject_SetItem(__pyx_t_3, __pyx_n_s_iter, __pyx_t_4) < 0) __PYX_ERR(0, 88, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_4); __pyx_t_4 = 0;
- /* "cutadapt/_seqio.pyx":75
- *
- *
- * class FastqReader(SequenceReader): # <<<<<<<<<<<<<<
- * """
- * Reader for FASTQ files. Does not support multi-line FASTQ files.
- */
- __pyx_t_4 = __Pyx_Py3ClassCreate(__pyx_t_1, __pyx_n_s_FastqReader, __pyx_t_2, __pyx_t_3, NULL, 0, 1); if (unlikely(!__pyx_t_4)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 75; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_4 = __Pyx_Py3ClassCreate(__pyx_t_1, __pyx_n_s_FastqReader, __pyx_t_2, __pyx_t_3, NULL, 0, 1); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 75, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_4);
- if (PyDict_SetItem(__pyx_d, __pyx_n_s_FastqReader, __pyx_t_4) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 75; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyDict_SetItem(__pyx_d, __pyx_n_s_FastqReader, __pyx_t_4) < 0) __PYX_ERR(0, 75, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_4); __pyx_t_4 = 0;
__Pyx_DECREF(__pyx_t_3); __pyx_t_3 = 0;
__Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
- /* "cutadapt/_seqio.pyx":1
- * # kate: syntax Python; # <<<<<<<<<<<<<<
- * # cython: profile=False, emit_code_comments=False
- * from __future__ import print_function, division, absolute_import
- */
- __pyx_t_2 = PyDict_New(); if (unlikely(!__pyx_t_2)) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ __pyx_t_2 = PyDict_New(); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 1, __pyx_L1_error)
__Pyx_GOTREF(__pyx_t_2);
- if (PyDict_SetItem(__pyx_d, __pyx_n_s_test, __pyx_t_2) < 0) {__pyx_filename = __pyx_f[0]; __pyx_lineno = 1; __pyx_clineno = __LINE__; goto __pyx_L1_error;}
+ if (PyDict_SetItem(__pyx_d, __pyx_n_s_test, __pyx_t_2) < 0) __PYX_ERR(0, 1, __pyx_L1_error)
__Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
/*--- Wrapped vars code ---*/
@@ -4906,6 +4078,7 @@ PyMODINIT_FUNC PyInit__seqio(void)
}
/* --- Runtime support code --- */
+/* Refnanny */
#if CYTHON_REFNANNY
static __Pyx_RefNannyAPIStruct *__Pyx_RefNannyImportAPI(const char *modname) {
PyObject *m = NULL, *p = NULL;
@@ -4922,6 +4095,7 @@ end:
}
#endif
+/* GetBuiltinName */
static PyObject *__Pyx_GetBuiltinName(PyObject *name) {
PyObject* result = __Pyx_PyObject_GetAttrStr(__pyx_b, name);
if (unlikely(!result)) {
@@ -4935,6 +4109,7 @@ static PyObject *__Pyx_GetBuiltinName(PyObject *name) {
return result;
}
+/* RaiseArgTupleInvalid */
static void __Pyx_RaiseArgtupleInvalid(
const char* func_name,
int exact,
@@ -4960,6 +4135,7 @@ static void __Pyx_RaiseArgtupleInvalid(
(num_expected == 1) ? "" : "s", num_found);
}
+/* RaiseDoubleKeywords */
static void __Pyx_RaiseDoubleKeywordsError(
const char* func_name,
PyObject* kw_name)
@@ -4973,6 +4149,7 @@ static void __Pyx_RaiseDoubleKeywordsError(
#endif
}
+/* ParseKeywords */
static int __Pyx_ParseOptionalKeywords(
PyObject *kwds,
PyObject **argnames[],
@@ -5074,6 +4251,7 @@ bad:
return -1;
}
+/* ArgTypeTest */
static void __Pyx_RaiseArgumentTypeInvalid(const char* name, PyObject *obj, PyTypeObject *type) {
PyErr_Format(PyExc_TypeError,
"Argument '%.200s' has incorrect type (expected %.200s, got %.200s)",
@@ -5100,6 +4278,7 @@ static CYTHON_INLINE int __Pyx_ArgTypeTest(PyObject *obj, PyTypeObject *type, in
return 0;
}
+/* GetModuleGlobalName */
static CYTHON_INLINE PyObject *__Pyx_GetModuleGlobalName(PyObject *name) {
PyObject *result;
#if CYTHON_COMPILING_IN_CPYTHON
@@ -5117,7 +4296,8 @@ static CYTHON_INLINE PyObject *__Pyx_GetModuleGlobalName(PyObject *name) {
return result;
}
-#if CYTHON_COMPILING_IN_CPYTHON
+/* PyObjectCall */
+ #if CYTHON_COMPILING_IN_CPYTHON
static CYTHON_INLINE PyObject* __Pyx_PyObject_Call(PyObject *func, PyObject *arg, PyObject *kw) {
PyObject *result;
ternaryfunc call = func->ob_type->tp_call;
@@ -5136,7 +4316,8 @@ static CYTHON_INLINE PyObject* __Pyx_PyObject_Call(PyObject *func, PyObject *arg
}
#endif
-#if CYTHON_COMPILING_IN_CPYTHON
+/* PyObjectCallMethO */
+ #if CYTHON_COMPILING_IN_CPYTHON
static CYTHON_INLINE PyObject* __Pyx_PyObject_CallMethO(PyObject *func, PyObject *arg) {
PyObject *self, *result;
PyCFunction cfunc;
@@ -5155,7 +4336,8 @@ static CYTHON_INLINE PyObject* __Pyx_PyObject_CallMethO(PyObject *func, PyObject
}
#endif
-#if CYTHON_COMPILING_IN_CPYTHON
+/* PyObjectCallOneArg */
+ #if CYTHON_COMPILING_IN_CPYTHON
static PyObject* __Pyx__PyObject_CallOneArg(PyObject *func, PyObject *arg) {
PyObject *result;
PyObject *args = PyTuple_New(1);
@@ -5189,10 +4371,10 @@ static CYTHON_INLINE PyObject* __Pyx_PyObject_CallOneArg(PyObject *func, PyObjec
}
#endif
-static CYTHON_INLINE void __Pyx_ErrRestore(PyObject *type, PyObject *value, PyObject *tb) {
-#if CYTHON_COMPILING_IN_CPYTHON
+/* PyErrFetchRestore */
+ #if CYTHON_COMPILING_IN_CPYTHON
+static CYTHON_INLINE void __Pyx_ErrRestoreInState(PyThreadState *tstate, PyObject *type, PyObject *value, PyObject *tb) {
PyObject *tmp_type, *tmp_value, *tmp_tb;
- PyThreadState *tstate = PyThreadState_GET();
tmp_type = tstate->curexc_type;
tmp_value = tstate->curexc_value;
tmp_tb = tstate->curexc_traceback;
@@ -5202,27 +4384,22 @@ static CYTHON_INLINE void __Pyx_ErrRestore(PyObject *type, PyObject *value, PyOb
Py_XDECREF(tmp_type);
Py_XDECREF(tmp_value);
Py_XDECREF(tmp_tb);
-#else
- PyErr_Restore(type, value, tb);
-#endif
}
-static CYTHON_INLINE void __Pyx_ErrFetch(PyObject **type, PyObject **value, PyObject **tb) {
-#if CYTHON_COMPILING_IN_CPYTHON
- PyThreadState *tstate = PyThreadState_GET();
+static CYTHON_INLINE void __Pyx_ErrFetchInState(PyThreadState *tstate, PyObject **type, PyObject **value, PyObject **tb) {
*type = tstate->curexc_type;
*value = tstate->curexc_value;
*tb = tstate->curexc_traceback;
tstate->curexc_type = 0;
tstate->curexc_value = 0;
tstate->curexc_traceback = 0;
-#else
- PyErr_Fetch(type, value, tb);
-#endif
}
+#endif
-#if PY_MAJOR_VERSION < 3
+/* RaiseException */
+ #if PY_MAJOR_VERSION < 3
static void __Pyx_Raise(PyObject *type, PyObject *value, PyObject *tb,
CYTHON_UNUSED PyObject *cause) {
+ __Pyx_PyThreadState_declare
Py_XINCREF(type);
if (!value || value == Py_None)
value = NULL;
@@ -5261,6 +4438,7 @@ static void __Pyx_Raise(PyObject *type, PyObject *value, PyObject *tb,
goto raise_error;
}
}
+ __Pyx_PyThreadState_assign
__Pyx_ErrRestore(type, value, tb);
return;
raise_error:
@@ -5380,7 +4558,8 @@ bad:
}
#endif
-#if CYTHON_COMPILING_IN_CPYTHON
+/* PyObjectCallNoArg */
+ #if CYTHON_COMPILING_IN_CPYTHON
static CYTHON_INLINE PyObject* __Pyx_PyObject_CallNoArg(PyObject *func) {
#ifdef __Pyx_CyFunction_USED
if (likely(PyCFunction_Check(func) || PyObject_TypeCheck(func, __pyx_CyFunctionType))) {
@@ -5395,7 +4574,8 @@ static CYTHON_INLINE PyObject* __Pyx_PyObject_CallNoArg(PyObject *func) {
}
#endif
-static CYTHON_INLINE PyObject *__Pyx_PyIter_Next2(PyObject* iterator, PyObject* defval) {
+/* IterNext */
+ static CYTHON_INLINE PyObject *__Pyx_PyIter_Next2(PyObject* iterator, PyObject* defval) {
PyObject* next;
iternextfunc iternext = Py_TYPE(iterator)->tp_iternext;
#if CYTHON_COMPILING_IN_CPYTHON
@@ -5432,7 +4612,8 @@ static CYTHON_INLINE PyObject *__Pyx_PyIter_Next2(PyObject* iterator, PyObject*
return NULL;
}
-static CYTHON_INLINE PyObject *__Pyx_GetItemInt_Generic(PyObject *o, PyObject* j) {
+/* GetItemInt */
+ static CYTHON_INLINE PyObject *__Pyx_GetItemInt_Generic(PyObject *o, PyObject* j) {
PyObject *r;
if (!j) return NULL;
r = PyObject_GetItem(o, j);
@@ -5496,10 +4677,9 @@ static CYTHON_INLINE PyObject *__Pyx_GetItemInt_Fast(PyObject *o, Py_ssize_t i,
if (likely(l >= 0)) {
i += l;
} else {
- if (PyErr_ExceptionMatches(PyExc_OverflowError))
- PyErr_Clear();
- else
+ if (!PyErr_ExceptionMatches(PyExc_OverflowError))
return NULL;
+ PyErr_Clear();
}
}
return m->sq_item(o, i);
@@ -5513,7 +4693,8 @@ static CYTHON_INLINE PyObject *__Pyx_GetItemInt_Fast(PyObject *o, Py_ssize_t i,
return __Pyx_GetItemInt_Generic(o, PyInt_FromSsize_t(i));
}
-static CYTHON_INLINE int __Pyx_PyBytes_Equals(PyObject* s1, PyObject* s2, int equals) {
+/* BytesEquals */
+ static CYTHON_INLINE int __Pyx_PyBytes_Equals(PyObject* s1, PyObject* s2, int equals) {
#if CYTHON_COMPILING_IN_PYPY
return PyObject_RichCompareBool(s1, s2, equals);
#else
@@ -5550,7 +4731,8 @@ static CYTHON_INLINE int __Pyx_PyBytes_Equals(PyObject* s1, PyObject* s2, int eq
#endif
}
-static CYTHON_INLINE int __Pyx_PyUnicode_Equals(PyObject* s1, PyObject* s2, int equals) {
+/* UnicodeEquals */
+ static CYTHON_INLINE int __Pyx_PyUnicode_Equals(PyObject* s1, PyObject* s2, int equals) {
#if CYTHON_COMPILING_IN_PYPY
return PyObject_RichCompareBool(s1, s2, equals);
#else
@@ -5633,7 +4815,8 @@ return_ne:
#endif
}
-static int __Pyx_PyBytes_SingleTailmatch(PyObject* self, PyObject* arg,
+/* bytes_tailmatch */
+ static int __Pyx_PyBytes_SingleTailmatch(PyObject* self, PyObject* arg,
Py_ssize_t start, Py_ssize_t end, int direction) {
const char* self_ptr = PyBytes_AS_STRING(self);
Py_ssize_t self_len = PyBytes_GET_SIZE(self);
@@ -5703,7 +4886,8 @@ static int __Pyx_PyBytes_Tailmatch(PyObject* self, PyObject* substr,
return __Pyx_PyBytes_SingleTailmatch(self, substr, start, end, direction);
}
-static int __Pyx_PyUnicode_Tailmatch(PyObject* s, PyObject* substr,
+/* unicode_tailmatch */
+ static int __Pyx_PyUnicode_Tailmatch(PyObject* s, PyObject* substr,
Py_ssize_t start, Py_ssize_t end, int direction) {
if (unlikely(PyTuple_Check(substr))) {
Py_ssize_t i, count = PyTuple_GET_SIZE(substr);
@@ -5727,7 +4911,8 @@ static int __Pyx_PyUnicode_Tailmatch(PyObject* s, PyObject* substr,
return (int) PyUnicode_Tailmatch(s, substr, start, end, direction);
}
-static CYTHON_INLINE int __Pyx_PyStr_Tailmatch(PyObject* self, PyObject* arg, Py_ssize_t start,
+/* str_tailmatch */
+ static CYTHON_INLINE int __Pyx_PyStr_Tailmatch(PyObject* self, PyObject* arg, Py_ssize_t start,
Py_ssize_t end, int direction)
{
if (PY_MAJOR_VERSION < 3)
@@ -5736,17 +4921,20 @@ static CYTHON_INLINE int __Pyx_PyStr_Tailmatch(PyObject* self, PyObject* arg, Py
return __Pyx_PyUnicode_Tailmatch(self, arg, start, end, direction);
}
-static CYTHON_INLINE void __Pyx_RaiseUnboundLocalError(const char *varname) {
+/* None */
+ static CYTHON_INLINE void __Pyx_RaiseUnboundLocalError(const char *varname) {
PyErr_Format(PyExc_UnboundLocalError, "local variable '%s' referenced before assignment", varname);
}
-static CYTHON_INLINE long __Pyx_mod_long(long a, long b) {
+/* None */
+ static CYTHON_INLINE long __Pyx_mod_long(long a, long b) {
long r = a % b;
r += ((r != 0) & ((r ^ b) < 0)) * b;
return r;
}
-static PyObject *__Pyx_Import(PyObject *name, PyObject *from_list, int level) {
+/* Import */
+ static PyObject *__Pyx_Import(PyObject *name, PyObject *from_list, int level) {
PyObject *empty_list = 0;
PyObject *module = 0;
PyObject *global_dict = 0;
@@ -5819,7 +5007,8 @@ bad:
return module;
}
-static PyObject* __Pyx_ImportFrom(PyObject* module, PyObject* name) {
+/* ImportFrom */
+ static PyObject* __Pyx_ImportFrom(PyObject* module, PyObject* name) {
PyObject* value = __Pyx_PyObject_GetAttrStr(module, name);
if (unlikely(!value) && PyErr_ExceptionMatches(PyExc_AttributeError)) {
PyErr_Format(PyExc_ImportError,
@@ -5832,7 +5021,8 @@ static PyObject* __Pyx_ImportFrom(PyObject* module, PyObject* name) {
return value;
}
-static PyObject *__Pyx_CalculateMetaclass(PyTypeObject *metaclass, PyObject *bases) {
+/* CalculateMetaclass */
+ static PyObject *__Pyx_CalculateMetaclass(PyTypeObject *metaclass, PyObject *bases) {
Py_ssize_t i, nbases = PyTuple_GET_SIZE(bases);
for (i=0; i < nbases; i++) {
PyTypeObject *tmptype;
@@ -5870,7 +5060,8 @@ static PyObject *__Pyx_CalculateMetaclass(PyTypeObject *metaclass, PyObject *bas
return (PyObject*) metaclass;
}
-static PyTypeObject* __Pyx_FetchCommonType(PyTypeObject* type) {
+/* FetchCommonType */
+ static PyTypeObject* __Pyx_FetchCommonType(PyTypeObject* type) {
PyObject* fake_module;
PyTypeObject* cached_type = NULL;
fake_module = PyImport_AddModule((char*) "_cython_" CYTHON_ABI);
@@ -5908,7 +5099,8 @@ bad:
goto done;
}
-static PyObject *
+/* CythonFunction */
+ static PyObject *
__Pyx_CyFunction_get_doc(__pyx_CyFunctionObject *op, CYTHON_UNUSED void *closure)
{
if (unlikely(op->func_doc == NULL)) {
@@ -6263,7 +5455,7 @@ __Pyx_CyFunction_clear(__pyx_CyFunctionObject *m)
int i;
for (i = 0; i < m->defaults_pyobjects; i++)
Py_XDECREF(pydefaults[i]);
- PyMem_Free(m->defaults);
+ PyObject_Free(m->defaults);
m->defaults = NULL;
}
return 0;
@@ -6451,7 +5643,7 @@ static int __pyx_CyFunction_init(void) {
}
static CYTHON_INLINE void *__Pyx_CyFunction_InitDefaults(PyObject *func, size_t size, int pyobjects) {
__pyx_CyFunctionObject *m = (__pyx_CyFunctionObject *) func;
- m->defaults = PyMem_Malloc(size);
+ m->defaults = PyObject_Malloc(size);
if (!m->defaults)
return PyErr_NoMemory();
memset(m->defaults, 0, size);
@@ -6474,7 +5666,8 @@ static CYTHON_INLINE void __Pyx_CyFunction_SetAnnotationsDict(PyObject *func, Py
Py_INCREF(dict);
}
-static PyObject *__Pyx_Py3MetaclassPrepare(PyObject *metaclass, PyObject *bases, PyObject *name,
+/* Py3ClassCreate */
+ static PyObject *__Pyx_Py3MetaclassPrepare(PyObject *metaclass, PyObject *bases, PyObject *name,
PyObject *qualname, PyObject *mkw, PyObject *modname, PyObject *doc) {
PyObject *ns;
if (metaclass) {
@@ -6540,7 +5733,8 @@ static PyObject *__Pyx_Py3ClassCreate(PyObject *metaclass, PyObject *name, PyObj
return result;
}
-static int __pyx_bisect_code_objects(__Pyx_CodeObjectCacheEntry* entries, int count, int code_line) {
+/* CodeObjectCache */
+ static int __pyx_bisect_code_objects(__Pyx_CodeObjectCacheEntry* entries, int count, int code_line) {
int start = 0, mid = 0, end = count - 1;
if (end >= 0 && code_line > entries[end].code_line) {
return count;
@@ -6619,7 +5813,8 @@ static void __pyx_insert_code_object(int code_line, PyCodeObject* code_object) {
Py_INCREF(code_object);
}
-#include "compile.h"
+/* AddTraceback */
+ #include "compile.h"
#include "frameobject.h"
#include "traceback.h"
static PyCodeObject* __Pyx_CreateCodeObjectForTraceback(
@@ -6699,7 +5894,8 @@ bad:
Py_XDECREF(py_frame);
}
-#define __PYX_VERIFY_RETURN_INT(target_type, func_type, func_value)\
+/* CIntFromPyVerify */
+ #define __PYX_VERIFY_RETURN_INT(target_type, func_type, func_value)\
__PYX__VERIFY_RETURN_INT(target_type, func_type, func_value, 0)
#define __PYX_VERIFY_RETURN_INT_EXC(target_type, func_type, func_value)\
__PYX__VERIFY_RETURN_INT(target_type, func_type, func_value, 1)
@@ -6720,11 +5916,35 @@ bad:
return (target_type) value;\
}
-#if CYTHON_USE_PYLONG_INTERNALS
- #include "longintrepr.h"
-#endif
+/* CIntToPy */
+ static CYTHON_INLINE PyObject* __Pyx_PyInt_From_long(long value) {
+ const long neg_one = (long) -1, const_zero = (long) 0;
+ const int is_unsigned = neg_one > const_zero;
+ if (is_unsigned) {
+ if (sizeof(long) < sizeof(long)) {
+ return PyInt_FromLong((long) value);
+ } else if (sizeof(long) <= sizeof(unsigned long)) {
+ return PyLong_FromUnsignedLong((unsigned long) value);
+ } else if (sizeof(long) <= sizeof(unsigned PY_LONG_LONG)) {
+ return PyLong_FromUnsignedLongLong((unsigned PY_LONG_LONG) value);
+ }
+ } else {
+ if (sizeof(long) <= sizeof(long)) {
+ return PyInt_FromLong((long) value);
+ } else if (sizeof(long) <= sizeof(PY_LONG_LONG)) {
+ return PyLong_FromLongLong((PY_LONG_LONG) value);
+ }
+ }
+ {
+ int one = 1; int little = (int)*(unsigned char *)&one;
+ unsigned char *bytes = (unsigned char *)&value;
+ return _PyLong_FromByteArray(bytes, sizeof(long),
+ little, !is_unsigned);
+ }
+}
-static CYTHON_INLINE int __Pyx_PyInt_As_int(PyObject *x) {
+/* CIntFromPy */
+ static CYTHON_INLINE int __Pyx_PyInt_As_int(PyObject *x) {
const int neg_one = (int) -1, const_zero = (int) 0;
const int is_unsigned = neg_one > const_zero;
#if PY_MAJOR_VERSION < 3
@@ -6799,7 +6019,7 @@ static CYTHON_INLINE int __Pyx_PyInt_As_int(PyObject *x) {
const digit* digits = ((PyLongObject*)x)->ob_digit;
switch (Py_SIZE(x)) {
case 0: return (int) 0;
- case -1: __PYX_VERIFY_RETURN_INT(int, sdigit, -(sdigit) digits[0])
+ case -1: __PYX_VERIFY_RETURN_INT(int, sdigit, (sdigit) (-(sdigit)digits[0]))
case 1: __PYX_VERIFY_RETURN_INT(int, digit, +digits[0])
case -2:
if (8 * sizeof(int) - 1 > 1 * PyLong_SHIFT) {
@@ -6869,7 +6089,7 @@ static CYTHON_INLINE int __Pyx_PyInt_As_int(PyObject *x) {
"_PyLong_AsByteArray() not available in PyPy, cannot convert large numbers");
#else
int val;
- PyObject *v = __Pyx_PyNumber_Int(x);
+ PyObject *v = __Pyx_PyNumber_IntOrLong(x);
#if PY_MAJOR_VERSION < 3
if (likely(v) && !PyLong_Check(v)) {
PyObject *tmp = v;
@@ -6892,7 +6112,7 @@ static CYTHON_INLINE int __Pyx_PyInt_As_int(PyObject *x) {
}
} else {
int val;
- PyObject *tmp = __Pyx_PyNumber_Int(x);
+ PyObject *tmp = __Pyx_PyNumber_IntOrLong(x);
if (!tmp) return (int) -1;
val = __Pyx_PyInt_As_int(tmp);
Py_DECREF(tmp);
@@ -6908,33 +6128,8 @@ raise_neg_overflow:
return (int) -1;
}
-static CYTHON_INLINE PyObject* __Pyx_PyInt_From_long(long value) {
- const long neg_one = (long) -1, const_zero = (long) 0;
- const int is_unsigned = neg_one > const_zero;
- if (is_unsigned) {
- if (sizeof(long) < sizeof(long)) {
- return PyInt_FromLong((long) value);
- } else if (sizeof(long) <= sizeof(unsigned long)) {
- return PyLong_FromUnsignedLong((unsigned long) value);
- } else if (sizeof(long) <= sizeof(unsigned PY_LONG_LONG)) {
- return PyLong_FromUnsignedLongLong((unsigned PY_LONG_LONG) value);
- }
- } else {
- if (sizeof(long) <= sizeof(long)) {
- return PyInt_FromLong((long) value);
- } else if (sizeof(long) <= sizeof(PY_LONG_LONG)) {
- return PyLong_FromLongLong((PY_LONG_LONG) value);
- }
- }
- {
- int one = 1; int little = (int)*(unsigned char *)&one;
- unsigned char *bytes = (unsigned char *)&value;
- return _PyLong_FromByteArray(bytes, sizeof(long),
- little, !is_unsigned);
- }
-}
-
-static CYTHON_INLINE long __Pyx_PyInt_As_long(PyObject *x) {
+/* CIntFromPy */
+ static CYTHON_INLINE long __Pyx_PyInt_As_long(PyObject *x) {
const long neg_one = (long) -1, const_zero = (long) 0;
const int is_unsigned = neg_one > const_zero;
#if PY_MAJOR_VERSION < 3
@@ -7009,7 +6204,7 @@ static CYTHON_INLINE long __Pyx_PyInt_As_long(PyObject *x) {
const digit* digits = ((PyLongObject*)x)->ob_digit;
switch (Py_SIZE(x)) {
case 0: return (long) 0;
- case -1: __PYX_VERIFY_RETURN_INT(long, sdigit, -(sdigit) digits[0])
+ case -1: __PYX_VERIFY_RETURN_INT(long, sdigit, (sdigit) (-(sdigit)digits[0]))
case 1: __PYX_VERIFY_RETURN_INT(long, digit, +digits[0])
case -2:
if (8 * sizeof(long) - 1 > 1 * PyLong_SHIFT) {
@@ -7079,7 +6274,7 @@ static CYTHON_INLINE long __Pyx_PyInt_As_long(PyObject *x) {
"_PyLong_AsByteArray() not available in PyPy, cannot convert large numbers");
#else
long val;
- PyObject *v = __Pyx_PyNumber_Int(x);
+ PyObject *v = __Pyx_PyNumber_IntOrLong(x);
#if PY_MAJOR_VERSION < 3
if (likely(v) && !PyLong_Check(v)) {
PyObject *tmp = v;
@@ -7102,7 +6297,7 @@ static CYTHON_INLINE long __Pyx_PyInt_As_long(PyObject *x) {
}
} else {
long val;
- PyObject *tmp = __Pyx_PyNumber_Int(x);
+ PyObject *tmp = __Pyx_PyNumber_IntOrLong(x);
if (!tmp) return (long) -1;
val = __Pyx_PyInt_As_long(tmp);
Py_DECREF(tmp);
@@ -7118,26 +6313,33 @@ raise_neg_overflow:
return (long) -1;
}
-static CYTHON_INLINE void __Pyx_ExceptionSwap(PyObject **type, PyObject **value, PyObject **tb) {
+/* SwapException */
+ #if CYTHON_COMPILING_IN_CPYTHON
+static CYTHON_INLINE void __Pyx__ExceptionSwap(PyThreadState *tstate, PyObject **type, PyObject **value, PyObject **tb) {
PyObject *tmp_type, *tmp_value, *tmp_tb;
-#if CYTHON_COMPILING_IN_CPYTHON
- PyThreadState *tstate = PyThreadState_GET();
tmp_type = tstate->exc_type;
tmp_value = tstate->exc_value;
tmp_tb = tstate->exc_traceback;
tstate->exc_type = *type;
tstate->exc_value = *value;
tstate->exc_traceback = *tb;
+ *type = tmp_type;
+ *value = tmp_value;
+ *tb = tmp_tb;
+}
#else
+static CYTHON_INLINE void __Pyx_ExceptionSwap(PyObject **type, PyObject **value, PyObject **tb) {
+ PyObject *tmp_type, *tmp_value, *tmp_tb;
PyErr_GetExcInfo(&tmp_type, &tmp_value, &tmp_tb);
PyErr_SetExcInfo(*type, *value, *tb);
-#endif
*type = tmp_type;
*value = tmp_value;
*tb = tmp_tb;
}
+#endif
-static PyObject* __Pyx_PyObject_CallMethod1(PyObject* obj, PyObject* method_name, PyObject* arg) {
+/* PyObjectCallMethod1 */
+ static PyObject* __Pyx_PyObject_CallMethod1(PyObject* obj, PyObject* method_name, PyObject* arg) {
PyObject *method, *result = NULL;
method = __Pyx_PyObject_GetAttrStr(obj, method_name);
if (unlikely(!method)) goto bad;
@@ -7168,7 +6370,8 @@ bad:
return result;
}
-#include <structmember.h>
+/* CoroutineBase */
+ #include <structmember.h>
#include <frameobject.h>
static PyObject *__Pyx_Coroutine_Send(PyObject *self, PyObject *value);
static PyObject *__Pyx_Coroutine_Close(PyObject *self);
@@ -7178,6 +6381,8 @@ static PyObject *__Pyx_Coroutine_Throw(PyObject *gen, PyObject *args);
static int __Pyx_PyGen_FetchStopIterationValue(PyObject **pvalue) {
PyObject *et, *ev, *tb;
PyObject *value = NULL;
+ __Pyx_PyThreadState_declare
+ __Pyx_PyThreadState_assign
__Pyx_ErrFetch(&et, &ev, &tb);
if (!et) {
Py_XDECREF(tb);
@@ -7282,6 +6487,7 @@ int __Pyx_Coroutine_CheckRunning(__pyx_CoroutineObject *gen) {
static CYTHON_INLINE
PyObject *__Pyx_Coroutine_SendEx(__pyx_CoroutineObject *self, PyObject *value) {
PyObject *retval;
+ __Pyx_PyThreadState_declare
assert(!self->is_running);
if (unlikely(self->resume_label == 0)) {
if (unlikely(value && value != Py_None)) {
@@ -7295,16 +6501,16 @@ PyObject *__Pyx_Coroutine_SendEx(__pyx_CoroutineObject *self, PyObject *value) {
PyErr_SetNone(PyExc_StopIteration);
return NULL;
}
+ __Pyx_PyThreadState_assign
if (value) {
#if CYTHON_COMPILING_IN_PYPY
#else
if (self->exc_traceback) {
- PyThreadState *tstate = PyThreadState_GET();
PyTracebackObject *tb = (PyTracebackObject *) self->exc_traceback;
PyFrameObject *f = tb->tb_frame;
- Py_XINCREF(tstate->frame);
+ Py_XINCREF(__pyx_tstate->frame);
assert(f->f_back == NULL);
- f->f_back = tstate->frame;
+ f->f_back = __pyx_tstate->frame;
}
#endif
__Pyx_ExceptionSwap(&self->exc_type, &self->exc_value,
@@ -7578,12 +6784,14 @@ static void __Pyx_Coroutine_del(PyObject *self) {
PyObject *res;
PyObject *error_type, *error_value, *error_traceback;
__pyx_CoroutineObject *gen = (__pyx_CoroutineObject *) self;
+ __Pyx_PyThreadState_declare
if (gen->resume_label <= 0)
return ;
#if PY_VERSION_HEX < 0x030400a1
assert(self->ob_refcnt == 0);
self->ob_refcnt = 1;
#endif
+ __Pyx_PyThreadState_assign
__Pyx_ErrFetch(&error_type, &error_value, &error_traceback);
res = __Pyx_Coroutine_Close(self);
if (res == NULL)
@@ -7686,7 +6894,8 @@ static __pyx_CoroutineObject *__Pyx__Coroutine_New(PyTypeObject* type, __pyx_cor
return gen;
}
-static PyObject* __Pyx_Coroutine_patch_module(PyObject* module, const char* py_code) {
+/* PatchModuleWithCoroutine */
+ static PyObject* __Pyx_Coroutine_patch_module(PyObject* module, const char* py_code) {
#if defined(__Pyx_Generator_USED) || defined(__Pyx_Coroutine_USED)
int result;
PyObject *globals, *result_obj;
@@ -7725,7 +6934,8 @@ ignore:
return module;
}
-#if defined(__Pyx_Generator_USED) || defined(__Pyx_Coroutine_USED)
+/* PatchGeneratorABC */
+ #if defined(__Pyx_Generator_USED) || defined(__Pyx_Coroutine_USED)
static PyObject* __Pyx_patch_abc_module(PyObject *module);
static PyObject* __Pyx_patch_abc_module(PyObject *module) {
module = __Pyx_Coroutine_patch_module(
@@ -7778,7 +6988,8 @@ static int __Pyx_patch_abc(void) {
return 0;
}
-static PyMethodDef __pyx_Generator_methods[] = {
+/* Generator */
+ static PyMethodDef __pyx_Generator_methods[] = {
{"send", (PyCFunction) __Pyx_Coroutine_Send, METH_O,
(char*) PyDoc_STR("send(arg) -> send 'arg' into generator,\nreturn next yielded value or raise StopIteration.")},
{"throw", (PyCFunction) __Pyx_Coroutine_Throw, METH_VARARGS,
@@ -7866,7 +7077,8 @@ static int __pyx_Generator_init(void) {
return 0;
}
-static int __Pyx_check_binary_version(void) {
+/* CheckBinaryVersion */
+ static int __Pyx_check_binary_version(void) {
char ctversion[4], rtversion[4];
PyOS_snprintf(ctversion, 4, "%d.%d", PY_MAJOR_VERSION, PY_MINOR_VERSION);
PyOS_snprintf(rtversion, 4, "%s", Py_GetVersion());
@@ -7881,7 +7093,8 @@ static int __Pyx_check_binary_version(void) {
return 0;
}
-static int __Pyx_InitStrings(__Pyx_StringTabEntry *t) {
+/* InitStrings */
+ static int __Pyx_InitStrings(__Pyx_StringTabEntry *t) {
while (t->p) {
#if PY_MAJOR_VERSION < 3
if (t->is_unicode) {
@@ -7981,7 +7194,7 @@ static CYTHON_INLINE int __Pyx_PyObject_IsTrue(PyObject* x) {
if (is_true | (x == Py_False) | (x == Py_None)) return is_true;
else return PyObject_IsTrue(x);
}
-static CYTHON_INLINE PyObject* __Pyx_PyNumber_Int(PyObject* x) {
+static CYTHON_INLINE PyObject* __Pyx_PyNumber_IntOrLong(PyObject* x) {
PyNumberMethods *m;
const char *name = NULL;
PyObject *res = NULL;
diff --git a/cutadapt/_seqio.pyx b/cutadapt/_seqio.pyx
index b687c0b..e94f82e 100644
--- a/cutadapt/_seqio.pyx
+++ b/cutadapt/_seqio.pyx
@@ -18,17 +18,17 @@ cdef class Sequence(object):
public str name
public str sequence
public str qualities
- public str name2
+ public bint second_header
public object match
public object match_info
- def __init__(self, str name, str sequence, str qualities=None, str name2='', match=None,
+ def __init__(self, str name, str sequence, str qualities=None, bint second_header=False, match=None,
match_info=None):
"""Set qualities to None if there are no quality values"""
self.name = name
self.sequence = sequence
self.qualities = qualities
- self.name2 = name2
+ self.second_header = second_header
self.match = match
self.match_info = match_info
if qualities is not None and len(qualities) != len(sequence):
@@ -43,7 +43,7 @@ cdef class Sequence(object):
self.name,
self.sequence[key],
self.qualities[key] if self.qualities is not None else None,
- self.name2,
+ self.second_header,
self.match,
self.match_info)
@@ -69,7 +69,7 @@ cdef class Sequence(object):
raise NotImplementedError()
def __reduce__(self):
- return (Sequence, (self.name, self.sequence, self.qualities, self.name2))
+ return (Sequence, (self.name, self.sequence, self.qualities, self.second_header))
class FastqReader(SequenceReader):
@@ -124,15 +124,15 @@ class FastqReader(SequenceReader):
"The second sequence description must be either empty "
"or equal to the first description.".format(i+1,
name, line[1:]))
- name2 = name
+ second_header = True
else:
- name2 = ''
+ second_header = False
elif i == 3:
if len(line) == len(sequence) - strip:
qualities = line[:strip]
else:
qualities = line.rstrip('\r\n')
- yield sequence_class(name, sequence, qualities, name2=name2)
+ yield sequence_class(name, sequence, qualities, second_header=second_header)
i = (i + 1) % 4
if i != 0:
raise FormatError("FASTQ file ended prematurely")
diff --git a/cutadapt/_version.py b/cutadapt/_version.py
new file mode 100644
index 0000000..9b4fb9e
--- /dev/null
+++ b/cutadapt/_version.py
@@ -0,0 +1,21 @@
+
+# This file was generated by 'versioneer.py' (0.16) from
+# revision-control system data, or from the parent directory name of an
+# unpacked source archive. Distribution tarballs contain a pre-generated copy
+# of this file.
+
+import json
+import sys
+
+version_json = '''
+{
+ "dirty": false,
+ "error": null,
+ "full-revisionid": "46bab59782eb0930854a0a73640b011b4cf4b6cf",
+ "version": "1.11"
+}
+''' # END VERSION_JSON
+
+
+def get_versions():
+ return json.loads(version_json)
diff --git a/cutadapt/scripts/cutadapt.py b/cutadapt/scripts/cutadapt.py
index 7a7b0af..bc3fdbd 100755
--- a/cutadapt/scripts/cutadapt.py
+++ b/cutadapt/scripts/cutadapt.py
@@ -225,40 +225,35 @@ def get_option_parser():
"If LENGTH is positive, remove bases from the beginning. "
"If LENGTH is negative, remove bases from the end. "
"Can be used twice if LENGTHs have different signs.")
+ group.add_option("--nextseq-trim", type=int, default=None, metavar="3'CUTOFF",
+ help="NextSeq-specific quality trimming (each read). Trims also dark "
+ "cycles appearing as high-quality G bases (EXPERIMENTAL).")
group.add_option("-q", "--quality-cutoff", default=None, metavar="[5'CUTOFF,]3'CUTOFF",
help="Trim low-quality bases from 5' and/or 3' ends of each read before "
"adapter removal. Applied to both reads if data is paired. If one "
"value is given, only the 3' end is trimmed. If two "
"comma-separated cutoffs are given, the 5' end is trimmed with "
"the first cutoff, the 3' end with the second.")
- group.add_option("--nextseq-trim", type=int, default=None, metavar="3'CUTOFF",
- help="NextSeq-specific quality trimming (each read). Trims also dark "
- "cycles appearing as high-quality G bases (EXPERIMENTAL).")
group.add_option("--quality-base", type=int, default=33,
help="Assume that quality values in FASTQ are encoded as ascii(quality "
"+ QUALITY_BASE). This needs to be set to 64 for some old Illumina "
"FASTQ files. Default: %default")
group.add_option("--trim-n", action='store_true', default=False,
help="Trim N's on ends of reads.")
- group.add_option("-x", "--prefix", default='',
- help="Add this prefix to read names. Use {name} to insert the name of the matching adapter.")
- group.add_option("-y", "--suffix", default='',
- help="Add this suffix to read names; can also include {name}")
- group.add_option("--strip-suffix", action='append', default=[],
- help="Remove this suffix from read names if present. Can be given multiple times.")
group.add_option("--length-tag", metavar="TAG",
help="Search for TAG followed by a decimal number in the description "
"field of the read. Replace the decimal number with the correct "
"length of the trimmed read. For example, use --length-tag 'length=' "
"to correct fields like 'length=123'.")
+ group.add_option("--strip-suffix", action='append', default=[],
+ help="Remove this suffix from read names if present. Can be given multiple times.")
+ group.add_option("-x", "--prefix", default='',
+ help="Add this prefix to read names. Use {name} to insert the name of the matching adapter.")
+ group.add_option("-y", "--suffix", default='',
+ help="Add this suffix to read names; can also include {name}")
parser.add_option_group(group)
group = OptionGroup(parser, "Filtering of processed reads")
- group.add_option("--discard-trimmed", "--discard", action='store_true', default=False,
- help="Discard reads that contain an adapter. Also use -O to avoid "
- "discarding too many randomly matching reads!")
- group.add_option("--discard-untrimmed", "--trimmed-only", action='store_true', default=False,
- help="Discard reads that do not contain the adapter.")
group.add_option("-m", "--minimum-length", type=int, default=0, metavar="LENGTH",
help="Discard trimmed reads that are shorter than LENGTH. Reads that "
"are too short even before adapter removal are also discarded. In "
@@ -272,6 +267,11 @@ def get_option_parser():
help="Discard reads with too many N bases. If COUNT is an integer, it "
"is treated as the absolute number of N bases. If it is between 0 "
"and 1, it is treated as the proportion of N's allowed in a read.")
+ group.add_option("--discard-trimmed", "--discard", action='store_true', default=False,
+ help="Discard reads that contain an adapter. Also use -O to avoid "
+ "discarding too many randomly matching reads!")
+ group.add_option("--discard-untrimmed", "--trimmed-only", action='store_true', default=False,
+ help="Discard reads that do not contain the adapter.")
parser.add_option_group(group)
group = OptionGroup(parser, "Output")
@@ -399,44 +399,51 @@ def main(cmdlineargs=None, default_outfile=sys.stdout):
paired = 'first'
# Any of these options switch off legacy mode
if (options.adapters2 or options.front2 or options.anywhere2 or
- options.cut2 or options.interleaved or options.pair_filter or
- options.too_short_paired_output or options.too_long_paired_output):
+ options.cut2 or options.interleaved or options.pair_filter or
+ options.too_short_paired_output or options.too_long_paired_output):
# Full paired-end trimming when both -p and -A/-G/-B/-U given
# Read modifications (such as quality trimming) are applied also to second read.
paired = 'both'
if paired and len(args) == 1 and not options.interleaved:
- parser.error("When paired-end trimming is enabled via -A/-G/-B/-U or -p, "
- "two input files are required.")
- if options.interleaved and len(args) != 1:
- parser.error("When reading interleaved files, only one input file may "
- "be given.")
+ parser.error("When paired-end trimming is enabled via -A/-G/-B/-U/"
+ "--interleaved or -p, two input files are required.")
if not paired:
if options.untrimmed_paired_output:
parser.error("Option --untrimmed-paired-output can only be used when "
"trimming paired-end reads (with option -p).")
+ interleaved_input = False
+ interleaved_output = False
+ if options.interleaved:
+ interleaved_input = len(args) == 1
+ interleaved_output = not options.paired_output
+ if not interleaved_input and not interleaved_output:
+ parser.error("When --interleaved is used, you cannot provide both two input files and two output files")
+
# Assign input_paired_filename and quality_filename
input_paired_filename = None
quality_filename = None
if paired:
- if not options.interleaved:
+ if not interleaved_input:
input_paired_filename = args[1]
+ if not interleaved_output:
if not options.paired_output:
parser.error("When paired-end trimming is enabled via -A/-G/-B/-U, "
"a second output file needs to be specified via -p (--paired-output).")
if not options.output:
parser.error("When you use -p or --paired-output, you must also "
"use the -o option.")
- if bool(options.untrimmed_output) != bool(options.untrimmed_paired_output):
- parser.error("When trimming paired-end reads, you must use either none "
- "or both of the --untrimmed-output/--untrimmed-paired-output options.")
- if options.too_short_output and not options.too_short_paired_output:
- parser.error("When using --too-short-output with paired-end "
- "reads, you also need to use --too-short-paired-output")
- if options.too_long_output and not options.too_long_paired_output:
- parser.error("When using --too-long-output with paired-end "
- "reads, you also need to use --too-long-paired-output")
+
+ if bool(options.untrimmed_output) != bool(options.untrimmed_paired_output):
+ parser.error("When trimming paired-end reads, you must use either none "
+ "or both of the --untrimmed-output/--untrimmed-paired-output options.")
+ if options.too_short_output and not options.too_short_paired_output:
+ parser.error("When using --too-short-output with paired-end "
+ "reads, you also need to use --too-short-paired-output")
+ if options.too_long_output and not options.too_long_paired_output:
+ parser.error("When using --too-long-output with paired-end "
+ "reads, you also need to use --too-long-paired-output")
elif len(args) == 2:
quality_filename = args[1]
if options.format is not None:
@@ -450,7 +457,7 @@ def main(cmdlineargs=None, default_outfile=sys.stdout):
try:
reader = seqio.open(input_filename, file2=input_paired_filename,
qualfile=quality_filename, colorspace=options.colorspace,
- fileformat=options.format, interleaved=options.interleaved)
+ fileformat=options.format, interleaved=interleaved_input)
except (seqio.UnknownFileType, IOError) as e:
parser.error(e)
@@ -472,8 +479,7 @@ def main(cmdlineargs=None, default_outfile=sys.stdout):
cutoffs = None
open_writer = functools.partial(seqio.open, mode='w',
- qualities=reader.delivers_qualities, colorspace=options.colorspace,
- interleaved=options.interleaved)
+ qualities=reader.delivers_qualities, colorspace=options.colorspace)
if options.pair_filter is None:
options.pair_filter = 'any'
@@ -536,9 +542,9 @@ def main(cmdlineargs=None, default_outfile=sys.stdout):
# Finally, figure out where the reads that passed all the previous
# filters should go.
if options.output is not None:
- writer = open_writer(options.output, options.paired_output)
+ writer = open_writer(options.output, options.paired_output, interleaved=interleaved_output)
else:
- writer = open_writer(default_outfile)
+ writer = open_writer(default_outfile, interleaved=interleaved_output)
if not paired:
filters.append(NoFilter(writer))
else:
diff --git a/cutadapt/seqio.py b/cutadapt/seqio.py
index 28d6722..91518b8 100644
--- a/cutadapt/seqio.py
+++ b/cutadapt/seqio.py
@@ -34,12 +34,12 @@ def _shorten(s, n=100):
class Sequence(object):
"""qualities is a string and it contains the qualities encoded as ascii(qual+33)."""
- def __init__(self, name, sequence, qualities=None, name2='', match=None, match_info=None):
+ def __init__(self, name, sequence, qualities=None, second_header=False, match=None, match_info=None):
"""Set qualities to None if there are no quality values"""
self.name = name
self.sequence = sequence
self.qualities = qualities
- self.name2 = name2
+ self.second_header = second_header
self.match = match
self.match_info = match_info
self.original_length = len(sequence)
@@ -55,7 +55,7 @@ class Sequence(object):
self.name,
self.sequence[key],
self.qualities[key] if self.qualities is not None else None,
- self.name2,
+ self.second_header,
self.match,
self.match_info)
@@ -113,7 +113,7 @@ except ImportError:
class ColorspaceSequence(Sequence):
- def __init__(self, name, sequence, qualities, primer=None, name2='', match=None, match_info=None):
+ def __init__(self, name, sequence, qualities, primer=None, second_header=False, match=None, match_info=None):
# In colorspace, the first character is the last nucleotide of the primer base
# and the second character encodes the transition from the primer base to the
# first real base of the read.
@@ -127,7 +127,7 @@ class ColorspaceSequence(Sequence):
raise FormatError("In read named {0!r}: length of colorspace quality "
"sequence ({1}) and length of read ({2}) do not match (primer "
"is: {3!r})".format(rname, len(qualities), len(sequence), self.primer))
- super(ColorspaceSequence, self).__init__(name, sequence, qualities, name2, match, match_info)
+ super(ColorspaceSequence, self).__init__(name, sequence, qualities, second_header, match, match_info)
if not self.primer in ('A', 'C', 'G', 'T'):
raise FormatError("Primer base is {0!r} in read {1!r}, but it "
"should be one of A, C, G, T.".format(
@@ -146,14 +146,14 @@ class ColorspaceSequence(Sequence):
self.sequence[key],
self.qualities[key] if self.qualities is not None else None,
self.primer,
- self.name2,
+ self.second_header,
self.match,
self.match_info)
-def sra_colorspace_sequence(name, sequence, qualities, name2):
+def sra_colorspace_sequence(name, sequence, qualities, second_header):
"""Factory for an SRA colorspace sequence (which has one quality value too many)"""
- return ColorspaceSequence(name, sequence, qualities[1:], name2=name2)
+ return ColorspaceSequence(name, sequence, qualities[1:], second_header=second_header)
class FileWithPrependedLine(object):
@@ -277,12 +277,12 @@ class FastqReader(SequenceReader):
"The second sequence description must be either empty "
"or equal to the first description.".format(
i+1, name, line[1:].rstrip()))
- name2 = name
+ second_header = True
else:
- name2 = ''
+ second_header = False
elif i % 4 == 3:
qualities = line.rstrip('\n\r')
- yield self.sequence_class(name, sequence, qualities, name2=name2)
+ yield self.sequence_class(name, sequence, qualities, second_header=second_header)
if i % 4 != 3:
raise FormatError("FASTQ file ended prematurely")
@@ -520,12 +520,14 @@ class FastaWriter(FileWriter, SingleRecordWriter):
else:
print('>{0}'.format(name), sequence, file=self._file, sep='\n')
+
class ColorspaceFastaWriter(FastaWriter):
def write(self, record):
name = record.name
sequence = record.primer + record.sequence
super(ColorspaceFastaWriter, self).write(name, sequence)
+
class FastqWriter(FileWriter, SingleRecordWriter):
"""
Write sequences with qualities in FASTQ format.
@@ -542,14 +544,16 @@ class FastqWriter(FileWriter, SingleRecordWriter):
The record must have attributes .name, .sequence and .qualities.
"""
+ name2 = record.name if record.second_header else ''
s = ('@' + record.name + '\n' + record.sequence + '\n+' +
- record.name2 + '\n' + record.qualities + '\n')
+ name2 + '\n' + record.qualities + '\n')
self._file.write(s)
def writeseq(self, name, sequence, qualities):
print("@{0:s}\n{1:s}\n+\n{2:s}".format(
name, sequence, qualities), file=self._file)
+
class ColorspaceFastqWriter(FastqWriter):
def write(self, record):
name = record.name
@@ -557,6 +561,7 @@ class ColorspaceFastqWriter(FastqWriter):
qualities = record.qualities
super(ColorspaceFastqWriter, self).writeseq(name, sequence, qualities)
+
class PairRecordWriter(object):
"""Public interface to paired-record files"""
def write(self, read1, read2):
@@ -571,6 +576,7 @@ class PairRecordWriter(object):
def __exit__(self, *args):
self.close()
+
class PairedSequenceWriter(PairRecordWriter):
def __init__(self, file1, file2, colorspace=False, fileformat='fastq', qualities=None):
self._writer1 = open(file1, colorspace=colorspace, fileformat=fileformat, mode='w',
@@ -586,6 +592,7 @@ class PairedSequenceWriter(PairRecordWriter):
self._writer1.close()
self._writer2.close()
+
class InterleavedSequenceWriter(PairRecordWriter):
"""
Write paired-end reads to an interleaved FASTA or FASTQ file
@@ -600,6 +607,7 @@ class InterleavedSequenceWriter(PairRecordWriter):
def close(self):
self._writer.close()
+
class UnknownFileType(Exception):
"""
Raised when open could not autodetect the file type.
diff --git a/doc/conf.py b/doc/conf.py
index bca116e..511465d 100644
--- a/doc/conf.py
+++ b/doc/conf.py
@@ -29,7 +29,7 @@ sys.path.insert(0, os.path.abspath(os.pardir))
# extensions coming with Sphinx (named 'sphinx.ext.*') or your custom
# ones.
extensions = [
- 'sphinx.ext.autodoc',
+ 'sphinx.ext.autodoc',
]
# Add any paths that contain templates here, relative to this directory.
@@ -53,10 +53,16 @@ copyright = u'2010-2016, Marcel Martin'
# built documents.
from cutadapt import __version__
-
-#
# The short X.Y version.
version = __version__
+
+# Read The Docs modifies the conf.py script and we therefore get
+# version numbers like 0.7+0.g27d0d31.dirty from versioneer.
+if version.endswith('.dirty') and os.environ.get('READTHEDOCS') == 'True':
+ version, _, rest = version.partition('+')
+ if not rest.startswith('0.'):
+ version = version + '+' + rest[:-6]
+
# The full version, including alpha/beta/rc tags.
release = __version__
diff --git a/doc/guide.rst b/doc/guide.rst
index d5d7fe6..2c8092c 100644
--- a/doc/guide.rst
+++ b/doc/guide.rst
@@ -112,10 +112,17 @@ way:
1. :ref:`Read modification options <modifying-reads>` are applied. This includes
:ref:`adapter removal <removing-adapters>`,
- :ref:`quality trimming <quality-trimming>`, read name modifications etc.
+ :ref:`quality trimming <quality-trimming>`, read name modifications etc. The
+ order in which they are applied is the order in which they are listed in the
+ help shown by ``cutadapt --help`` under the “Additional read modifications”
+ heading. Adapter trimming itself does not appear in that list and is
+ done after quality trimming and before ``N``-end trimming (``--trim-N``).
+
2. :ref:`Filtering options <filtering>` are applied, such as removal of too
short or untrimmed reads. Some of the filters also allow to redirect a read
- to a separate output file.
+ to a separate output file. The filters are applied in the order in which
+ they are listed in the help shown by ``cutadapt --help`` under the
+ “Filtering of processed reads” heading.
3. If the read has passed all the filters, it is written to the output file.
@@ -826,9 +833,18 @@ option to the command-line. For example::
cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.fastq reads.fastq
-The output FASTQ file will also be written interleaved. Cutadapt will detect if
-the input file is not properly interleaved by checking whether read names match
-and whether the file contains an even number of entries.
+To read from an interleaved file, but write regular two-file output, provide the
+second output file as usual with the ``-p`` option::
+
+ cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.1.fastq -p trimmed.2.fastq reads.fastq
+
+Reading two-file input and writing interleaved is also possible by providing
+a second input file::
+
+ cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.1.fastq reads.1.fastq reads.2.fastq
+
+Cutadapt will detect if an input file is not properly interleaved by checking
+whether read names match and whether the file contains an even number of entries.
When ``--interleaved`` is used, legacy mode is disabled (that is,
read-modification options such as ``-q`` always apply to both reads).
diff --git a/doc/recipes.rst b/doc/recipes.rst
index 3020be4..e04ae06 100644
--- a/doc/recipes.rst
+++ b/doc/recipes.rst
@@ -9,36 +9,42 @@ cutadapt can be made to behave in the desired way.
.. note:: This section is still being written.
-Forcing matches to be at the end of the read
---------------------------------------------
+Avoiding internal adapter matches
+---------------------------------
-Use ``-a TACGGCATXXX``. The ``X`` is always counted as a mismatch and will force
-the adapter match to be at the end. This is not the same as an anchored 3'
-adapter since partial matches are still allowed.
+To force matches to be at the end of the read and thus avoiding internal
+adapter matches, append a few ``X`` characters to the adapter sequence, like
+this: ``-a TACGGCATXXX``. The ``X`` is counted as a mismatch and will force the
+match to be at the end. Just make sure that there are more ``X`` characters than
+the length of the adapter times the error rate. This is not the same as an
+anchored 3' adapter since partial matches are still allowed.
Removing more than one adapter
------------------------------
-If you want to remove more than one adapter, let's say a 5' adapter and a 3'
-adapter, you have two options.
+If you want to remove a 5' and 3' adapter at the same time, :ref:`use the
+support for linked adapters <linked-adapters>`.
-First, you can specify both adapters and also ``--times=2`` (or the short
+If your situation is different, for example, when you have many 5' adapters
+but only one 3' adapter, then you have two options.
+
+First, you can specify the adapters and also ``--times=2`` (or the short
version ``-n 2``). For example::
- cutadapt -g ^TTAAGGCC -a TACGGACT -n 2 -o output.fastq input.fastq
+ cutadapt -g ^TTAAGGCC -g ^AAGCTTA -a TACGGACT -n 2 -o output.fastq input.fastq
This instructs cutadapt to run two rounds of adapter finding and removal. That
means that, after the first round and only when an adapter was actually found,
-another round is performed. In both rounds, all given adapters (two in this
-case) are searched and removed. The problem is that it could happen that one
-adapter is found twice (so the 3' adapter, for example, could be removed twice).
+another round is performed. In both rounds, all given adapters are searched and
+removed. The problem is that it could happen that one adapter is found twice (so
+the 3' adapter, for example, could be removed twice).
The second option is to not use the ``-n`` option, but to run cutadapt twice,
first removing one adapter and then the other. It is easiest if you use a pipe
as in this example::
- cutadapt -g ^TTAAGGCC input.fastq | cutadapt -a TACGGACT - > output.fastq
+ cutadapt -g ^TTAAGGCC -g ^AAGCTTA input.fastq | cutadapt -a TACGGACT - > output.fastq
Trimming poly-A tails
diff --git a/setup.cfg b/setup.cfg
new file mode 100644
index 0000000..08fbaca
--- /dev/null
+++ b/setup.cfg
@@ -0,0 +1,13 @@
+[versioneer]
+vcs = git
+style = pep440
+versionfile_source = cutadapt/_version.py
+versionfile_build = cutadapt/_version.py
+tag_prefix = v
+parentdir_prefix = cutadapt-
+
+[egg_info]
+tag_build =
+tag_date = 0
+tag_svn_revision = 0
+
diff --git a/setup.py b/setup.py
index 1a2d235..fa09b1c 100644
--- a/setup.py
+++ b/setup.py
@@ -1,18 +1,14 @@
"""
Build cutadapt.
-
-Cython is run when
-* no pre-generated C sources are found,
-* or the pre-generated C sources are out of date,
-* or when --cython is given on the command line.
"""
import sys
import os.path
-from distutils.core import setup, Extension
+from setuptools import setup, Extension
from distutils.version import LooseVersion
from distutils.command.sdist import sdist as _sdist
from distutils.command.build_ext import build_ext as _build_ext
+import versioneer
MIN_CYTHON_VERSION = '0.24'
@@ -21,14 +17,6 @@ if sys.version_info < (2, 6):
sys.exit(1)
-# set __version__
-with open(os.path.join(os.path.dirname(__file__), 'cutadapt', '__init__.py')) as f:
- for line in f:
- if line.startswith('__version__'):
- exec(line)
- break
-
-
def out_of_date(extensions):
"""
Check whether any pyx source is newer than the corresponding generated
@@ -95,8 +83,12 @@ extensions = [
Extension('cutadapt._seqio', sources=['cutadapt/_seqio.pyx']),
]
+cmdclass = versioneer.get_cmdclass()
+versioneer_build_ext = cmdclass.get('build_ext', _build_ext)
+versioneer_sdist = cmdclass.get('sdist', _sdist)
-class build_ext(_build_ext):
+
+class build_ext(versioneer_build_ext):
def run(self):
# If we encounter a PKG-INFO file, then this is likely a .tar.gz/.zip
# file retrieved from PyPI that already includes the pre-cythonized
@@ -109,27 +101,30 @@ class build_ext(_build_ext):
check_cython_version()
from Cython.Build import cythonize
self.extensions = cythonize(self.extensions)
- _build_ext.run(self)
+ versioneer_build_ext.run(self)
-class sdist(_sdist):
+class sdist(versioneer_sdist):
def run(self):
# Make sure the compiled Cython files in the distribution are up-to-date
from Cython.Build import cythonize
check_cython_version()
cythonize(extensions)
- _sdist.run(self)
+ versioneer_sdist.run(self)
+
+cmdclass['build_ext'] = build_ext
+cmdclass['sdist'] = sdist
setup(
name = 'cutadapt',
- version = __version__,
+ version = versioneer.get_version(),
author = 'Marcel Martin',
author_email = 'marcel.martin at scilifelab.se',
- url = 'https://cutadapt.readthedocs.org/',
+ url = 'https://cutadapt.readthedocs.io/',
description = 'trim adapters from high-throughput sequencing reads',
license = 'MIT',
- cmdclass = {'sdist': sdist, 'build_ext': build_ext},
+ cmdclass = cmdclass,
ext_modules = extensions,
packages = ['cutadapt', 'cutadapt.scripts'],
scripts = ['bin/cutadapt'],
@@ -140,7 +135,6 @@ setup(
"License :: OSI Approved :: MIT License",
"Natural Language :: English",
"Programming Language :: Cython",
- "Programming Language :: Python :: 2.6",
"Programming Language :: Python :: 2.7",
"Programming Language :: Python :: 3",
"Topic :: Scientific/Engineering :: Bio-Informatics"
diff --git a/tests/cut/SRR2040271_1.fastq b/tests/cut/SRR2040271_1.fastq
new file mode 100644
index 0000000..c324b4a
--- /dev/null
+++ b/tests/cut/SRR2040271_1.fastq
@@ -0,0 +1,8 @@
+ at SRR2040271.1 SN603_WBP007_8_1101_63.30_99.90 length=50
+NTCATTCCATGACATTGTCTGTTGGTTGCTTTTTGAGTATATTTTCTCAT
++SRR2040271.1 SN603_WBP007_8_1101_63.30_99.90 length=50
+!1=DDFFFGHHHHIJJJJJIIJJJGGHJGJIJJGBGGHEGHJIIIIEHIJ
+ at SRR2040271.2 SN603_WBP007_8_1101_79.90_99.30 length=20
+NTAAAGACCCTTCAACTCAG
++SRR2040271.2 SN603_WBP007_8_1101_79.90_99.30 length=20
+!4=BBDDDFHHHH at FHIIII
diff --git a/tests/data/SRR2040271_1.fastq b/tests/data/SRR2040271_1.fastq
new file mode 100644
index 0000000..f6d7e60
--- /dev/null
+++ b/tests/data/SRR2040271_1.fastq
@@ -0,0 +1,8 @@
+ at SRR2040271.1 SN603_WBP007_8_1101_63.30_99.90 length=100
+NTCATTCCATGACATTGTCTGTTGGTTGCTTTTTGAGTATATTTTCTCATGGCTTCATCTATCTTGCTCATAAGACTAAATGGGGAGACAGACTTCCTGG
++SRR2040271.1 SN603_WBP007_8_1101_63.30_99.90 length=100
+!1=DDFFFGHHHHIJJJJJIIJJJGGHJGJIJJGBGGHEGHJIIIIEHIJEH>@G;FHCG<<BCG:CG at F4@D@=@DG>EE>EED(,,(;((,;;@A>CC
+ at SRR2040271.2 SN603_WBP007_8_1101_79.90_99.30 length=100
+NTAAAGACCCTTCAACTCAGGGCTTCTGAACCCTGGCTACCCATTAGAATCACTTAGGGAGCTTTGAAAAATATCAACACCCCAGCCCTAACCCAGCCCA
++SRR2040271.2 SN603_WBP007_8_1101_79.90_99.30 length=100
+!4=BBDDDFHHHH at FHIIIIIIIIIGIIHGIIIIIIIIHIIIIIICEGGIIIIIIGHIIEGHIGIIIHHHFHEEEEEEECC=B=@BBBCCCBBBBA(88?
diff --git a/tests/testpaired.py b/tests/testpaired.py
index 51cc1d0..f3f687a 100644
--- a/tests/testpaired.py
+++ b/tests/testpaired.py
@@ -18,26 +18,29 @@ def run_paired(params, in1, in2, expected1, expected2):
assert files_equal(cutpath(expected2), p2)
-def run_interleaved(params, inpath, expected):
+def run_interleaved(params, inpath1, inpath2=None, expected1=None, expected2=None):
+ """
+ Interleaved input or output (or both)
+ """
+ assert not (inpath1 and inpath2 and expected1 and expected2)
+ assert not (expected2 and not expected1)
+ assert not (inpath2 and not inpath1)
if type(params) is str:
params = params.split()
- with temporary_path(expected) as tmp:
- params += ['--interleaved', '-o', tmp, datapath(inpath)]
- assert cutadapt.main(params) is None
- assert files_equal(cutpath(expected), tmp)
-
-
-def run_interleaved2(params, inpath, expected1, expected2):
- assert False # unused function
- if type(params) is str:
- params = params.split()
- with temporary_path('tmp1-' + expected1) as p1:
- with temporary_path('tmp2-' + expected2) as p2:
- params += ['--interleaved', '-o', p1, '-p', p2]
- params += [datapath(inpath)]
- assert cutadapt.main(params) is None
- assert files_equal(cutpath(expected), p1)
- assert files_equal(cutpath(expected), p2)
+ params += ['--interleaved']
+ with temporary_path('tmp1-' + expected1) as tmp1:
+ params += ['-o', tmp1]
+ paths = [datapath(inpath1)]
+ if inpath2:
+ paths += [datapath(inpath2)]
+ if expected2:
+ with temporary_path('tmp2-' + expected2) as tmp2:
+ params += ['-p', tmp2]
+ assert cutadapt.main(params + paths) is None
+ assert files_equal(cutpath(expected2), tmp2)
+ else:
+ assert cutadapt.main(params + paths) is None
+ assert files_equal(cutpath(expected1), tmp1)
def test_paired_separate():
@@ -109,7 +112,7 @@ def test_first_too_short():
with open(trunc1, 'w') as f:
f.writelines(lines)
with redirect_stderr():
- cutadapt.main('-a XX --paired-output out.fastq'.split() + [trunc1, datapath('paired.2.fastq')])
+ cutadapt.main('-a XX -o /dev/null --paired-output out.fastq'.split() + [trunc1, datapath('paired.2.fastq')])
@raises(SystemExit)
@@ -122,7 +125,7 @@ def test_second_too_short():
with open(trunc2, 'w') as f:
f.writelines(lines)
with redirect_stderr():
- cutadapt.main('-a XX --paired-output out.fastq'.split() + [datapath('paired.1.fastq'), trunc2])
+ cutadapt.main('-a XX -o /dev/null --paired-output out.fastq'.split() + [datapath('paired.1.fastq'), trunc2])
@raises(SystemExit)
@@ -138,6 +141,18 @@ def test_unmatched_read_names():
cutadapt.main('-a XX -o out1.fastq --paired-output out2.fastq'.split() + [swapped, datapath('paired.2.fastq')])
+ at raises(SystemExit)
+def test_p_without_o():
+ """Option -p given but -o missing"""
+ cutadapt.main('-a XX -p /dev/null'.split() + [datapath('paired.1.fastq'), datapath('paired.2.fastq')])
+
+
+ at raises(SystemExit)
+def test_paired_but_only_one_input_file():
+ """Option -p given but only one input file"""
+ cutadapt.main('-a XX -o /dev/null -p /dev/null'.split() + [datapath('paired.1.fastq')])
+
+
def test_legacy_minlength():
'''Ensure -m is not applied to second read in a pair in legacy mode'''
run_paired('-a XXX -m 27',
@@ -207,15 +222,32 @@ def test_discard_trimmed():
)
-def test_interleaved():
- '''single-pass interleaved paired-end with -q and -m'''
+def test_interleaved_in_and_out():
+ '''Single-pass interleaved paired-end with -q and -m'''
run_interleaved('-q 20 -a TTAGACATAT -A CAGTGGAGTA -m 14 -M 90',
- inpath='interleaved.fastq', expected='interleaved.fastq'
+ inpath1='interleaved.fastq', expected1='interleaved.fastq'
+ )
+
+
+def test_interleaved_in():
+ '''Interleaved input, two files output'''
+ run_interleaved('-q 20 -a TTAGACATAT -A CAGTGGAGTA -m 14 -M 90',
+ inpath1='interleaved.fastq',
+ expected1='pairedq.1.fastq', expected2='pairedq.2.fastq'
+ )
+
+
+def test_interleaved_out():
+ '''Two files input, interleaved output'''
+ run_interleaved('-q 20 -a TTAGACATAT -A CAGTGGAGTA -m 14 -M 90',
+ inpath1='paired.1.fastq', inpath2='paired.2.fastq',
+ expected1='interleaved.fastq'
)
@raises(SystemExit)
-def test_interleaved_no_paired_output():
+def test_interleaved_neither_nor():
+ """Option --interleaved used, but pairs of files given for input and output"""
with temporary_path("temp-paired.1.fastq") as p1:
with temporary_path("temp-paired.2.fastq") as p2:
params = '-a XX --interleaved'.split()
@@ -223,14 +255,6 @@ def test_interleaved_no_paired_output():
params += [ '-o', p1, '-p1', p2, 'paired.1.fastq', 'paired.2.fastq']
cutadapt.main(params)
-"""
-def test_interleaved_input_paired_output():
- '''single-pass interleaved paired-end with -q and -m, paired output'''
- run_interleaved2('-q 20 -a TTAGACATAT -A CAGTGGAGTA -m 14 -M 90',
- inpath='interleaved.fastq', expected1='pairedq1.fastq', expected2='pairedq2.fastq'
- )
-"""
-
def test_pair_filter():
run_paired('--pair-filter=both -a TTAGACATAT -A GGAGTA -m 14',
diff --git a/tests/tests.py b/tests/tests.py
index 241e169..12bc2ae 100644
--- a/tests/tests.py
+++ b/tests/tests.py
@@ -381,3 +381,8 @@ def test_linked():
def test_fasta():
run('-a TTAGACATATCTCCGTCG', 'small.fasta', 'small.fastq')
+
+
+def test_issue_202():
+ """Ensure --length-tag= also modifies the second header line"""
+ run('-a GGCTTC --length-tag=length=', 'SRR2040271_1.fastq', 'SRR2040271_1.fastq')
diff --git a/tests/testseqio.py b/tests/testseqio.py
index ef8b0b6..063d08e 100644
--- a/tests/testseqio.py
+++ b/tests/testseqio.py
@@ -308,8 +308,8 @@ class TestFastqWriter:
def test_twoheaders(self):
with FastqWriter(self.path) as fq:
- fq.write(Sequence("name", "CCATA", "!#!#!", name2="name"))
- fq.write(Sequence("name2", "HELLO", "&&&!&", name2="name2"))
+ fq.write(Sequence("name", "CCATA", "!#!#!", second_header=True))
+ fq.write(Sequence("name2", "HELLO", "&&&!&", second_header=True))
assert fq._file.closed
with open(self.path) as t:
assert t.read() == '@name\nCCATA\n+name\n!#!#!\n at name2\nHELLO\n+name2\n&&&!&\n'
diff --git a/versioneer.py b/versioneer.py
new file mode 100644
index 0000000..7ed2a21
--- /dev/null
+++ b/versioneer.py
@@ -0,0 +1,1774 @@
+
+# Version: 0.16
+
+"""The Versioneer - like a rocketeer, but for versions.
+
+The Versioneer
+==============
+
+* like a rocketeer, but for versions!
+* https://github.com/warner/python-versioneer
+* Brian Warner
+* License: Public Domain
+* Compatible With: python2.6, 2.7, 3.3, 3.4, 3.5, and pypy
+* [![Latest Version]
+(https://pypip.in/version/versioneer/badge.svg?style=flat)
+](https://pypi.python.org/pypi/versioneer/)
+* [![Build Status]
+(https://travis-ci.org/warner/python-versioneer.png?branch=master)
+](https://travis-ci.org/warner/python-versioneer)
+
+This is a tool for managing a recorded version number in distutils-based
+python projects. The goal is to remove the tedious and error-prone "update
+the embedded version string" step from your release process. Making a new
+release should be as easy as recording a new tag in your version-control
+system, and maybe making new tarballs.
+
+
+## Quick Install
+
+* `pip install versioneer` to somewhere to your $PATH
+* add a `[versioneer]` section to your setup.cfg (see below)
+* run `versioneer install` in your source tree, commit the results
+
+## Version Identifiers
+
+Source trees come from a variety of places:
+
+* a version-control system checkout (mostly used by developers)
+* a nightly tarball, produced by build automation
+* a snapshot tarball, produced by a web-based VCS browser, like github's
+ "tarball from tag" feature
+* a release tarball, produced by "setup.py sdist", distributed through PyPI
+
+Within each source tree, the version identifier (either a string or a number,
+this tool is format-agnostic) can come from a variety of places:
+
+* ask the VCS tool itself, e.g. "git describe" (for checkouts), which knows
+ about recent "tags" and an absolute revision-id
+* the name of the directory into which the tarball was unpacked
+* an expanded VCS keyword ($Id$, etc)
+* a `_version.py` created by some earlier build step
+
+For released software, the version identifier is closely related to a VCS
+tag. Some projects use tag names that include more than just the version
+string (e.g. "myproject-1.2" instead of just "1.2"), in which case the tool
+needs to strip the tag prefix to extract the version identifier. For
+unreleased software (between tags), the version identifier should provide
+enough information to help developers recreate the same tree, while also
+giving them an idea of roughly how old the tree is (after version 1.2, before
+version 1.3). Many VCS systems can report a description that captures this,
+for example `git describe --tags --dirty --always` reports things like
+"0.7-1-g574ab98-dirty" to indicate that the checkout is one revision past the
+0.7 tag, has a unique revision id of "574ab98", and is "dirty" (it has
+uncommitted changes.
+
+The version identifier is used for multiple purposes:
+
+* to allow the module to self-identify its version: `myproject.__version__`
+* to choose a name and prefix for a 'setup.py sdist' tarball
+
+## Theory of Operation
+
+Versioneer works by adding a special `_version.py` file into your source
+tree, where your `__init__.py` can import it. This `_version.py` knows how to
+dynamically ask the VCS tool for version information at import time.
+
+`_version.py` also contains `$Revision$` markers, and the installation
+process marks `_version.py` to have this marker rewritten with a tag name
+during the `git archive` command. As a result, generated tarballs will
+contain enough information to get the proper version.
+
+To allow `setup.py` to compute a version too, a `versioneer.py` is added to
+the top level of your source tree, next to `setup.py` and the `setup.cfg`
+that configures it. This overrides several distutils/setuptools commands to
+compute the version when invoked, and changes `setup.py build` and `setup.py
+sdist` to replace `_version.py` with a small static file that contains just
+the generated version data.
+
+## Installation
+
+First, decide on values for the following configuration variables:
+
+* `VCS`: the version control system you use. Currently accepts "git".
+
+* `style`: the style of version string to be produced. See "Styles" below for
+ details. Defaults to "pep440", which looks like
+ `TAG[+DISTANCE.gSHORTHASH[.dirty]]`.
+
+* `versionfile_source`:
+
+ A project-relative pathname into which the generated version strings should
+ be written. This is usually a `_version.py` next to your project's main
+ `__init__.py` file, so it can be imported at runtime. If your project uses
+ `src/myproject/__init__.py`, this should be `src/myproject/_version.py`.
+ This file should be checked in to your VCS as usual: the copy created below
+ by `setup.py setup_versioneer` will include code that parses expanded VCS
+ keywords in generated tarballs. The 'build' and 'sdist' commands will
+ replace it with a copy that has just the calculated version string.
+
+ This must be set even if your project does not have any modules (and will
+ therefore never import `_version.py`), since "setup.py sdist" -based trees
+ still need somewhere to record the pre-calculated version strings. Anywhere
+ in the source tree should do. If there is a `__init__.py` next to your
+ `_version.py`, the `setup.py setup_versioneer` command (described below)
+ will append some `__version__`-setting assignments, if they aren't already
+ present.
+
+* `versionfile_build`:
+
+ Like `versionfile_source`, but relative to the build directory instead of
+ the source directory. These will differ when your setup.py uses
+ 'package_dir='. If you have `package_dir={'myproject': 'src/myproject'}`,
+ then you will probably have `versionfile_build='myproject/_version.py'` and
+ `versionfile_source='src/myproject/_version.py'`.
+
+ If this is set to None, then `setup.py build` will not attempt to rewrite
+ any `_version.py` in the built tree. If your project does not have any
+ libraries (e.g. if it only builds a script), then you should use
+ `versionfile_build = None`. To actually use the computed version string,
+ your `setup.py` will need to override `distutils.command.build_scripts`
+ with a subclass that explicitly inserts a copy of
+ `versioneer.get_version()` into your script file. See
+ `test/demoapp-script-only/setup.py` for an example.
+
+* `tag_prefix`:
+
+ a string, like 'PROJECTNAME-', which appears at the start of all VCS tags.
+ If your tags look like 'myproject-1.2.0', then you should use
+ tag_prefix='myproject-'. If you use unprefixed tags like '1.2.0', this
+ should be an empty string, using either `tag_prefix=` or `tag_prefix=''`.
+
+* `parentdir_prefix`:
+
+ a optional string, frequently the same as tag_prefix, which appears at the
+ start of all unpacked tarball filenames. If your tarball unpacks into
+ 'myproject-1.2.0', this should be 'myproject-'. To disable this feature,
+ just omit the field from your `setup.cfg`.
+
+This tool provides one script, named `versioneer`. That script has one mode,
+"install", which writes a copy of `versioneer.py` into the current directory
+and runs `versioneer.py setup` to finish the installation.
+
+To versioneer-enable your project:
+
+* 1: Modify your `setup.cfg`, adding a section named `[versioneer]` and
+ populating it with the configuration values you decided earlier (note that
+ the option names are not case-sensitive):
+
+ ````
+ [versioneer]
+ VCS = git
+ style = pep440
+ versionfile_source = src/myproject/_version.py
+ versionfile_build = myproject/_version.py
+ tag_prefix =
+ parentdir_prefix = myproject-
+ ````
+
+* 2: Run `versioneer install`. This will do the following:
+
+ * copy `versioneer.py` into the top of your source tree
+ * create `_version.py` in the right place (`versionfile_source`)
+ * modify your `__init__.py` (if one exists next to `_version.py`) to define
+ `__version__` (by calling a function from `_version.py`)
+ * modify your `MANIFEST.in` to include both `versioneer.py` and the
+ generated `_version.py` in sdist tarballs
+
+ `versioneer install` will complain about any problems it finds with your
+ `setup.py` or `setup.cfg`. Run it multiple times until you have fixed all
+ the problems.
+
+* 3: add a `import versioneer` to your setup.py, and add the following
+ arguments to the setup() call:
+
+ version=versioneer.get_version(),
+ cmdclass=versioneer.get_cmdclass(),
+
+* 4: commit these changes to your VCS. To make sure you won't forget,
+ `versioneer install` will mark everything it touched for addition using
+ `git add`. Don't forget to add `setup.py` and `setup.cfg` too.
+
+## Post-Installation Usage
+
+Once established, all uses of your tree from a VCS checkout should get the
+current version string. All generated tarballs should include an embedded
+version string (so users who unpack them will not need a VCS tool installed).
+
+If you distribute your project through PyPI, then the release process should
+boil down to two steps:
+
+* 1: git tag 1.0
+* 2: python setup.py register sdist upload
+
+If you distribute it through github (i.e. users use github to generate
+tarballs with `git archive`), the process is:
+
+* 1: git tag 1.0
+* 2: git push; git push --tags
+
+Versioneer will report "0+untagged.NUMCOMMITS.gHASH" until your tree has at
+least one tag in its history.
+
+## Version-String Flavors
+
+Code which uses Versioneer can learn about its version string at runtime by
+importing `_version` from your main `__init__.py` file and running the
+`get_versions()` function. From the "outside" (e.g. in `setup.py`), you can
+import the top-level `versioneer.py` and run `get_versions()`.
+
+Both functions return a dictionary with different flavors of version
+information:
+
+* `['version']`: A condensed version string, rendered using the selected
+ style. This is the most commonly used value for the project's version
+ string. The default "pep440" style yields strings like `0.11`,
+ `0.11+2.g1076c97`, or `0.11+2.g1076c97.dirty`. See the "Styles" section
+ below for alternative styles.
+
+* `['full-revisionid']`: detailed revision identifier. For Git, this is the
+ full SHA1 commit id, e.g. "1076c978a8d3cfc70f408fe5974aa6c092c949ac".
+
+* `['dirty']`: a boolean, True if the tree has uncommitted changes. Note that
+ this is only accurate if run in a VCS checkout, otherwise it is likely to
+ be False or None
+
+* `['error']`: if the version string could not be computed, this will be set
+ to a string describing the problem, otherwise it will be None. It may be
+ useful to throw an exception in setup.py if this is set, to avoid e.g.
+ creating tarballs with a version string of "unknown".
+
+Some variants are more useful than others. Including `full-revisionid` in a
+bug report should allow developers to reconstruct the exact code being tested
+(or indicate the presence of local changes that should be shared with the
+developers). `version` is suitable for display in an "about" box or a CLI
+`--version` output: it can be easily compared against release notes and lists
+of bugs fixed in various releases.
+
+The installer adds the following text to your `__init__.py` to place a basic
+version in `YOURPROJECT.__version__`:
+
+ from ._version import get_versions
+ __version__ = get_versions()['version']
+ del get_versions
+
+## Styles
+
+The setup.cfg `style=` configuration controls how the VCS information is
+rendered into a version string.
+
+The default style, "pep440", produces a PEP440-compliant string, equal to the
+un-prefixed tag name for actual releases, and containing an additional "local
+version" section with more detail for in-between builds. For Git, this is
+TAG[+DISTANCE.gHEX[.dirty]] , using information from `git describe --tags
+--dirty --always`. For example "0.11+2.g1076c97.dirty" indicates that the
+tree is like the "1076c97" commit but has uncommitted changes (".dirty"), and
+that this commit is two revisions ("+2") beyond the "0.11" tag. For released
+software (exactly equal to a known tag), the identifier will only contain the
+stripped tag, e.g. "0.11".
+
+Other styles are available. See details.md in the Versioneer source tree for
+descriptions.
+
+## Debugging
+
+Versioneer tries to avoid fatal errors: if something goes wrong, it will tend
+to return a version of "0+unknown". To investigate the problem, run `setup.py
+version`, which will run the version-lookup code in a verbose mode, and will
+display the full contents of `get_versions()` (including the `error` string,
+which may help identify what went wrong).
+
+## Updating Versioneer
+
+To upgrade your project to a new release of Versioneer, do the following:
+
+* install the new Versioneer (`pip install -U versioneer` or equivalent)
+* edit `setup.cfg`, if necessary, to include any new configuration settings
+ indicated by the release notes
+* re-run `versioneer install` in your source tree, to replace
+ `SRC/_version.py`
+* commit any changed files
+
+### Upgrading to 0.16
+
+Nothing special.
+
+### Upgrading to 0.15
+
+Starting with this version, Versioneer is configured with a `[versioneer]`
+section in your `setup.cfg` file. Earlier versions required the `setup.py` to
+set attributes on the `versioneer` module immediately after import. The new
+version will refuse to run (raising an exception during import) until you
+have provided the necessary `setup.cfg` section.
+
+In addition, the Versioneer package provides an executable named
+`versioneer`, and the installation process is driven by running `versioneer
+install`. In 0.14 and earlier, the executable was named
+`versioneer-installer` and was run without an argument.
+
+### Upgrading to 0.14
+
+0.14 changes the format of the version string. 0.13 and earlier used
+hyphen-separated strings like "0.11-2-g1076c97-dirty". 0.14 and beyond use a
+plus-separated "local version" section strings, with dot-separated
+components, like "0.11+2.g1076c97". PEP440-strict tools did not like the old
+format, but should be ok with the new one.
+
+### Upgrading from 0.11 to 0.12
+
+Nothing special.
+
+### Upgrading from 0.10 to 0.11
+
+You must add a `versioneer.VCS = "git"` to your `setup.py` before re-running
+`setup.py setup_versioneer`. This will enable the use of additional
+version-control systems (SVN, etc) in the future.
+
+## Future Directions
+
+This tool is designed to make it easily extended to other version-control
+systems: all VCS-specific components are in separate directories like
+src/git/ . The top-level `versioneer.py` script is assembled from these
+components by running make-versioneer.py . In the future, make-versioneer.py
+will take a VCS name as an argument, and will construct a version of
+`versioneer.py` that is specific to the given VCS. It might also take the
+configuration arguments that are currently provided manually during
+installation by editing setup.py . Alternatively, it might go the other
+direction and include code from all supported VCS systems, reducing the
+number of intermediate scripts.
+
+
+## License
+
+To make Versioneer easier to embed, all its code is dedicated to the public
+domain. The `_version.py` that it creates is also in the public domain.
+Specifically, both are released under the Creative Commons "Public Domain
+Dedication" license (CC0-1.0), as described in
+https://creativecommons.org/publicdomain/zero/1.0/ .
+
+"""
+
+from __future__ import print_function
+try:
+ import configparser
+except ImportError:
+ import ConfigParser as configparser
+import errno
+import json
+import os
+import re
+import subprocess
+import sys
+
+
+class VersioneerConfig:
+ """Container for Versioneer configuration parameters."""
+
+
+def get_root():
+ """Get the project root directory.
+
+ We require that all commands are run from the project root, i.e. the
+ directory that contains setup.py, setup.cfg, and versioneer.py .
+ """
+ root = os.path.realpath(os.path.abspath(os.getcwd()))
+ setup_py = os.path.join(root, "setup.py")
+ versioneer_py = os.path.join(root, "versioneer.py")
+ if not (os.path.exists(setup_py) or os.path.exists(versioneer_py)):
+ # allow 'python path/to/setup.py COMMAND'
+ root = os.path.dirname(os.path.realpath(os.path.abspath(sys.argv[0])))
+ setup_py = os.path.join(root, "setup.py")
+ versioneer_py = os.path.join(root, "versioneer.py")
+ if not (os.path.exists(setup_py) or os.path.exists(versioneer_py)):
+ err = ("Versioneer was unable to run the project root directory. "
+ "Versioneer requires setup.py to be executed from "
+ "its immediate directory (like 'python setup.py COMMAND'), "
+ "or in a way that lets it use sys.argv[0] to find the root "
+ "(like 'python path/to/setup.py COMMAND').")
+ raise VersioneerBadRootError(err)
+ try:
+ # Certain runtime workflows (setup.py install/develop in a setuptools
+ # tree) execute all dependencies in a single python process, so
+ # "versioneer" may be imported multiple times, and python's shared
+ # module-import table will cache the first one. So we can't use
+ # os.path.dirname(__file__), as that will find whichever
+ # versioneer.py was first imported, even in later projects.
+ me = os.path.realpath(os.path.abspath(__file__))
+ if os.path.splitext(me)[0] != os.path.splitext(versioneer_py)[0]:
+ print("Warning: build in %s is using versioneer.py from %s"
+ % (os.path.dirname(me), versioneer_py))
+ except NameError:
+ pass
+ return root
+
+
+def get_config_from_root(root):
+ """Read the project setup.cfg file to determine Versioneer config."""
+ # This might raise EnvironmentError (if setup.cfg is missing), or
+ # configparser.NoSectionError (if it lacks a [versioneer] section), or
+ # configparser.NoOptionError (if it lacks "VCS="). See the docstring at
+ # the top of versioneer.py for instructions on writing your setup.cfg .
+ setup_cfg = os.path.join(root, "setup.cfg")
+ parser = configparser.SafeConfigParser()
+ with open(setup_cfg, "r") as f:
+ parser.readfp(f)
+ VCS = parser.get("versioneer", "VCS") # mandatory
+
+ def get(parser, name):
+ if parser.has_option("versioneer", name):
+ return parser.get("versioneer", name)
+ return None
+ cfg = VersioneerConfig()
+ cfg.VCS = VCS
+ cfg.style = get(parser, "style") or ""
+ cfg.versionfile_source = get(parser, "versionfile_source")
+ cfg.versionfile_build = get(parser, "versionfile_build")
+ cfg.tag_prefix = get(parser, "tag_prefix")
+ if cfg.tag_prefix in ("''", '""'):
+ cfg.tag_prefix = ""
+ cfg.parentdir_prefix = get(parser, "parentdir_prefix")
+ cfg.verbose = get(parser, "verbose")
+ return cfg
+
+
+class NotThisMethod(Exception):
+ """Exception raised if a method is not valid for the current scenario."""
+
+# these dictionaries contain VCS-specific tools
+LONG_VERSION_PY = {}
+HANDLERS = {}
+
+
+def register_vcs_handler(vcs, method): # decorator
+ """Decorator to mark a method as the handler for a particular VCS."""
+ def decorate(f):
+ """Store f in HANDLERS[vcs][method]."""
+ if vcs not in HANDLERS:
+ HANDLERS[vcs] = {}
+ HANDLERS[vcs][method] = f
+ return f
+ return decorate
+
+
+def run_command(commands, args, cwd=None, verbose=False, hide_stderr=False):
+ """Call the given command(s)."""
+ assert isinstance(commands, list)
+ p = None
+ for c in commands:
+ try:
+ dispcmd = str([c] + args)
+ # remember shell=False, so use git.cmd on windows, not just git
+ p = subprocess.Popen([c] + args, cwd=cwd, stdout=subprocess.PIPE,
+ stderr=(subprocess.PIPE if hide_stderr
+ else None))
+ break
+ except EnvironmentError:
+ e = sys.exc_info()[1]
+ if e.errno == errno.ENOENT:
+ continue
+ if verbose:
+ print("unable to run %s" % dispcmd)
+ print(e)
+ return None
+ else:
+ if verbose:
+ print("unable to find command, tried %s" % (commands,))
+ return None
+ stdout = p.communicate()[0].strip()
+ if sys.version_info[0] >= 3:
+ stdout = stdout.decode()
+ if p.returncode != 0:
+ if verbose:
+ print("unable to run %s (error)" % dispcmd)
+ return None
+ return stdout
+LONG_VERSION_PY['git'] = '''
+# This file helps to compute a version number in source trees obtained from
+# git-archive tarball (such as those provided by githubs download-from-tag
+# feature). Distribution tarballs (built by setup.py sdist) and build
+# directories (produced by setup.py build) will contain a much shorter file
+# that just contains the computed version number.
+
+# This file is released into the public domain. Generated by
+# versioneer-0.16 (https://github.com/warner/python-versioneer)
+
+"""Git implementation of _version.py."""
+
+import errno
+import os
+import re
+import subprocess
+import sys
+
+
+def get_keywords():
+ """Get the keywords needed to look up the version information."""
+ # these strings will be replaced by git during git-archive.
+ # setup.py/versioneer.py will grep for the variable names, so they must
+ # each be defined on a line of their own. _version.py will just call
+ # get_keywords().
+ git_refnames = "%(DOLLAR)sFormat:%%d%(DOLLAR)s"
+ git_full = "%(DOLLAR)sFormat:%%H%(DOLLAR)s"
+ keywords = {"refnames": git_refnames, "full": git_full}
+ return keywords
+
+
+class VersioneerConfig:
+ """Container for Versioneer configuration parameters."""
+
+
+def get_config():
+ """Create, populate and return the VersioneerConfig() object."""
+ # these strings are filled in when 'setup.py versioneer' creates
+ # _version.py
+ cfg = VersioneerConfig()
+ cfg.VCS = "git"
+ cfg.style = "%(STYLE)s"
+ cfg.tag_prefix = "%(TAG_PREFIX)s"
+ cfg.parentdir_prefix = "%(PARENTDIR_PREFIX)s"
+ cfg.versionfile_source = "%(VERSIONFILE_SOURCE)s"
+ cfg.verbose = False
+ return cfg
+
+
+class NotThisMethod(Exception):
+ """Exception raised if a method is not valid for the current scenario."""
+
+
+LONG_VERSION_PY = {}
+HANDLERS = {}
+
+
+def register_vcs_handler(vcs, method): # decorator
+ """Decorator to mark a method as the handler for a particular VCS."""
+ def decorate(f):
+ """Store f in HANDLERS[vcs][method]."""
+ if vcs not in HANDLERS:
+ HANDLERS[vcs] = {}
+ HANDLERS[vcs][method] = f
+ return f
+ return decorate
+
+
+def run_command(commands, args, cwd=None, verbose=False, hide_stderr=False):
+ """Call the given command(s)."""
+ assert isinstance(commands, list)
+ p = None
+ for c in commands:
+ try:
+ dispcmd = str([c] + args)
+ # remember shell=False, so use git.cmd on windows, not just git
+ p = subprocess.Popen([c] + args, cwd=cwd, stdout=subprocess.PIPE,
+ stderr=(subprocess.PIPE if hide_stderr
+ else None))
+ break
+ except EnvironmentError:
+ e = sys.exc_info()[1]
+ if e.errno == errno.ENOENT:
+ continue
+ if verbose:
+ print("unable to run %%s" %% dispcmd)
+ print(e)
+ return None
+ else:
+ if verbose:
+ print("unable to find command, tried %%s" %% (commands,))
+ return None
+ stdout = p.communicate()[0].strip()
+ if sys.version_info[0] >= 3:
+ stdout = stdout.decode()
+ if p.returncode != 0:
+ if verbose:
+ print("unable to run %%s (error)" %% dispcmd)
+ return None
+ return stdout
+
+
+def versions_from_parentdir(parentdir_prefix, root, verbose):
+ """Try to determine the version from the parent directory name.
+
+ Source tarballs conventionally unpack into a directory that includes
+ both the project name and a version string.
+ """
+ dirname = os.path.basename(root)
+ if not dirname.startswith(parentdir_prefix):
+ if verbose:
+ print("guessing rootdir is '%%s', but '%%s' doesn't start with "
+ "prefix '%%s'" %% (root, dirname, parentdir_prefix))
+ raise NotThisMethod("rootdir doesn't start with parentdir_prefix")
+ return {"version": dirname[len(parentdir_prefix):],
+ "full-revisionid": None,
+ "dirty": False, "error": None}
+
+
+ at register_vcs_handler("git", "get_keywords")
+def git_get_keywords(versionfile_abs):
+ """Extract version information from the given file."""
+ # the code embedded in _version.py can just fetch the value of these
+ # keywords. When used from setup.py, we don't want to import _version.py,
+ # so we do it with a regexp instead. This function is not used from
+ # _version.py.
+ keywords = {}
+ try:
+ f = open(versionfile_abs, "r")
+ for line in f.readlines():
+ if line.strip().startswith("git_refnames ="):
+ mo = re.search(r'=\s*"(.*)"', line)
+ if mo:
+ keywords["refnames"] = mo.group(1)
+ if line.strip().startswith("git_full ="):
+ mo = re.search(r'=\s*"(.*)"', line)
+ if mo:
+ keywords["full"] = mo.group(1)
+ f.close()
+ except EnvironmentError:
+ pass
+ return keywords
+
+
+ at register_vcs_handler("git", "keywords")
+def git_versions_from_keywords(keywords, tag_prefix, verbose):
+ """Get version information from git keywords."""
+ if not keywords:
+ raise NotThisMethod("no keywords at all, weird")
+ refnames = keywords["refnames"].strip()
+ if refnames.startswith("$Format"):
+ if verbose:
+ print("keywords are unexpanded, not using")
+ raise NotThisMethod("unexpanded keywords, not a git-archive tarball")
+ refs = set([r.strip() for r in refnames.strip("()").split(",")])
+ # starting in git-1.8.3, tags are listed as "tag: foo-1.0" instead of
+ # just "foo-1.0". If we see a "tag: " prefix, prefer those.
+ TAG = "tag: "
+ tags = set([r[len(TAG):] for r in refs if r.startswith(TAG)])
+ if not tags:
+ # Either we're using git < 1.8.3, or there really are no tags. We use
+ # a heuristic: assume all version tags have a digit. The old git %%d
+ # expansion behaves like git log --decorate=short and strips out the
+ # refs/heads/ and refs/tags/ prefixes that would let us distinguish
+ # between branches and tags. By ignoring refnames without digits, we
+ # filter out many common branch names like "release" and
+ # "stabilization", as well as "HEAD" and "master".
+ tags = set([r for r in refs if re.search(r'\d', r)])
+ if verbose:
+ print("discarding '%%s', no digits" %% ",".join(refs-tags))
+ if verbose:
+ print("likely tags: %%s" %% ",".join(sorted(tags)))
+ for ref in sorted(tags):
+ # sorting will prefer e.g. "2.0" over "2.0rc1"
+ if ref.startswith(tag_prefix):
+ r = ref[len(tag_prefix):]
+ if verbose:
+ print("picking %%s" %% r)
+ return {"version": r,
+ "full-revisionid": keywords["full"].strip(),
+ "dirty": False, "error": None
+ }
+ # no suitable tags, so version is "0+unknown", but full hex is still there
+ if verbose:
+ print("no suitable tags, using unknown + full revision id")
+ return {"version": "0+unknown",
+ "full-revisionid": keywords["full"].strip(),
+ "dirty": False, "error": "no suitable tags"}
+
+
+ at register_vcs_handler("git", "pieces_from_vcs")
+def git_pieces_from_vcs(tag_prefix, root, verbose, run_command=run_command):
+ """Get version from 'git describe' in the root of the source tree.
+
+ This only gets called if the git-archive 'subst' keywords were *not*
+ expanded, and _version.py hasn't already been rewritten with a short
+ version string, meaning we're inside a checked out source tree.
+ """
+ if not os.path.exists(os.path.join(root, ".git")):
+ if verbose:
+ print("no .git in %%s" %% root)
+ raise NotThisMethod("no .git directory")
+
+ GITS = ["git"]
+ if sys.platform == "win32":
+ GITS = ["git.cmd", "git.exe"]
+ # if there is a tag matching tag_prefix, this yields TAG-NUM-gHEX[-dirty]
+ # if there isn't one, this yields HEX[-dirty] (no NUM)
+ describe_out = run_command(GITS, ["describe", "--tags", "--dirty",
+ "--always", "--long",
+ "--match", "%%s*" %% tag_prefix],
+ cwd=root)
+ # --long was added in git-1.5.5
+ if describe_out is None:
+ raise NotThisMethod("'git describe' failed")
+ describe_out = describe_out.strip()
+ full_out = run_command(GITS, ["rev-parse", "HEAD"], cwd=root)
+ if full_out is None:
+ raise NotThisMethod("'git rev-parse' failed")
+ full_out = full_out.strip()
+
+ pieces = {}
+ pieces["long"] = full_out
+ pieces["short"] = full_out[:7] # maybe improved later
+ pieces["error"] = None
+
+ # parse describe_out. It will be like TAG-NUM-gHEX[-dirty] or HEX[-dirty]
+ # TAG might have hyphens.
+ git_describe = describe_out
+
+ # look for -dirty suffix
+ dirty = git_describe.endswith("-dirty")
+ pieces["dirty"] = dirty
+ if dirty:
+ git_describe = git_describe[:git_describe.rindex("-dirty")]
+
+ # now we have TAG-NUM-gHEX or HEX
+
+ if "-" in git_describe:
+ # TAG-NUM-gHEX
+ mo = re.search(r'^(.+)-(\d+)-g([0-9a-f]+)$', git_describe)
+ if not mo:
+ # unparseable. Maybe git-describe is misbehaving?
+ pieces["error"] = ("unable to parse git-describe output: '%%s'"
+ %% describe_out)
+ return pieces
+
+ # tag
+ full_tag = mo.group(1)
+ if not full_tag.startswith(tag_prefix):
+ if verbose:
+ fmt = "tag '%%s' doesn't start with prefix '%%s'"
+ print(fmt %% (full_tag, tag_prefix))
+ pieces["error"] = ("tag '%%s' doesn't start with prefix '%%s'"
+ %% (full_tag, tag_prefix))
+ return pieces
+ pieces["closest-tag"] = full_tag[len(tag_prefix):]
+
+ # distance: number of commits since tag
+ pieces["distance"] = int(mo.group(2))
+
+ # commit: short hex revision ID
+ pieces["short"] = mo.group(3)
+
+ else:
+ # HEX: no tags
+ pieces["closest-tag"] = None
+ count_out = run_command(GITS, ["rev-list", "HEAD", "--count"],
+ cwd=root)
+ pieces["distance"] = int(count_out) # total number of commits
+
+ return pieces
+
+
+def plus_or_dot(pieces):
+ """Return a + if we don't already have one, else return a ."""
+ if "+" in pieces.get("closest-tag", ""):
+ return "."
+ return "+"
+
+
+def render_pep440(pieces):
+ """Build up version string, with post-release "local version identifier".
+
+ Our goal: TAG[+DISTANCE.gHEX[.dirty]] . Note that if you
+ get a tagged build and then dirty it, you'll get TAG+0.gHEX.dirty
+
+ Exceptions:
+ 1: no tags. git_describe was just HEX. 0+untagged.DISTANCE.gHEX[.dirty]
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ if pieces["distance"] or pieces["dirty"]:
+ rendered += plus_or_dot(pieces)
+ rendered += "%%d.g%%s" %% (pieces["distance"], pieces["short"])
+ if pieces["dirty"]:
+ rendered += ".dirty"
+ else:
+ # exception #1
+ rendered = "0+untagged.%%d.g%%s" %% (pieces["distance"],
+ pieces["short"])
+ if pieces["dirty"]:
+ rendered += ".dirty"
+ return rendered
+
+
+def render_pep440_pre(pieces):
+ """TAG[.post.devDISTANCE] -- No -dirty.
+
+ Exceptions:
+ 1: no tags. 0.post.devDISTANCE
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ if pieces["distance"]:
+ rendered += ".post.dev%%d" %% pieces["distance"]
+ else:
+ # exception #1
+ rendered = "0.post.dev%%d" %% pieces["distance"]
+ return rendered
+
+
+def render_pep440_post(pieces):
+ """TAG[.postDISTANCE[.dev0]+gHEX] .
+
+ The ".dev0" means dirty. Note that .dev0 sorts backwards
+ (a dirty tree will appear "older" than the corresponding clean one),
+ but you shouldn't be releasing software with -dirty anyways.
+
+ Exceptions:
+ 1: no tags. 0.postDISTANCE[.dev0]
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ if pieces["distance"] or pieces["dirty"]:
+ rendered += ".post%%d" %% pieces["distance"]
+ if pieces["dirty"]:
+ rendered += ".dev0"
+ rendered += plus_or_dot(pieces)
+ rendered += "g%%s" %% pieces["short"]
+ else:
+ # exception #1
+ rendered = "0.post%%d" %% pieces["distance"]
+ if pieces["dirty"]:
+ rendered += ".dev0"
+ rendered += "+g%%s" %% pieces["short"]
+ return rendered
+
+
+def render_pep440_old(pieces):
+ """TAG[.postDISTANCE[.dev0]] .
+
+ The ".dev0" means dirty.
+
+ Eexceptions:
+ 1: no tags. 0.postDISTANCE[.dev0]
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ if pieces["distance"] or pieces["dirty"]:
+ rendered += ".post%%d" %% pieces["distance"]
+ if pieces["dirty"]:
+ rendered += ".dev0"
+ else:
+ # exception #1
+ rendered = "0.post%%d" %% pieces["distance"]
+ if pieces["dirty"]:
+ rendered += ".dev0"
+ return rendered
+
+
+def render_git_describe(pieces):
+ """TAG[-DISTANCE-gHEX][-dirty].
+
+ Like 'git describe --tags --dirty --always'.
+
+ Exceptions:
+ 1: no tags. HEX[-dirty] (note: no 'g' prefix)
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ if pieces["distance"]:
+ rendered += "-%%d-g%%s" %% (pieces["distance"], pieces["short"])
+ else:
+ # exception #1
+ rendered = pieces["short"]
+ if pieces["dirty"]:
+ rendered += "-dirty"
+ return rendered
+
+
+def render_git_describe_long(pieces):
+ """TAG-DISTANCE-gHEX[-dirty].
+
+ Like 'git describe --tags --dirty --always -long'.
+ The distance/hash is unconditional.
+
+ Exceptions:
+ 1: no tags. HEX[-dirty] (note: no 'g' prefix)
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ rendered += "-%%d-g%%s" %% (pieces["distance"], pieces["short"])
+ else:
+ # exception #1
+ rendered = pieces["short"]
+ if pieces["dirty"]:
+ rendered += "-dirty"
+ return rendered
+
+
+def render(pieces, style):
+ """Render the given version pieces into the requested style."""
+ if pieces["error"]:
+ return {"version": "unknown",
+ "full-revisionid": pieces.get("long"),
+ "dirty": None,
+ "error": pieces["error"]}
+
+ if not style or style == "default":
+ style = "pep440" # the default
+
+ if style == "pep440":
+ rendered = render_pep440(pieces)
+ elif style == "pep440-pre":
+ rendered = render_pep440_pre(pieces)
+ elif style == "pep440-post":
+ rendered = render_pep440_post(pieces)
+ elif style == "pep440-old":
+ rendered = render_pep440_old(pieces)
+ elif style == "git-describe":
+ rendered = render_git_describe(pieces)
+ elif style == "git-describe-long":
+ rendered = render_git_describe_long(pieces)
+ else:
+ raise ValueError("unknown style '%%s'" %% style)
+
+ return {"version": rendered, "full-revisionid": pieces["long"],
+ "dirty": pieces["dirty"], "error": None}
+
+
+def get_versions():
+ """Get version information or return default if unable to do so."""
+ # I am in _version.py, which lives at ROOT/VERSIONFILE_SOURCE. If we have
+ # __file__, we can work backwards from there to the root. Some
+ # py2exe/bbfreeze/non-CPython implementations don't do __file__, in which
+ # case we can only use expanded keywords.
+
+ cfg = get_config()
+ verbose = cfg.verbose
+
+ try:
+ return git_versions_from_keywords(get_keywords(), cfg.tag_prefix,
+ verbose)
+ except NotThisMethod:
+ pass
+
+ try:
+ root = os.path.realpath(__file__)
+ # versionfile_source is the relative path from the top of the source
+ # tree (where the .git directory might live) to this file. Invert
+ # this to find the root from __file__.
+ for i in cfg.versionfile_source.split('/'):
+ root = os.path.dirname(root)
+ except NameError:
+ return {"version": "0+unknown", "full-revisionid": None,
+ "dirty": None,
+ "error": "unable to find root of source tree"}
+
+ try:
+ pieces = git_pieces_from_vcs(cfg.tag_prefix, root, verbose)
+ return render(pieces, cfg.style)
+ except NotThisMethod:
+ pass
+
+ try:
+ if cfg.parentdir_prefix:
+ return versions_from_parentdir(cfg.parentdir_prefix, root, verbose)
+ except NotThisMethod:
+ pass
+
+ return {"version": "0+unknown", "full-revisionid": None,
+ "dirty": None,
+ "error": "unable to compute version"}
+'''
+
+
+ at register_vcs_handler("git", "get_keywords")
+def git_get_keywords(versionfile_abs):
+ """Extract version information from the given file."""
+ # the code embedded in _version.py can just fetch the value of these
+ # keywords. When used from setup.py, we don't want to import _version.py,
+ # so we do it with a regexp instead. This function is not used from
+ # _version.py.
+ keywords = {}
+ try:
+ f = open(versionfile_abs, "r")
+ for line in f.readlines():
+ if line.strip().startswith("git_refnames ="):
+ mo = re.search(r'=\s*"(.*)"', line)
+ if mo:
+ keywords["refnames"] = mo.group(1)
+ if line.strip().startswith("git_full ="):
+ mo = re.search(r'=\s*"(.*)"', line)
+ if mo:
+ keywords["full"] = mo.group(1)
+ f.close()
+ except EnvironmentError:
+ pass
+ return keywords
+
+
+ at register_vcs_handler("git", "keywords")
+def git_versions_from_keywords(keywords, tag_prefix, verbose):
+ """Get version information from git keywords."""
+ if not keywords:
+ raise NotThisMethod("no keywords at all, weird")
+ refnames = keywords["refnames"].strip()
+ if refnames.startswith("$Format"):
+ if verbose:
+ print("keywords are unexpanded, not using")
+ raise NotThisMethod("unexpanded keywords, not a git-archive tarball")
+ refs = set([r.strip() for r in refnames.strip("()").split(",")])
+ # starting in git-1.8.3, tags are listed as "tag: foo-1.0" instead of
+ # just "foo-1.0". If we see a "tag: " prefix, prefer those.
+ TAG = "tag: "
+ tags = set([r[len(TAG):] for r in refs if r.startswith(TAG)])
+ if not tags:
+ # Either we're using git < 1.8.3, or there really are no tags. We use
+ # a heuristic: assume all version tags have a digit. The old git %d
+ # expansion behaves like git log --decorate=short and strips out the
+ # refs/heads/ and refs/tags/ prefixes that would let us distinguish
+ # between branches and tags. By ignoring refnames without digits, we
+ # filter out many common branch names like "release" and
+ # "stabilization", as well as "HEAD" and "master".
+ tags = set([r for r in refs if re.search(r'\d', r)])
+ if verbose:
+ print("discarding '%s', no digits" % ",".join(refs-tags))
+ if verbose:
+ print("likely tags: %s" % ",".join(sorted(tags)))
+ for ref in sorted(tags):
+ # sorting will prefer e.g. "2.0" over "2.0rc1"
+ if ref.startswith(tag_prefix):
+ r = ref[len(tag_prefix):]
+ if verbose:
+ print("picking %s" % r)
+ return {"version": r,
+ "full-revisionid": keywords["full"].strip(),
+ "dirty": False, "error": None
+ }
+ # no suitable tags, so version is "0+unknown", but full hex is still there
+ if verbose:
+ print("no suitable tags, using unknown + full revision id")
+ return {"version": "0+unknown",
+ "full-revisionid": keywords["full"].strip(),
+ "dirty": False, "error": "no suitable tags"}
+
+
+ at register_vcs_handler("git", "pieces_from_vcs")
+def git_pieces_from_vcs(tag_prefix, root, verbose, run_command=run_command):
+ """Get version from 'git describe' in the root of the source tree.
+
+ This only gets called if the git-archive 'subst' keywords were *not*
+ expanded, and _version.py hasn't already been rewritten with a short
+ version string, meaning we're inside a checked out source tree.
+ """
+ if not os.path.exists(os.path.join(root, ".git")):
+ if verbose:
+ print("no .git in %s" % root)
+ raise NotThisMethod("no .git directory")
+
+ GITS = ["git"]
+ if sys.platform == "win32":
+ GITS = ["git.cmd", "git.exe"]
+ # if there is a tag matching tag_prefix, this yields TAG-NUM-gHEX[-dirty]
+ # if there isn't one, this yields HEX[-dirty] (no NUM)
+ describe_out = run_command(GITS, ["describe", "--tags", "--dirty",
+ "--always", "--long",
+ "--match", "%s*" % tag_prefix],
+ cwd=root)
+ # --long was added in git-1.5.5
+ if describe_out is None:
+ raise NotThisMethod("'git describe' failed")
+ describe_out = describe_out.strip()
+ full_out = run_command(GITS, ["rev-parse", "HEAD"], cwd=root)
+ if full_out is None:
+ raise NotThisMethod("'git rev-parse' failed")
+ full_out = full_out.strip()
+
+ pieces = {}
+ pieces["long"] = full_out
+ pieces["short"] = full_out[:7] # maybe improved later
+ pieces["error"] = None
+
+ # parse describe_out. It will be like TAG-NUM-gHEX[-dirty] or HEX[-dirty]
+ # TAG might have hyphens.
+ git_describe = describe_out
+
+ # look for -dirty suffix
+ dirty = git_describe.endswith("-dirty")
+ pieces["dirty"] = dirty
+ if dirty:
+ git_describe = git_describe[:git_describe.rindex("-dirty")]
+
+ # now we have TAG-NUM-gHEX or HEX
+
+ if "-" in git_describe:
+ # TAG-NUM-gHEX
+ mo = re.search(r'^(.+)-(\d+)-g([0-9a-f]+)$', git_describe)
+ if not mo:
+ # unparseable. Maybe git-describe is misbehaving?
+ pieces["error"] = ("unable to parse git-describe output: '%s'"
+ % describe_out)
+ return pieces
+
+ # tag
+ full_tag = mo.group(1)
+ if not full_tag.startswith(tag_prefix):
+ if verbose:
+ fmt = "tag '%s' doesn't start with prefix '%s'"
+ print(fmt % (full_tag, tag_prefix))
+ pieces["error"] = ("tag '%s' doesn't start with prefix '%s'"
+ % (full_tag, tag_prefix))
+ return pieces
+ pieces["closest-tag"] = full_tag[len(tag_prefix):]
+
+ # distance: number of commits since tag
+ pieces["distance"] = int(mo.group(2))
+
+ # commit: short hex revision ID
+ pieces["short"] = mo.group(3)
+
+ else:
+ # HEX: no tags
+ pieces["closest-tag"] = None
+ count_out = run_command(GITS, ["rev-list", "HEAD", "--count"],
+ cwd=root)
+ pieces["distance"] = int(count_out) # total number of commits
+
+ return pieces
+
+
+def do_vcs_install(manifest_in, versionfile_source, ipy):
+ """Git-specific installation logic for Versioneer.
+
+ For Git, this means creating/changing .gitattributes to mark _version.py
+ for export-time keyword substitution.
+ """
+ GITS = ["git"]
+ if sys.platform == "win32":
+ GITS = ["git.cmd", "git.exe"]
+ files = [manifest_in, versionfile_source]
+ if ipy:
+ files.append(ipy)
+ try:
+ me = __file__
+ if me.endswith(".pyc") or me.endswith(".pyo"):
+ me = os.path.splitext(me)[0] + ".py"
+ versioneer_file = os.path.relpath(me)
+ except NameError:
+ versioneer_file = "versioneer.py"
+ files.append(versioneer_file)
+ present = False
+ try:
+ f = open(".gitattributes", "r")
+ for line in f.readlines():
+ if line.strip().startswith(versionfile_source):
+ if "export-subst" in line.strip().split()[1:]:
+ present = True
+ f.close()
+ except EnvironmentError:
+ pass
+ if not present:
+ f = open(".gitattributes", "a+")
+ f.write("%s export-subst\n" % versionfile_source)
+ f.close()
+ files.append(".gitattributes")
+ run_command(GITS, ["add", "--"] + files)
+
+
+def versions_from_parentdir(parentdir_prefix, root, verbose):
+ """Try to determine the version from the parent directory name.
+
+ Source tarballs conventionally unpack into a directory that includes
+ both the project name and a version string.
+ """
+ dirname = os.path.basename(root)
+ if not dirname.startswith(parentdir_prefix):
+ if verbose:
+ print("guessing rootdir is '%s', but '%s' doesn't start with "
+ "prefix '%s'" % (root, dirname, parentdir_prefix))
+ raise NotThisMethod("rootdir doesn't start with parentdir_prefix")
+ return {"version": dirname[len(parentdir_prefix):],
+ "full-revisionid": None,
+ "dirty": False, "error": None}
+
+SHORT_VERSION_PY = """
+# This file was generated by 'versioneer.py' (0.16) from
+# revision-control system data, or from the parent directory name of an
+# unpacked source archive. Distribution tarballs contain a pre-generated copy
+# of this file.
+
+import json
+import sys
+
+version_json = '''
+%s
+''' # END VERSION_JSON
+
+
+def get_versions():
+ return json.loads(version_json)
+"""
+
+
+def versions_from_file(filename):
+ """Try to determine the version from _version.py if present."""
+ try:
+ with open(filename) as f:
+ contents = f.read()
+ except EnvironmentError:
+ raise NotThisMethod("unable to read _version.py")
+ mo = re.search(r"version_json = '''\n(.*)''' # END VERSION_JSON",
+ contents, re.M | re.S)
+ if not mo:
+ raise NotThisMethod("no version_json in _version.py")
+ return json.loads(mo.group(1))
+
+
+def write_to_version_file(filename, versions):
+ """Write the given version number to the given _version.py file."""
+ os.unlink(filename)
+ contents = json.dumps(versions, sort_keys=True,
+ indent=1, separators=(",", ": "))
+ with open(filename, "w") as f:
+ f.write(SHORT_VERSION_PY % contents)
+
+ print("set %s to '%s'" % (filename, versions["version"]))
+
+
+def plus_or_dot(pieces):
+ """Return a + if we don't already have one, else return a ."""
+ if "+" in pieces.get("closest-tag", ""):
+ return "."
+ return "+"
+
+
+def render_pep440(pieces):
+ """Build up version string, with post-release "local version identifier".
+
+ Our goal: TAG[+DISTANCE.gHEX[.dirty]] . Note that if you
+ get a tagged build and then dirty it, you'll get TAG+0.gHEX.dirty
+
+ Exceptions:
+ 1: no tags. git_describe was just HEX. 0+untagged.DISTANCE.gHEX[.dirty]
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ if pieces["distance"] or pieces["dirty"]:
+ rendered += plus_or_dot(pieces)
+ rendered += "%d.g%s" % (pieces["distance"], pieces["short"])
+ if pieces["dirty"]:
+ rendered += ".dirty"
+ else:
+ # exception #1
+ rendered = "0+untagged.%d.g%s" % (pieces["distance"],
+ pieces["short"])
+ if pieces["dirty"]:
+ rendered += ".dirty"
+ return rendered
+
+
+def render_pep440_pre(pieces):
+ """TAG[.post.devDISTANCE] -- No -dirty.
+
+ Exceptions:
+ 1: no tags. 0.post.devDISTANCE
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ if pieces["distance"]:
+ rendered += ".post.dev%d" % pieces["distance"]
+ else:
+ # exception #1
+ rendered = "0.post.dev%d" % pieces["distance"]
+ return rendered
+
+
+def render_pep440_post(pieces):
+ """TAG[.postDISTANCE[.dev0]+gHEX] .
+
+ The ".dev0" means dirty. Note that .dev0 sorts backwards
+ (a dirty tree will appear "older" than the corresponding clean one),
+ but you shouldn't be releasing software with -dirty anyways.
+
+ Exceptions:
+ 1: no tags. 0.postDISTANCE[.dev0]
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ if pieces["distance"] or pieces["dirty"]:
+ rendered += ".post%d" % pieces["distance"]
+ if pieces["dirty"]:
+ rendered += ".dev0"
+ rendered += plus_or_dot(pieces)
+ rendered += "g%s" % pieces["short"]
+ else:
+ # exception #1
+ rendered = "0.post%d" % pieces["distance"]
+ if pieces["dirty"]:
+ rendered += ".dev0"
+ rendered += "+g%s" % pieces["short"]
+ return rendered
+
+
+def render_pep440_old(pieces):
+ """TAG[.postDISTANCE[.dev0]] .
+
+ The ".dev0" means dirty.
+
+ Eexceptions:
+ 1: no tags. 0.postDISTANCE[.dev0]
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ if pieces["distance"] or pieces["dirty"]:
+ rendered += ".post%d" % pieces["distance"]
+ if pieces["dirty"]:
+ rendered += ".dev0"
+ else:
+ # exception #1
+ rendered = "0.post%d" % pieces["distance"]
+ if pieces["dirty"]:
+ rendered += ".dev0"
+ return rendered
+
+
+def render_git_describe(pieces):
+ """TAG[-DISTANCE-gHEX][-dirty].
+
+ Like 'git describe --tags --dirty --always'.
+
+ Exceptions:
+ 1: no tags. HEX[-dirty] (note: no 'g' prefix)
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ if pieces["distance"]:
+ rendered += "-%d-g%s" % (pieces["distance"], pieces["short"])
+ else:
+ # exception #1
+ rendered = pieces["short"]
+ if pieces["dirty"]:
+ rendered += "-dirty"
+ return rendered
+
+
+def render_git_describe_long(pieces):
+ """TAG-DISTANCE-gHEX[-dirty].
+
+ Like 'git describe --tags --dirty --always -long'.
+ The distance/hash is unconditional.
+
+ Exceptions:
+ 1: no tags. HEX[-dirty] (note: no 'g' prefix)
+ """
+ if pieces["closest-tag"]:
+ rendered = pieces["closest-tag"]
+ rendered += "-%d-g%s" % (pieces["distance"], pieces["short"])
+ else:
+ # exception #1
+ rendered = pieces["short"]
+ if pieces["dirty"]:
+ rendered += "-dirty"
+ return rendered
+
+
+def render(pieces, style):
+ """Render the given version pieces into the requested style."""
+ if pieces["error"]:
+ return {"version": "unknown",
+ "full-revisionid": pieces.get("long"),
+ "dirty": None,
+ "error": pieces["error"]}
+
+ if not style or style == "default":
+ style = "pep440" # the default
+
+ if style == "pep440":
+ rendered = render_pep440(pieces)
+ elif style == "pep440-pre":
+ rendered = render_pep440_pre(pieces)
+ elif style == "pep440-post":
+ rendered = render_pep440_post(pieces)
+ elif style == "pep440-old":
+ rendered = render_pep440_old(pieces)
+ elif style == "git-describe":
+ rendered = render_git_describe(pieces)
+ elif style == "git-describe-long":
+ rendered = render_git_describe_long(pieces)
+ else:
+ raise ValueError("unknown style '%s'" % style)
+
+ return {"version": rendered, "full-revisionid": pieces["long"],
+ "dirty": pieces["dirty"], "error": None}
+
+
+class VersioneerBadRootError(Exception):
+ """The project root directory is unknown or missing key files."""
+
+
+def get_versions(verbose=False):
+ """Get the project version from whatever source is available.
+
+ Returns dict with two keys: 'version' and 'full'.
+ """
+ if "versioneer" in sys.modules:
+ # see the discussion in cmdclass.py:get_cmdclass()
+ del sys.modules["versioneer"]
+
+ root = get_root()
+ cfg = get_config_from_root(root)
+
+ assert cfg.VCS is not None, "please set [versioneer]VCS= in setup.cfg"
+ handlers = HANDLERS.get(cfg.VCS)
+ assert handlers, "unrecognized VCS '%s'" % cfg.VCS
+ verbose = verbose or cfg.verbose
+ assert cfg.versionfile_source is not None, \
+ "please set versioneer.versionfile_source"
+ assert cfg.tag_prefix is not None, "please set versioneer.tag_prefix"
+
+ versionfile_abs = os.path.join(root, cfg.versionfile_source)
+
+ # extract version from first of: _version.py, VCS command (e.g. 'git
+ # describe'), parentdir. This is meant to work for developers using a
+ # source checkout, for users of a tarball created by 'setup.py sdist',
+ # and for users of a tarball/zipball created by 'git archive' or github's
+ # download-from-tag feature or the equivalent in other VCSes.
+
+ get_keywords_f = handlers.get("get_keywords")
+ from_keywords_f = handlers.get("keywords")
+ if get_keywords_f and from_keywords_f:
+ try:
+ keywords = get_keywords_f(versionfile_abs)
+ ver = from_keywords_f(keywords, cfg.tag_prefix, verbose)
+ if verbose:
+ print("got version from expanded keyword %s" % ver)
+ return ver
+ except NotThisMethod:
+ pass
+
+ try:
+ ver = versions_from_file(versionfile_abs)
+ if verbose:
+ print("got version from file %s %s" % (versionfile_abs, ver))
+ return ver
+ except NotThisMethod:
+ pass
+
+ from_vcs_f = handlers.get("pieces_from_vcs")
+ if from_vcs_f:
+ try:
+ pieces = from_vcs_f(cfg.tag_prefix, root, verbose)
+ ver = render(pieces, cfg.style)
+ if verbose:
+ print("got version from VCS %s" % ver)
+ return ver
+ except NotThisMethod:
+ pass
+
+ try:
+ if cfg.parentdir_prefix:
+ ver = versions_from_parentdir(cfg.parentdir_prefix, root, verbose)
+ if verbose:
+ print("got version from parentdir %s" % ver)
+ return ver
+ except NotThisMethod:
+ pass
+
+ if verbose:
+ print("unable to compute version")
+
+ return {"version": "0+unknown", "full-revisionid": None,
+ "dirty": None, "error": "unable to compute version"}
+
+
+def get_version():
+ """Get the short version string for this project."""
+ return get_versions()["version"]
+
+
+def get_cmdclass():
+ """Get the custom setuptools/distutils subclasses used by Versioneer."""
+ if "versioneer" in sys.modules:
+ del sys.modules["versioneer"]
+ # this fixes the "python setup.py develop" case (also 'install' and
+ # 'easy_install .'), in which subdependencies of the main project are
+ # built (using setup.py bdist_egg) in the same python process. Assume
+ # a main project A and a dependency B, which use different versions
+ # of Versioneer. A's setup.py imports A's Versioneer, leaving it in
+ # sys.modules by the time B's setup.py is executed, causing B to run
+ # with the wrong versioneer. Setuptools wraps the sub-dep builds in a
+ # sandbox that restores sys.modules to it's pre-build state, so the
+ # parent is protected against the child's "import versioneer". By
+ # removing ourselves from sys.modules here, before the child build
+ # happens, we protect the child from the parent's versioneer too.
+ # Also see https://github.com/warner/python-versioneer/issues/52
+
+ cmds = {}
+
+ # we add "version" to both distutils and setuptools
+ from distutils.core import Command
+
+ class cmd_version(Command):
+ description = "report generated version string"
+ user_options = []
+ boolean_options = []
+
+ def initialize_options(self):
+ pass
+
+ def finalize_options(self):
+ pass
+
+ def run(self):
+ vers = get_versions(verbose=True)
+ print("Version: %s" % vers["version"])
+ print(" full-revisionid: %s" % vers.get("full-revisionid"))
+ print(" dirty: %s" % vers.get("dirty"))
+ if vers["error"]:
+ print(" error: %s" % vers["error"])
+ cmds["version"] = cmd_version
+
+ # we override "build_py" in both distutils and setuptools
+ #
+ # most invocation pathways end up running build_py:
+ # distutils/build -> build_py
+ # distutils/install -> distutils/build ->..
+ # setuptools/bdist_wheel -> distutils/install ->..
+ # setuptools/bdist_egg -> distutils/install_lib -> build_py
+ # setuptools/install -> bdist_egg ->..
+ # setuptools/develop -> ?
+
+ # we override different "build_py" commands for both environments
+ if "setuptools" in sys.modules:
+ from setuptools.command.build_py import build_py as _build_py
+ else:
+ from distutils.command.build_py import build_py as _build_py
+
+ class cmd_build_py(_build_py):
+ def run(self):
+ root = get_root()
+ cfg = get_config_from_root(root)
+ versions = get_versions()
+ _build_py.run(self)
+ # now locate _version.py in the new build/ directory and replace
+ # it with an updated value
+ if cfg.versionfile_build:
+ target_versionfile = os.path.join(self.build_lib,
+ cfg.versionfile_build)
+ print("UPDATING %s" % target_versionfile)
+ write_to_version_file(target_versionfile, versions)
+ cmds["build_py"] = cmd_build_py
+
+ if "cx_Freeze" in sys.modules: # cx_freeze enabled?
+ from cx_Freeze.dist import build_exe as _build_exe
+
+ class cmd_build_exe(_build_exe):
+ def run(self):
+ root = get_root()
+ cfg = get_config_from_root(root)
+ versions = get_versions()
+ target_versionfile = cfg.versionfile_source
+ print("UPDATING %s" % target_versionfile)
+ write_to_version_file(target_versionfile, versions)
+
+ _build_exe.run(self)
+ os.unlink(target_versionfile)
+ with open(cfg.versionfile_source, "w") as f:
+ LONG = LONG_VERSION_PY[cfg.VCS]
+ f.write(LONG %
+ {"DOLLAR": "$",
+ "STYLE": cfg.style,
+ "TAG_PREFIX": cfg.tag_prefix,
+ "PARENTDIR_PREFIX": cfg.parentdir_prefix,
+ "VERSIONFILE_SOURCE": cfg.versionfile_source,
+ })
+ cmds["build_exe"] = cmd_build_exe
+ del cmds["build_py"]
+
+ # we override different "sdist" commands for both environments
+ if "setuptools" in sys.modules:
+ from setuptools.command.sdist import sdist as _sdist
+ else:
+ from distutils.command.sdist import sdist as _sdist
+
+ class cmd_sdist(_sdist):
+ def run(self):
+ versions = get_versions()
+ self._versioneer_generated_versions = versions
+ # unless we update this, the command will keep using the old
+ # version
+ self.distribution.metadata.version = versions["version"]
+ return _sdist.run(self)
+
+ def make_release_tree(self, base_dir, files):
+ root = get_root()
+ cfg = get_config_from_root(root)
+ _sdist.make_release_tree(self, base_dir, files)
+ # now locate _version.py in the new base_dir directory
+ # (remembering that it may be a hardlink) and replace it with an
+ # updated value
+ target_versionfile = os.path.join(base_dir, cfg.versionfile_source)
+ print("UPDATING %s" % target_versionfile)
+ write_to_version_file(target_versionfile,
+ self._versioneer_generated_versions)
+ cmds["sdist"] = cmd_sdist
+
+ return cmds
+
+
+CONFIG_ERROR = """
+setup.cfg is missing the necessary Versioneer configuration. You need
+a section like:
+
+ [versioneer]
+ VCS = git
+ style = pep440
+ versionfile_source = src/myproject/_version.py
+ versionfile_build = myproject/_version.py
+ tag_prefix =
+ parentdir_prefix = myproject-
+
+You will also need to edit your setup.py to use the results:
+
+ import versioneer
+ setup(version=versioneer.get_version(),
+ cmdclass=versioneer.get_cmdclass(), ...)
+
+Please read the docstring in ./versioneer.py for configuration instructions,
+edit setup.cfg, and re-run the installer or 'python versioneer.py setup'.
+"""
+
+SAMPLE_CONFIG = """
+# See the docstring in versioneer.py for instructions. Note that you must
+# re-run 'versioneer.py setup' after changing this section, and commit the
+# resulting files.
+
+[versioneer]
+#VCS = git
+#style = pep440
+#versionfile_source =
+#versionfile_build =
+#tag_prefix =
+#parentdir_prefix =
+
+"""
+
+INIT_PY_SNIPPET = """
+from ._version import get_versions
+__version__ = get_versions()['version']
+del get_versions
+"""
+
+
+def do_setup():
+ """Main VCS-independent setup function for installing Versioneer."""
+ root = get_root()
+ try:
+ cfg = get_config_from_root(root)
+ except (EnvironmentError, configparser.NoSectionError,
+ configparser.NoOptionError) as e:
+ if isinstance(e, (EnvironmentError, configparser.NoSectionError)):
+ print("Adding sample versioneer config to setup.cfg",
+ file=sys.stderr)
+ with open(os.path.join(root, "setup.cfg"), "a") as f:
+ f.write(SAMPLE_CONFIG)
+ print(CONFIG_ERROR, file=sys.stderr)
+ return 1
+
+ print(" creating %s" % cfg.versionfile_source)
+ with open(cfg.versionfile_source, "w") as f:
+ LONG = LONG_VERSION_PY[cfg.VCS]
+ f.write(LONG % {"DOLLAR": "$",
+ "STYLE": cfg.style,
+ "TAG_PREFIX": cfg.tag_prefix,
+ "PARENTDIR_PREFIX": cfg.parentdir_prefix,
+ "VERSIONFILE_SOURCE": cfg.versionfile_source,
+ })
+
+ ipy = os.path.join(os.path.dirname(cfg.versionfile_source),
+ "__init__.py")
+ if os.path.exists(ipy):
+ try:
+ with open(ipy, "r") as f:
+ old = f.read()
+ except EnvironmentError:
+ old = ""
+ if INIT_PY_SNIPPET not in old:
+ print(" appending to %s" % ipy)
+ with open(ipy, "a") as f:
+ f.write(INIT_PY_SNIPPET)
+ else:
+ print(" %s unmodified" % ipy)
+ else:
+ print(" %s doesn't exist, ok" % ipy)
+ ipy = None
+
+ # Make sure both the top-level "versioneer.py" and versionfile_source
+ # (PKG/_version.py, used by runtime code) are in MANIFEST.in, so
+ # they'll be copied into source distributions. Pip won't be able to
+ # install the package without this.
+ manifest_in = os.path.join(root, "MANIFEST.in")
+ simple_includes = set()
+ try:
+ with open(manifest_in, "r") as f:
+ for line in f:
+ if line.startswith("include "):
+ for include in line.split()[1:]:
+ simple_includes.add(include)
+ except EnvironmentError:
+ pass
+ # That doesn't cover everything MANIFEST.in can do
+ # (http://docs.python.org/2/distutils/sourcedist.html#commands), so
+ # it might give some false negatives. Appending redundant 'include'
+ # lines is safe, though.
+ if "versioneer.py" not in simple_includes:
+ print(" appending 'versioneer.py' to MANIFEST.in")
+ with open(manifest_in, "a") as f:
+ f.write("include versioneer.py\n")
+ else:
+ print(" 'versioneer.py' already in MANIFEST.in")
+ if cfg.versionfile_source not in simple_includes:
+ print(" appending versionfile_source ('%s') to MANIFEST.in" %
+ cfg.versionfile_source)
+ with open(manifest_in, "a") as f:
+ f.write("include %s\n" % cfg.versionfile_source)
+ else:
+ print(" versionfile_source already in MANIFEST.in")
+
+ # Make VCS-specific changes. For git, this means creating/changing
+ # .gitattributes to mark _version.py for export-time keyword
+ # substitution.
+ do_vcs_install(manifest_in, cfg.versionfile_source, ipy)
+ return 0
+
+
+def scan_setup_py():
+ """Validate the contents of setup.py against Versioneer's expectations."""
+ found = set()
+ setters = False
+ errors = 0
+ with open("setup.py", "r") as f:
+ for line in f.readlines():
+ if "import versioneer" in line:
+ found.add("import")
+ if "versioneer.get_cmdclass()" in line:
+ found.add("cmdclass")
+ if "versioneer.get_version()" in line:
+ found.add("get_version")
+ if "versioneer.VCS" in line:
+ setters = True
+ if "versioneer.versionfile_source" in line:
+ setters = True
+ if len(found) != 3:
+ print("")
+ print("Your setup.py appears to be missing some important items")
+ print("(but I might be wrong). Please make sure it has something")
+ print("roughly like the following:")
+ print("")
+ print(" import versioneer")
+ print(" setup( version=versioneer.get_version(),")
+ print(" cmdclass=versioneer.get_cmdclass(), ...)")
+ print("")
+ errors += 1
+ if setters:
+ print("You should remove lines like 'versioneer.VCS = ' and")
+ print("'versioneer.versionfile_source = ' . This configuration")
+ print("now lives in setup.cfg, and should be removed from setup.py")
+ print("")
+ errors += 1
+ return errors
+
+if __name__ == "__main__":
+ cmd = sys.argv[1]
+ if cmd == "setup":
+ errors = do_setup()
+ errors += scan_setup_py()
+ if errors:
+ sys.exit(1)
--
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/python-cutadapt.git
More information about the debian-med-commit
mailing list