[med-svn] [trnascan-se] 01/03: New upstream version 1.23
Steffen Möller
moeller at moszumanska.debian.org
Sat Oct 21 22:26:38 UTC 2017
This is an automated email from the git hooks/post-receive script.
moeller pushed a commit to branch master
in repository trnascan-se.
commit dc9d5b7eea6a47c5537aa75b88d77e81ea7b3b57
Author: Steffen Moeller <moeller at debian.org>
Date: Wed Sep 13 13:33:21 2017 +0200
New upstream version 1.23
---
Archaea-BHB-noncan.cm | 167 -
ESELCinf-c.cm | 384 ---
FILES | 8 +-
Makefile | 17 +-
Manual.ps | 8019 ++++++++++++++++++---------------------------
PSELCinf-c.cm | 406 ---
README | 51 +-
Release.history | 42 -
TRNAinf-arch-3h-nc.cm | 242 --
TRNAinf-arch-5h-nc.cm | 165 -
TRNAinf-arch-c.cm | 415 ---
TRNAinf-arch-ns-c.cm | 416 ---
TRNAinf-bact-c.cm | 415 ---
TRNAinf-bact-ns-c.cm | 416 ---
TRNAinf-c.cm | 403 ---
TRNAinf-euk-c.cm | 403 ---
TRNAinf-euk-ns-c.cm | 404 ---
TRNAinf-ns-c.cm | 404 ---
debug.c | 2 +-
fasta2gsi.pl | 0
gnuregex.c | 2 +-
pavesi.c | 4 +-
save.c | 33 +-
scorestack.c | 2 +-
sqio.c | 66 +-
sstofa.pl | 0
tRNAscan-SE.src | 4344 +++++++++++++++++++-----
tRNAscanSE/CM.pm | 2561 ---------------
tRNAscanSE/Constants.pm | 105 -
tRNAscanSE/Eufind.pm | 261 --
tRNAscanSE/GeneticCode.pm | 291 --
tRNAscanSE/LogFile.pm | 87 -
tRNAscanSE/Options.pm | 668 ----
tRNAscanSE/SS.pm | 197 --
tRNAscanSE/ScanResult.pm | 657 ----
tRNAscanSE/Sequence.pm | 763 -----
tRNAscanSE/Stats.pm | 430 ---
tRNAscanSE/Tscan.pm | 393 ---
tRNAscanSE/Utils.pm | 175 -
testrun.ref | 16 +-
trnascan.c | 63 +-
41 files changed, 6850 insertions(+), 17047 deletions(-)
diff --git a/Archaea-BHB-noncan.cm b/Archaea-BHB-noncan.cm
deleted file mode 100644
index 78eebdf..0000000
--- a/Archaea-BHB-noncan.cm
+++ /dev/null
@@ -1,167 +0,0 @@
-INFERNAL-1 [1.0]
-NAME Archaea-NC-Intron
-STATES 124
-NODES 28
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 148
-EFFNSEQ 148.000
-CLEN 40
-BCOM cmbuild --rf --enone -F Archaea-BHB-noncan.cm Archaea-BHB-noncan.sto
-BDATE Wed Aug 5 18:38:10 2009
-NULL 0.000 0.000 0.000 0.000
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 6 -13.180 -13.120 -0.001 -11.896 -12.176 -12.571
- IL 1 1 2 1 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 2 2 3 2 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 1 ]
- MP 3 2 3 7 6 -13.180 -13.120 -0.001 -11.896 -12.176 -12.571 -0.553 0.180 -0.805 -1.580 0.039 -0.132 1.032 -0.961 1.087 0.350 -0.302 -3.122 -0.376 0.222 0.847 -0.473
- ML 4 2 3 7 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 5 2 3 7 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 6 2 3 7 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 7 7 5 7 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 8 8 6 8 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 2 ]
- MP 9 8 6 13 6 -13.180 -13.120 -0.001 -11.896 -12.176 -12.571 -0.679 0.345 -1.278 0.217 -1.335 0.610 0.158 -2.094 -0.942 1.328 0.852 -0.808 -0.468 0.384 0.241 -0.638
- ML 10 8 6 13 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 11 8 6 13 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 12 8 6 13 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 13 13 5 13 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 14 14 6 14 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 3 ]
- MP 15 14 6 19 6 -13.180 -13.120 -0.001 -11.896 -12.176 -12.571 -3.085 -0.094 0.388 0.575 -4.100 -1.284 0.323 -0.315 0.485 1.652 0.861 0.534 -1.310 -0.940 -0.533 -2.306
- ML 16 14 6 19 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 17 14 6 19 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 18 14 6 19 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 19 19 5 19 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 20 20 6 20 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 4 ]
- MP 21 20 6 25 6 -13.180 -13.120 -0.001 -11.896 -12.176 -12.571 -1.627 1.032 0.144 0.574 -0.502 0.326 0.474 -1.619 -0.731 1.846 -0.268 -0.507 -2.731 -2.115 0.115 -2.573
- ML 22 20 6 25 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 23 20 6 25 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 24 20 6 25 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 25 25 5 25 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 26 26 6 26 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 5 ]
- MP 27 26 6 31 4 -12.154 -6.639 -0.016 -9.853 -4.149 -2.051 0.059 -2.692 -0.481 -0.348 1.371 -0.318 -1.425 2.266 -0.515 0.197 -1.021 -0.781 -0.408 -0.402
- ML 28 26 6 31 4 -2.408 -4.532 -1.293 -1.473 0.660 -0.612 -0.293 -0.076
- MR 29 26 6 31 4 -4.102 -12.528 -0.390 -2.485 0.660 -0.612 -0.293 -0.076
- D 30 26 6 31 4 -12.737 -14.007 -2.036 -0.404
- IL 31 31 5 31 4 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000
- IR 32 32 6 32 3 -3.062 -0.226 -5.301 0.000 0.000 0.000 0.000
- [ MATR 6 ]
- MR 33 32 6 35 3 -13.564 -0.001 -11.882 -0.041 -0.728 0.409 0.133
- D 34 32 6 35 3 -6.390 -1.568 -0.620
- IR 35 35 3 35 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 7 ]
- MR 36 35 3 38 3 -13.564 -0.001 -11.882 0.773 -1.034 0.652 -2.111
- D 37 35 3 38 3 -6.390 -1.568 -0.620
- IR 38 38 3 38 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 8 ]
- MR 39 38 3 41 5 -12.207 -0.001 -12.022 -12.234 -13.126 1.907 -3.509 -3.041 -4.637
- D 40 38 3 41 5 -5.352 -0.707 -2.978 -4.409 -2.404
- IR 41 41 3 41 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 9 ]
- MP 42 41 3 46 6 -13.180 -13.120 -0.001 -11.896 -12.176 -12.571 -4.303 -2.311 -0.025 -0.706 -4.219 -1.631 2.474 -4.243 -2.815 1.438 -4.589 1.376 0.264 -1.749 0.162 -4.067
- ML 43 41 3 46 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 44 41 3 46 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 45 41 3 46 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 46 46 5 46 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 47 47 6 47 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 10 ]
- MP 48 47 6 52 6 -13.180 -13.120 -0.001 -11.896 -12.176 -12.571 -6.894 -3.183 -7.771 0.944 -8.050 -7.689 2.211 -7.339 -7.035 2.653 -2.529 -1.595 0.838 -7.036 -0.516 -6.190
- ML 49 47 6 52 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 50 47 6 52 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 51 47 6 52 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 52 52 5 52 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 53 53 6 53 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 11 ]
- MP 54 53 6 58 6 -13.180 -13.120 -0.001 -11.896 -12.176 -12.571 -7.157 -6.147 -8.101 0.723 -8.763 -7.957 1.793 -7.599 -7.277 3.124 -6.961 -0.665 -0.023 -7.318 -1.411 -3.113
- ML 55 53 6 58 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 56 53 6 58 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 57 53 6 58 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 58 58 5 58 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 59 59 6 59 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 12 ]
- MP 60 59 6 64 4 -12.357 -12.564 -0.001 -10.978 -6.403 -7.081 -0.862 -0.921 -6.146 -2.492 2.202 -7.461 -1.224 2.604 -7.540 -5.329 -1.275 -6.909 1.647 -6.316
- ML 61 59 6 64 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 62 59 6 64 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 63 59 6 64 4 -4.568 -4.250 -2.265 -0.520
- IL 64 64 5 64 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 65 65 6 65 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 13 ]
- ML 66 65 6 68 3 -13.269 -0.001 -11.923 0.690 -0.282 0.156 -1.154
- D 67 65 6 68 3 -6.174 -1.687 -0.566
- IL 68 68 3 68 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 14 ]
- ML 69 68 3 71 3 -13.269 -0.001 -11.923 -0.439 0.123 0.805 -1.229
- D 70 68 3 71 3 -6.174 -1.687 -0.566
- IL 71 71 3 71 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 15 ]
- ML 72 71 3 74 5 -12.207 -0.047 -6.886 -7.136 -5.962 1.545 -2.377 -1.607 -0.833
- D 73 71 3 74 5 -4.959 -0.803 -4.221 -2.596 -2.508
- IL 74 74 3 74 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 16 ]
- MP 75 74 3 79 6 -13.136 -13.076 -0.060 -11.852 -5.374 -5.957 -11.758 -10.096 -11.268 -2.214 -8.937 -12.516 2.537 -10.139 -12.707 2.974 -11.780 -1.382 0.621 -12.752 -2.356 -8.766
- ML 76 74 3 79 6 -7.725 -8.071 -2.786 -2.480 -7.921 -0.592 1.593 -1.856 -1.723 -1.306
- MR 77 74 3 79 6 -8.189 -6.918 -2.827 -6.897 -0.304 -5.110 1.532 -1.693 -1.530 -1.142
- D 78 74 3 79 6 -11.481 -10.179 -5.976 -6.659 -6.676 -0.054
- IL 79 79 5 79 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 80 80 6 80 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 17 ]
- MP 81 80 6 85 6 -13.078 -13.017 -0.176 -11.793 -5.650 -3.410 -6.750 -5.892 -2.749 0.736 -1.367 -7.583 1.586 -7.223 -3.149 3.082 -6.660 -1.920 0.457 -6.909 -0.988 -6.076
- ML 82 80 6 85 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 83 80 6 85 6 -9.755 -8.484 -0.495 -8.462 -1.869 -6.675 -0.920 -1.582 0.789 0.496
- D 84 80 6 85 6 -12.642 -11.340 -7.137 -7.819 -7.837 -0.024
- IL 85 85 5 85 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 86 86 6 86 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 18 ]
- MP 87 86 6 91 6 -12.944 -12.883 -0.328 -11.659 -6.872 -2.366 -3.574 -3.158 -2.975 1.051 -7.669 -7.356 2.093 -2.601 -2.084 2.718 -6.456 -0.740 0.602 -6.710 -2.354 -5.916
- ML 88 86 6 91 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 89 86 6 91 6 -9.540 -8.269 -0.177 -8.247 -3.381 -6.460 0.375 0.213 -0.189 -0.586
- D 90 86 6 91 6 -14.258 -12.956 -8.753 -9.436 -9.453 -0.008
- IL 91 91 5 91 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 92 92 6 92 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 19 ]
- MP 93 92 6 97 6 -12.670 -12.610 -0.354 -11.386 -6.521 -2.281 -6.550 -2.506 -7.481 0.718 -8.079 -7.352 2.827 -2.550 -6.675 2.376 -6.366 -0.382 -0.569 -6.707 -2.291 -5.871
- ML 94 92 6 97 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 95 92 6 97 6 -8.230 -6.959 -2.868 -6.937 -0.295 -5.151 1.550 -1.738 -1.583 -1.187
- D 96 92 6 97 6 -15.439 -14.137 -9.934 -10.616 -10.634 -0.003
- IL 97 97 5 97 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 98 98 6 98 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 20 ]
- MP 99 98 6 103 4 -11.450 -11.657 -0.895 -1.115 -5.905 -5.479 -2.092 0.063 -5.605 -6.755 2.924 -6.315 -2.962 2.213 -6.075 -0.726 0.130 -6.037 -0.914 -5.097
- ML 100 98 6 103 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 101 98 6 103 4 -6.893 -5.922 -0.258 -2.850 0.633 -1.416 0.599 -0.836
- D 102 98 6 103 4 -11.437 -11.119 -9.134 -0.004
- IL 103 103 5 103 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 104 104 6 104 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 21 ]
- ML 105 104 6 107 3 -11.550 -0.002 -10.204 -1.502 0.882 0.329 -0.868
- D 106 104 6 107 3 -14.171 -0.004 -8.562
- IL 107 107 3 107 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 22 ]
- ML 108 107 3 110 3 -13.269 -0.011 -7.094 0.051 0.101 0.211 -0.445
- D 109 107 3 110 3 -6.174 -1.687 -0.566
- IL 110 110 3 110 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 23 ]
- ML 111 110 3 113 3 -0.900 -2.036 -2.183 -0.109 0.249 0.323 -0.660
- D 112 110 3 113 3 -8.015 -0.308 -2.406
- IL 113 113 3 113 3 -0.249 -2.656 -12.425 0.000 0.000 0.000 0.000
- [ MATL 24 ]
- ML 114 113 3 116 3 -12.913 -0.001 -11.567 0.106 -0.048 -0.126 0.056
- D 115 113 3 116 3 -12.510 -0.012 -6.902
- IL 116 116 3 116 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 25 ]
- ML 117 116 3 119 3 -13.269 -1.720 -0.522 0.226 -0.054 0.162 -0.417
- D 118 116 3 119 3 -6.174 -1.687 -0.566
- IL 119 119 3 119 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 26 ]
- ML 120 119 3 122 2 * 0.000 -1.563 0.297 0.962 -1.042
- D 121 119 3 122 2 * 0.000
- IL 122 122 3 122 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 27 ]
- E 123 122 3 -1 0
-//
diff --git a/ESELCinf-c.cm b/ESELCinf-c.cm
deleted file mode 100644
index b2e5086..0000000
--- a/ESELCinf-c.cm
+++ /dev/null
@@ -1,384 +0,0 @@
-INFERNAL-1 [1.0]
-NAME euk-selcysteine
-STATES 277
-NODES 69
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 7
-EFFNSEQ 7.000
-CLEN 86
-BCOM cmbuild --rf --enone ESELCinf-nc.cm euk-selc.sto
-BDATE Sun Feb 8 16:47:27 2009
-CCOM cmcalibrate --exp-hfile cmcalibrate_files/ESELCinf.hfile --exp-sfile cmcalibrate_files/ESELCinf.sfile --exp-qqfile cmcalibrate_files/ESELCinf.qqfile --exp-ffile cmcalibrate_files/ESELCinf.ffile --fil-dfile cmcalibrate_files/ESELCinf.dfile -s 208 ESELCinf-c.cm
-CDATE Sun Feb 8 20:21:57 2009
-NULL 0.000 0.000 0.000 0.000
-PART 1 0 100
-E-LC 0 0.71367 -6.74489 2.01784 1500000 584916 0.001923
-E-GC 0 0.37359 -37.84370 -24.88577 1500000 47469 0.007900
-E-LI 0 0.73707 -5.86976 2.52683 1500000 548234 0.002052
-E-GI 0 0.42267 -31.24140 -19.96573 1500000 44037 0.008516
-E-LV 0 0.75319 -1.04434 5.07459 15000000 112901 0.009964
-E-GV 0 0.37368 -35.20156 -19.92893 15000000 112864 0.003323
-E-LF 0 0.80509 0.38582 6.11048 15000000 112915 0.009963
-E-GF 0 0.40055 -30.04964 -15.80224 15000000 112840 0.003323
-FT-LC 13 0.99500 10000 1500000 0
- 69.2835 69.2835 65.7954 61.4476 58.751 51.924 50.639 43.6522 22.8838 19.0426 15.6441 0.000114893 4.18549e-06
- 4903.14 4331.41 2637.84 1923.92 1664.37 1439.84 784.03 308.138 251.961 178.807 119.93 12.6591 11.993
-FT-LI 13 0.99500 10000 1500000 0
- 96.4545 91.9657 87.1926 81.244 75.5557 67.9886 66.5345 41.174 29.2931 23.6721 19.7349 9.85649e-05 4.9628e-07
- 4903.14 4331.41 2637.84 1923.92 1664.37 1439.84 784.03 308.138 251.961 178.807 119.93 12.6591 11.993
-FT-GC 1 0.99500 10000 1500000 1
- 3.998e-05
- 9.49083
-FT-GI 1 0.99500 10000 1500000 1
- 7.12336e-06
- 9.49083
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130
- IL 1 1 2 1 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 2 2 3 2 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 1 ]
- MP 3 2 3 7 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -3.964 -3.342 -4.390 0.436 -4.366 -4.513 -0.766 -4.090 -4.037 2.505 1.845 1.729 -0.634 -3.872 -1.997 -3.451
- ML 4 2 3 7 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 5 2 3 7 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 6 2 3 7 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 7 7 5 7 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 8 8 6 8 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 2 ]
- MP 9 8 6 13 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -4.576 -5.296 -3.942 -1.631 -3.388 0.854 3.535 -4.540 -5.393 -1.655 -4.107 -3.302 -0.001 -5.112 -1.243 -4.160
- ML 10 8 6 13 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 11 8 6 13 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 12 8 6 13 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 13 13 5 13 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 14 14 6 14 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 3 ]
- MP 15 14 6 19 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -6.359 -6.300 -4.476 -1.813 -4.184 -5.102 3.802 -5.124 -7.841 -1.775 -4.475 -3.436 -0.380 -6.994 -1.520 -5.197
- ML 16 14 6 19 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 17 14 6 19 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 18 14 6 19 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 19 19 5 19 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 20 20 6 20 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 4 ]
- MP 21 20 6 25 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -6.359 -6.300 -4.476 -1.813 -4.184 -5.102 3.802 -5.124 -7.841 -1.775 -4.475 -3.436 -0.380 -6.994 -1.520 -5.197
- ML 22 20 6 25 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 23 20 6 25 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 24 20 6 25 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 25 25 5 25 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 26 26 6 26 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 5 ]
- MP 27 26 6 31 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -5.758 -4.546 -6.306 0.054 -5.517 -6.066 2.223 -5.652 -5.663 3.087 -5.353 -1.610 -0.123 -5.565 -1.673 -4.538
- ML 28 26 6 31 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 29 26 6 31 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 30 26 6 31 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 31 31 5 31 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 32 32 6 32 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 6 ]
- MP 33 32 6 37 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -4.701 -4.843 2.369 -1.751 -4.353 -6.119 -1.897 -5.067 -4.904 -2.007 -5.328 3.185 -1.178 -4.939 -2.531 -4.264
- ML 34 32 6 37 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 35 32 6 37 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 36 32 6 37 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 37 37 5 37 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 38 38 6 38 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 7 ]
- MP 39 38 6 43 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -5.765 -4.918 -6.153 3.059 -5.184 -6.735 2.362 -5.431 -5.960 -0.242 -6.054 -1.953 -0.156 -6.034 -1.711 -4.542
- ML 40 38 6 43 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 41 38 6 43 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 42 38 6 43 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 43 43 5 43 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 44 44 6 44 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 8 ]
- MP 45 44 6 49 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -4.061 -4.669 -4.748 -1.643 -3.666 -5.764 -1.435 -4.833 -4.446 -1.988 -5.101 -2.521 -0.653 -4.506 2.375 3.117
- ML 46 44 6 49 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 47 44 6 49 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 48 44 6 49 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 49 49 5 49 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 50 50 6 50 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 9 ]
- MP 51 50 6 55 4 -8.235 -8.442 -0.022 -6.856 -5.905 -4.204 -6.594 -0.215 -6.822 -5.367 -1.313 -5.820 -5.297 3.357 -4.936 1.879 -1.271 -5.043 -2.815 -4.842
- ML 52 50 6 55 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 53 50 6 55 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 54 50 6 55 4 -4.568 -4.250 -2.265 -0.520
- IL 55 55 5 55 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 56 56 6 56 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 10 ]
- ML 57 56 6 59 3 -9.189 -0.009 -7.843 1.922 -4.110 -3.877 -3.575
- D 58 56 6 59 3 -6.174 -1.687 -0.566
- IL 59 59 3 59 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 11 ]
- ML 60 59 3 62 2 -9.738 -0.002 1.268 -0.962 -1.952 -0.287
- D 61 59 3 62 2 -8.445 -0.004
- IL 62 62 3 62 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ BIF 12 ]
- B 63 62 3 64 176
- [ BEGL 13 ]
- S 64 63 1 65 1 0.000
- [ BIF 14 ]
- B 65 64 1 66 116
- [ BEGL 15 ]
- S 66 65 1 67 4 -0.026 -7.622 -7.029 -7.669
- [ MATP 16 ]
- MP 67 66 1 71 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -6.359 -6.300 -4.476 -1.813 -4.184 -5.102 3.802 -5.124 -7.841 -1.775 -4.475 -3.436 -0.380 -6.994 -1.520 -5.197
- ML 68 66 1 71 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 69 66 1 71 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 70 66 1 71 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 71 71 5 71 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 72 72 6 72 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 17 ]
- MP 73 72 6 77 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -5.851 -5.914 -4.906 -1.026 -4.240 -5.606 3.365 -5.301 -6.660 -0.966 -4.994 -2.631 -0.006 -6.380 1.715 -4.783
- ML 74 72 6 77 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 75 72 6 77 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 76 72 6 77 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 77 77 5 77 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 78 78 6 78 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 18 ]
- MP 79 78 6 83 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -6.055 -5.502 -6.444 2.167 -5.462 -7.736 -1.154 -5.867 -5.973 -1.536 -6.164 -2.488 -1.097 -6.190 3.308 -5.006
- ML 80 78 6 83 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 81 78 6 83 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 82 78 6 83 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 83 83 5 83 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 84 84 6 84 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 19 ]
- MP 85 84 6 89 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -5.956 -6.069 -4.637 -1.230 -4.126 -5.292 3.511 -5.174 -7.043 -1.165 -4.699 -2.899 -0.053 -6.549 1.236 -4.880
- ML 86 84 6 89 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 87 84 6 89 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 88 84 6 89 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 89 89 5 89 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 90 90 6 90 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 20 ]
- MP 91 90 6 95 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -4.102 -3.101 -4.998 2.220 -5.631 -4.855 -0.158 -4.487 -4.209 2.622 -3.926 1.338 -0.167 -4.232 -1.747 -3.426
- ML 92 90 6 95 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 93 90 6 95 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 94 90 6 95 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 95 95 5 95 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 96 96 6 96 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 21 ]
- MP 97 96 6 101 4 -8.235 -8.442 -0.022 -6.856 -8.083 -4.214 -8.636 -0.936 -8.152 -4.542 -2.226 -7.336 -5.359 3.856 -4.855 -1.889 -2.148 -4.604 -4.047 -6.190
- ML 98 96 6 101 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 99 96 6 101 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 100 96 6 101 4 -4.568 -4.250 -2.265 -0.520
- IL 101 101 5 101 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 102 102 6 102 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 22 ]
- ML 103 102 6 105 3 -9.189 -0.009 -7.843 -1.578 -0.286 -2.393 1.408
- D 104 102 6 105 3 -6.174 -1.687 -0.566
- IL 105 105 3 105 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 23 ]
- ML 106 105 3 108 3 -9.189 -0.009 -7.843 -2.459 -3.879 1.863 -3.162
- D 107 105 3 108 3 -6.174 -1.687 -0.566
- IL 108 108 3 108 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 24 ]
- ML 109 108 3 111 3 -9.189 -0.009 -7.843 -2.459 -3.879 1.863 -3.162
- D 110 108 3 111 3 -6.174 -1.687 -0.566
- IL 111 111 3 111 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 25 ]
- ML 112 111 3 114 2 * 0.000 -3.045 -2.938 -3.786 1.878
- D 113 111 3 114 2 * 0.000
- IL 114 114 3 114 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 26 ]
- E 115 114 3 -1 0
- [ BEGR 27 ]
- S 116 65 1 117 5 -8.209 -0.018 -8.024 -8.237 -9.128
- IL 117 117 2 117 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 28 ]
- MP 118 117 2 122 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -5.595 -5.397 -6.100 -1.673 -5.082 -7.387 -1.510 -5.714 -5.651 -1.884 -5.981 -2.570 3.861 -5.838 -2.612 -4.809
- ML 119 117 2 122 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 120 117 2 122 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 121 117 2 122 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 122 122 5 122 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 123 123 6 123 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 29 ]
- MP 124 123 6 128 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -8.417 -5.833 -7.841 -2.015 -7.814 -11.206 -2.586 -6.365 -6.803 -2.265 -6.564 3.904 -2.163 -7.369 -3.383 -5.787
- ML 125 123 6 128 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 126 123 6 128 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 127 123 6 128 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 128 128 5 128 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 129 129 6 129 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 30 ]
- MP 130 129 6 134 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -6.359 -6.300 -4.476 -1.813 -4.184 -5.102 3.802 -5.124 -7.841 -1.775 -4.475 -3.436 -0.380 -6.994 -1.520 -5.197
- ML 131 129 6 134 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 132 129 6 134 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 133 129 6 134 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 134 134 5 134 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 135 135 6 135 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 31 ]
- MP 136 135 6 140 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -4.273 -3.291 -5.077 3.034 -5.553 -5.046 -0.507 -4.358 -4.477 2.374 -4.439 -1.059 -0.512 -4.539 -2.068 -3.573
- ML 137 135 6 140 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 138 135 6 140 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 139 135 6 140 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 140 140 5 140 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 141 141 6 141 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 32 ]
- MP 142 141 6 146 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -8.083 -4.214 -8.636 -0.936 -8.152 -4.542 -2.226 -7.336 -5.359 3.856 -4.855 -1.889 -2.148 -4.604 -4.047 -6.190
- ML 143 141 6 146 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 144 141 6 146 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 145 141 6 146 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 146 146 5 146 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 147 147 6 147 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 33 ]
- MP 148 147 6 152 4 -8.235 -8.442 -0.022 -6.856 -4.246 -3.278 -5.029 3.122 -5.478 -5.017 -0.567 -4.276 -4.482 2.246 -4.521 -1.112 -0.568 -4.549 -2.122 -3.553
- ML 149 147 6 152 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 150 147 6 152 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 151 147 6 152 4 -4.568 -4.250 -2.265 -0.520
- IL 152 152 5 152 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 153 153 6 153 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 34 ]
- ML 154 153 6 156 3 -9.189 -0.009 -7.843 -3.271 1.892 -4.181 -2.934
- D 155 153 6 156 3 -6.174 -1.687 -0.566
- IL 156 156 3 156 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 35 ]
- ML 157 156 3 159 3 -9.189 -0.009 -7.843 -3.045 -2.938 -3.786 1.878
- D 158 156 3 159 3 -6.174 -1.687 -0.566
- IL 159 159 3 159 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 36 ]
- ML 160 159 3 162 3 -9.189 -0.009 -7.843 -3.045 -2.938 -3.786 1.878
- D 161 159 3 162 3 -6.174 -1.687 -0.566
- IL 162 162 3 162 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 37 ]
- ML 163 162 3 165 3 -9.189 -0.009 -7.843 -3.271 1.892 -4.181 -2.934
- D 164 162 3 165 3 -6.174 -1.687 -0.566
- IL 165 165 3 165 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 38 ]
- ML 166 165 3 168 3 -9.189 -0.009 -7.843 1.922 -4.110 -3.877 -3.575
- D 167 165 3 168 3 -6.174 -1.687 -0.566
- IL 168 168 3 168 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 39 ]
- ML 169 168 3 171 3 -9.189 -0.009 -7.843 1.922 -4.110 -3.877 -3.575
- D 170 168 3 171 3 -6.174 -1.687 -0.566
- IL 171 171 3 171 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 40 ]
- ML 172 171 3 174 2 * 0.000 1.922 -4.110 -3.877 -3.575
- D 173 171 3 174 2 * 0.000
- IL 174 174 3 174 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 41 ]
- E 175 174 3 -1 0
- [ BEGR 42 ]
- S 176 63 1 177 2 -9.738 -0.002
- IL 177 177 2 177 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ BIF 43 ]
- B 178 177 2 179 229
- [ BEGL 44 ]
- S 179 178 1 180 4 -0.026 -7.622 -7.029 -7.669
- [ MATP 45 ]
- MP 180 179 1 184 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -6.266 -5.556 -6.636 -1.981 -5.840 -8.185 -2.431 -5.964 3.874 -2.273 -6.181 -2.675 -1.805 -6.305 -3.104 -5.196
- ML 181 179 1 184 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 182 179 1 184 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 183 179 1 184 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 184 184 5 184 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 185 185 6 185 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 46 ]
- MP 186 185 6 190 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -4.919 -4.800 -5.099 0.220 -3.685 -5.702 2.335 -4.946 -5.364 1.832 -5.282 -1.557 2.314 -4.999 -0.912 -3.637
- ML 187 185 6 190 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 188 185 6 190 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 189 185 6 190 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 190 190 5 190 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 191 191 6 191 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 47 ]
- MP 192 191 6 196 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -5.429 -5.615 -4.690 -0.721 -3.888 -5.359 3.350 -5.066 -6.204 -0.701 -4.824 -2.432 1.865 -5.809 -1.194 -4.348
- ML 193 191 6 196 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 194 191 6 196 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 195 191 6 196 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 196 196 5 196 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 197 197 6 197 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 48 ]
- MP 198 197 6 202 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -8.083 -4.214 -8.636 -0.936 -8.152 -4.542 -2.226 -7.336 -5.359 3.856 -4.855 -1.889 -2.148 -4.604 -4.047 -6.190
- ML 199 197 6 202 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 200 197 6 202 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 201 197 6 202 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 202 202 5 202 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 203 203 6 203 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 49 ]
- MP 204 203 6 208 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -4.315 -3.477 -5.052 2.229 -4.738 -5.126 0.397 -4.627 -4.499 2.312 -4.276 -0.930 1.859 -4.468 -1.429 -3.513
- ML 205 203 6 208 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 206 203 6 208 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 207 203 6 208 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 208 208 5 208 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 209 209 6 209 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 50 ]
- MP 210 209 6 214 4 -8.235 -8.442 -0.022 -6.856 -5.366 -5.426 -5.881 -0.978 -4.627 -7.014 1.927 -5.617 -5.650 -0.987 -6.062 -2.289 -0.311 -5.760 3.314 -4.572
- ML 211 209 6 214 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 212 209 6 214 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 213 209 6 214 4 -4.568 -4.250 -2.265 -0.520
- IL 214 214 5 214 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 215 215 6 215 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 51 ]
- ML 216 215 6 218 3 -9.189 -0.009 -7.843 -3.045 -2.938 -3.786 1.878
- D 217 215 6 218 3 -6.174 -1.687 -0.566
- IL 218 218 3 218 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 52 ]
- ML 219 218 3 221 3 -9.189 -0.009 -7.843 1.201 -1.803 -1.968 0.212
- D 220 218 3 221 3 -6.174 -1.687 -0.566
- IL 221 221 3 221 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 53 ]
- ML 222 221 3 224 3 -9.189 -0.009 -7.843 -2.459 -3.879 1.863 -3.162
- D 223 221 3 224 3 -6.174 -1.687 -0.566
- IL 224 224 3 224 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 54 ]
- ML 225 224 3 227 2 * 0.000 -3.271 1.892 -4.181 -2.934
- D 226 224 3 227 2 * 0.000
- IL 227 227 3 227 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 55 ]
- E 228 227 3 -1 0
- [ BEGR 56 ]
- S 229 178 1 230 5 -8.209 -0.018 -8.024 -8.237 -9.128
- IL 230 230 2 230 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 57 ]
- MP 231 230 2 235 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -5.905 -4.204 -6.594 -0.215 -6.822 -5.367 -1.313 -5.820 -5.297 3.357 -4.936 1.879 -1.271 -5.043 -2.815 -4.842
- ML 232 230 2 235 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 233 230 2 235 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 234 230 2 235 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 235 235 5 235 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 236 236 6 236 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 58 ]
- MP 237 236 6 241 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -5.595 -5.397 -6.100 -1.673 -5.082 -7.387 -1.510 -5.714 -5.651 -1.884 -5.981 -2.570 3.861 -5.838 -2.612 -4.809
- ML 238 236 6 241 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 239 236 6 241 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 240 236 6 241 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 241 241 5 241 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 242 242 6 242 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 59 ]
- MP 243 242 6 247 6 -9.739 -9.679 -0.014 -8.455 -8.735 -9.130 -8.083 -4.214 -8.636 -0.936 -8.152 -4.542 -2.226 -7.336 -5.359 3.856 -4.855 -1.889 -2.148 -4.604 -4.047 -6.190
- ML 244 242 6 247 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 245 242 6 247 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 246 242 6 247 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 247 247 5 247 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 248 248 6 248 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 60 ]
- MP 249 248 6 253 4 -8.235 -8.442 -0.022 -6.856 -8.083 -4.214 -8.636 -0.936 -8.152 -4.542 -2.226 -7.336 -5.359 3.856 -4.855 -1.889 -2.148 -4.604 -4.047 -6.190
- ML 250 248 6 253 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 251 248 6 253 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 252 248 6 253 4 -4.568 -4.250 -2.265 -0.520
- IL 253 253 5 253 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 254 254 6 254 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 61 ]
- ML 255 254 6 257 3 -9.189 -0.009 -7.843 -3.045 -2.938 -3.786 1.878
- D 256 254 6 257 3 -6.174 -1.687 -0.566
- IL 257 257 3 257 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 62 ]
- ML 258 257 3 260 3 -9.189 -0.009 -7.843 -3.045 -2.938 -3.786 1.878
- D 259 257 3 260 3 -6.174 -1.687 -0.566
- IL 260 260 3 260 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 63 ]
- ML 261 260 3 263 3 -9.189 -0.009 -7.843 -3.271 1.892 -4.181 -2.934
- D 262 260 3 263 3 -6.174 -1.687 -0.566
- IL 263 263 3 263 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 64 ]
- ML 264 263 3 266 3 -9.189 -0.009 -7.843 -0.134 -2.839 1.449 -2.192
- D 265 263 3 266 3 -6.174 -1.687 -0.566
- IL 266 266 3 266 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 65 ]
- ML 267 266 3 269 3 -9.189 -0.009 -7.843 1.922 -4.110 -3.877 -3.575
- D 268 266 3 269 3 -6.174 -1.687 -0.566
- IL 269 269 3 269 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 66 ]
- ML 270 269 3 272 3 -9.189 -0.009 -7.843 -1.578 -0.286 -2.393 1.408
- D 271 269 3 272 3 -6.174 -1.687 -0.566
- IL 272 272 3 272 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 67 ]
- ML 273 272 3 275 2 * 0.000 -3.045 -2.938 -3.786 1.878
- D 274 272 3 275 2 * 0.000
- IL 275 275 3 275 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 68 ]
- E 276 275 3 -1 0
-//
diff --git a/FILES b/FILES
index b6ae0ee..84d3d7b 100644
--- a/FILES
+++ b/FILES
@@ -41,7 +41,6 @@ Source / data files for tRNAscan-SE:
tRNAscan-SE.src PERL script source, must be run thru a 'make' to
do variable substitutions and create executable
file 'tRNAscan-SE'
-tRNAscanSE/*.cm PERL modules required for executing tRNAscan-SE
gcode.cilnuc Alternate genetic codes for Ciliates,
Dasycladacean, & Hexamita nuclear tRNAs
@@ -72,7 +71,7 @@ pavesi.c tRNA feature search functions
eufind_const.h constants & data structures
-Source / data files for Cove/Infernal package:
+Source / data files for Cove package:
TRNA2.cm default covariance model used by Cove to detect tRNAs
(built from hand-edited alignment of over
@@ -83,7 +82,7 @@ TRNA2ns.cm primary-structure only (HMM-like) covariance model used by
this model uses the same tRNA alignment as
TRNA2.cm, but excludes all secondary structure
information
-TRNA2-*.cm domain-specific covariance model used by Cove to detect tRNAs
+
PSELC.cm covariance model used to detect prokaryotic
selenocysteine tRNAs (also gives more accurate
secondary structure predictions of selcys tRNAs)
@@ -92,9 +91,6 @@ ESELC.cm covariance model used to detect eukaryotic
selenocysteine tRNAs (also gives more accurate
secondary structure predictions of selcys tRNAs)
trained on 7 known euk selcys tRNAs
-*inf-*.cm covariance models used by Infernal to detect tRNAs
-Archaea-BHB-noncan.cm covariance model used by Infernal to detect
- noncanonical tRNA introns in archaea
align_main.c main() for covea, multiple alignment
build_main.c main() for coveb, model construction
diff --git a/Makefile b/Makefile
index 9147eac..53e5c5b 100644
--- a/Makefile
+++ b/Makefile
@@ -4,8 +4,8 @@
COV_RELEASE = "2.4.4"
EUFIND_RELEASE = "1.1"
-SE_RELEASE = "1.3.1"
-RELEASEDATE= "January 2012"
+SE_RELEASE = "1.23"
+RELEASEDATE= "April 2002"
RFLAGS = -DRELEASE=$(COV_RELEASE) -DRELEASEDATE=$(RELEASEDATE)
## Note: if you want to use the -i option, use "make no-ambig"
@@ -106,7 +106,7 @@ OBJ = align.o dbviterbi.o debug.o emit.o fast-dbviterbi.o fastmodelmaker.o\
MPOBJ = mpviterbi.o mp-dbviterbi.o
-all: $(PROGS) tRNAscan-SE setpaths
+all: $(PROGS) tRNAscanSE setpaths
covels-SE: $(OBJ) scan_main.o
$(CC) $(CFLAGS) $(RFLAGS) -o covels-SE scan_main.o $(OBJ) $(LIBS)
@@ -121,7 +121,7 @@ eufindtRNA: $(SQUIDOBJ) pavesi.o eufind_main.o
trnascan-1.4: trnascan.o
$(CC) $(CFLAGS) -DTSCANDIR=\"$(LIBDIR)\" -o trnascan-1.4 trnascan.c
-tRNAscan-SE:
+tRNAscanSE:
$(PERLDIR)/$(PERLBIN) checkversion.pl
sed 's#/tmp#$(TEMPDIR)#g' tRNAscan-SE.src | \
sed 's#bindir = ""#bindir =\"$(BINDIR)/"#g' | \
@@ -140,7 +140,6 @@ tRNAscan-SE:
setpaths:
@echo 'setenv PATH "$$PATH"":""$(BINDIR)"' > setup.tRNAscan-SE
- @echo 'setenv PERL5LIB "$$PERL5LIB"":""$(BINDIR)"' >> setup.tRNAscan-SE
@echo 'setenv MANPATH "$$MANPATH"":""$(MANDIR)"' >> setup.tRNAscan-SE
@echo ""
@echo "The file \"setup.tRNAscan-SE\" has been created."
@@ -158,8 +157,7 @@ setpaths:
@echo "be sure to make the following changes:"
@echo ""
@echo "1) Add $(BINDIR) to your PATH variable"
- @echo "2) Add $(BINDIR) to your PERl5LIB variable"
- @echo "3) Add $(MANDIR) to your MANPATH variable"
+ @echo "2) Add $(MANDIR) to your MANPATH variable"
@echo ""
install: $(PROGS) tRNAscanSE
@@ -168,7 +166,6 @@ install: $(PROGS) tRNAscanSE
@if test -d $(TEMPDIR); then echo .; else mkdir -p $(TEMPDIR); fi
@if test -d $(MANDIR)/man$(MANSUFFIX); then echo .; else mkdir -p $(MANDIR)/man$(MANSUFFIX); fi
cp $(PROGS) tRNAscan-SE $(BINDIR)/.
- cp -R tRNAscanSE $(BINDIR)/
cp TPCsignal Dsignal *.cm gcode.* $(LIBDIR)/.
@if test -r trnascan-1.4-NA; then cp trnascan-1.4-NA $(BINDIR)/.; fi
@if test -r eufindtRNA-NA; then cp eufindtRNA-NA $(BINDIR)/.; fi
@@ -189,9 +186,9 @@ testrun:
echo ""; echo ""; \
echo "tRNAscan-SE up and running correctly!"; echo ""; \
else echo "Test run result file differs from reference result file!";\
- echo "tRNAscan-SE may not have executed correctly."; echo ""; \
+ echo "tRNAscan-SE may not have executed correctly."; @echo ""; \
echo "Please double check for correct compilation & installation"; \
- echo " and try 'make testrun' again."; echo ""; fi
+ echo " and try 'make testrun' again."; @echo ""; fi
# compiles versions of pre-scanners that do not conservatively
# call tRNAs with ambiguous bases
diff --git a/Manual.ps b/Manual.ps
index 6019fab..5cdda95 100644
--- a/Manual.ps
+++ b/Manual.ps
@@ -1,16 +1,14 @@
%!PS-Adobe-2.0
-%%Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software
+%%Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software
%%Title: Manual.dvi
%%Pages: 30
%%PageOrder: Ascend
-%%BoundingBox: 0 0 596 842
-%%DocumentFonts: CMBX12 CMTI12 CMR17 CMR12 CMBXTI10 CMR10 CMSY10 CMTI10
-%%+ CMBX10 CMMI10 CMTT10 CMITT10 CMTT9
+%%BoundingBox: 0 0 612 792
%%EndComments
%DVIPSWebPage: (www.radicaleye.com)
%DVIPSCommandLine: dvips -o Manual.ps Manual.dvi
%DVIPSParameters: dpi=600, compressed
-%DVIPSSource: TeX output 2008.06.04:0330
+%DVIPSSource: TeX output 2002.04.12:1312
%%BeginProcSet: texc.pro
%!
/TeXDict 300 dict def TeXDict begin/N{def}def/B{bind def}N/S{exch}N/X{S
@@ -69,3636 +67,2129 @@ p -2 w}B/o{p -1 w}B/q{p 1 w}B/r{p 2 w}B/s{p 3 w}B/t{p 4 w}B/x{0 S
rmoveto}B/y{3 2 roll p a}B/bos{/SS save N}B/eos{SS restore}B end
%%EndProcSet
-%%BeginProcSet: f7b6d320.enc
-% Thomas Esser, Dec 2002. public domain
-%
-% Encoding for:
-% cmb10 cmbx10 cmbx12 cmbx5 cmbx6 cmbx7 cmbx8 cmbx9 cmbxsl10
-% cmdunh10 cmr10 cmr12 cmr17cmr6 cmr7 cmr8 cmr9 cmsl10 cmsl12 cmsl8
-% cmsl9 cmss10cmss12 cmss17 cmss8 cmss9 cmssbx10 cmssdc10 cmssi10
-% cmssi12 cmssi17 cmssi8cmssi9 cmssq8 cmssqi8 cmvtt10
-%
-/TeXf7b6d320Encoding [
-/Gamma /Delta /Theta /Lambda /Xi /Pi /Sigma /Upsilon /Phi /Psi /Omega
-/ff /fi /fl /ffi /ffl /dotlessi /dotlessj /grave /acute /caron /breve
-/macron /ring /cedilla /germandbls /ae /oe /oslash /AE /OE /Oslash
-/suppress /exclam /quotedblright /numbersign /dollar /percent /ampersand
-/quoteright /parenleft /parenright /asterisk /plus /comma /hyphen
-/period /slash /zero /one /two /three /four /five /six /seven /eight
-/nine /colon /semicolon /exclamdown /equal /questiondown /question /at
-/A /B /C /D /E /F /G /H /I /J /K /L /M /N /O /P /Q /R /S /T /U /V /W /X
-/Y /Z /bracketleft /quotedblleft /bracketright /circumflex /dotaccent
-/quoteleft /a /b /c /d /e /f /g /h /i /j /k /l /m /n /o /p /q /r /s /t /u
-/v /w /x /y /z /endash /emdash /hungarumlaut /tilde /dieresis /suppress
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /space
-/Gamma /Delta /Theta /Lambda /Xi /Pi /Sigma /Upsilon /Phi /Psi /.notdef
-/.notdef /Omega /ff /fi /fl /ffi /ffl /dotlessi /dotlessj /grave /acute
-/caron /breve /macron /ring /cedilla /germandbls /ae /oe /oslash /AE
-/OE /Oslash /suppress /dieresis /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-] def
-
-%%EndProcSet
-%%BeginProcSet: 74afc74c.enc
-% Thomas Esser, Dec 2002. public domain
-%
-% Encoding for:
-% cmbxti10 cmff10 cmfi10 cmfib8 cmti10 cmti12 cmti7 cmti8cmti9 cmu10
-%
-/TeX74afc74cEncoding [
-/Gamma /Delta /Theta /Lambda /Xi /Pi /Sigma /Upsilon /Phi /Psi /Omega
-/ff /fi /fl /ffi /ffl /dotlessi /dotlessj /grave /acute /caron /breve
-/macron /ring /cedilla /germandbls /ae /oe /oslash /AE /OE /Oslash
-/suppress /exclam /quotedblright /numbersign /sterling /percent
-/ampersand /quoteright /parenleft /parenright /asterisk /plus /comma
-/hyphen /period /slash /zero /one /two /three /four /five /six /seven
-/eight /nine /colon /semicolon /exclamdown /equal /questiondown /question
-/at /A /B /C /D /E /F /G /H /I /J /K /L /M /N /O /P /Q /R /S /T /U /V /W
-/X /Y /Z /bracketleft /quotedblleft /bracketright /circumflex /dotaccent
-/quoteleft /a /b /c /d /e /f /g /h /i /j /k /l /m /n /o /p /q /r /s /t /u
-/v /w /x /y /z /endash /emdash /hungarumlaut /tilde /dieresis /suppress
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /space
-/Gamma /Delta /Theta /Lambda /Xi /Pi /Sigma /Upsilon /Phi /Psi /.notdef
-/.notdef /Omega /ff /fi /fl /ffi /ffl /dotlessi /dotlessj /grave /acute
-/caron /breve /macron /ring /cedilla /germandbls /ae /oe /oslash /AE
-/OE /Oslash /suppress /dieresis /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-] def
-
-%%EndProcSet
-%%BeginProcSet: bbad153f.enc
-% Thomas Esser, Dec 2002. public domain
-%
-% Encoding for:
-% cmsy10 cmsy5 cmsy6 cmsy7 cmsy8 cmsy9
-%
-/TeXbbad153fEncoding [
-/minus /periodcentered /multiply /asteriskmath /divide /diamondmath
-/plusminus /minusplus /circleplus /circleminus /circlemultiply
-/circledivide /circledot /circlecopyrt /openbullet /bullet
-/equivasymptotic /equivalence /reflexsubset /reflexsuperset /lessequal
-/greaterequal /precedesequal /followsequal /similar /approxequal
-/propersubset /propersuperset /lessmuch /greatermuch /precedes /follows
-/arrowleft /arrowright /arrowup /arrowdown /arrowboth /arrownortheast
-/arrowsoutheast /similarequal /arrowdblleft /arrowdblright /arrowdblup
-/arrowdbldown /arrowdblboth /arrownorthwest /arrowsouthwest /proportional
-/prime /infinity /element /owner /triangle /triangleinv /negationslash
-/mapsto /universal /existential /logicalnot /emptyset /Rfractur /Ifractur
-/latticetop /perpendicular /aleph /A /B /C /D /E /F /G /H /I /J /K
-/L /M /N /O /P /Q /R /S /T /U /V /W /X /Y /Z /union /intersection
-/unionmulti /logicaland /logicalor /turnstileleft /turnstileright
-/floorleft /floorright /ceilingleft /ceilingright /braceleft /braceright
-/angbracketleft /angbracketright /bar /bardbl /arrowbothv /arrowdblbothv
-/backslash /wreathproduct /radical /coproduct /nabla /integral
-/unionsq /intersectionsq /subsetsqequal /supersetsqequal /section
-/dagger /daggerdbl /paragraph /club /diamond /heart /spade /arrowleft
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/minus /periodcentered /multiply /asteriskmath /divide /diamondmath
-/plusminus /minusplus /circleplus /circleminus /.notdef /.notdef
-/circlemultiply /circledivide /circledot /circlecopyrt /openbullet
-/bullet /equivasymptotic /equivalence /reflexsubset /reflexsuperset
-/lessequal /greaterequal /precedesequal /followsequal /similar
-/approxequal /propersubset /propersuperset /lessmuch /greatermuch
-/precedes /follows /arrowleft /spade /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-] def
-
-%%EndProcSet
-%%BeginProcSet: aae443f0.enc
-% Thomas Esser, Dec 2002. public domain
-%
-% Encoding for:
-% cmmi10 cmmi12 cmmi5 cmmi6 cmmi7 cmmi8 cmmi9 cmmib10
-%
-/TeXaae443f0Encoding [
-/Gamma /Delta /Theta /Lambda /Xi /Pi /Sigma /Upsilon /Phi /Psi /Omega
-/alpha /beta /gamma /delta /epsilon1 /zeta /eta /theta /iota /kappa
-/lambda /mu /nu /xi /pi /rho /sigma /tau /upsilon /phi /chi /psi
-/omega /epsilon /theta1 /pi1 /rho1 /sigma1 /phi1 /arrowlefttophalf
-/arrowleftbothalf /arrowrighttophalf /arrowrightbothalf /arrowhookleft
-/arrowhookright /triangleright /triangleleft /zerooldstyle /oneoldstyle
-/twooldstyle /threeoldstyle /fouroldstyle /fiveoldstyle /sixoldstyle
-/sevenoldstyle /eightoldstyle /nineoldstyle /period /comma /less /slash
-/greater /star /partialdiff /A /B /C /D /E /F /G /H /I /J /K /L /M /N
-/O /P /Q /R /S /T /U /V /W /X /Y /Z /flat /natural /sharp /slurbelow
-/slurabove /lscript /a /b /c /d /e /f /g /h /i /j /k /l /m /n /o /p
-/q /r /s /t /u /v /w /x /y /z /dotlessi /dotlessj /weierstrass /vector
-/tie /psi /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/space /Gamma /Delta /Theta /Lambda /Xi /Pi /Sigma /Upsilon /Phi /Psi
-/.notdef /.notdef /Omega /alpha /beta /gamma /delta /epsilon1 /zeta /eta
-/theta /iota /kappa /lambda /mu /nu /xi /pi /rho /sigma /tau /upsilon
-/phi /chi /psi /tie /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef
-] def
-
-%%EndProcSet
-%%BeginProcSet: 09fbbfac.enc
-% Thomas Esser, Dec 2002. public domain
-%
-% Encoding for:
-% cmsltt10 cmtt10 cmtt12 cmtt8 cmtt9
-/TeX09fbbfacEncoding [
-/Gamma /Delta /Theta /Lambda /Xi /Pi /Sigma /Upsilon /Phi /Psi
-/Omega /arrowup /arrowdown /quotesingle /exclamdown /questiondown
-/dotlessi /dotlessj /grave /acute /caron /breve /macron /ring /cedilla
-/germandbls /ae /oe /oslash /AE /OE /Oslash /visiblespace /exclam
-/quotedbl /numbersign /dollar /percent /ampersand /quoteright /parenleft
-/parenright /asterisk /plus /comma /hyphen /period /slash /zero /one
-/two /three /four /five /six /seven /eight /nine /colon /semicolon /less
-/equal /greater /question /at /A /B /C /D /E /F /G /H /I /J /K /L /M /N
-/O /P /Q /R /S /T /U /V /W /X /Y /Z /bracketleft /backslash /bracketright
-/asciicircum /underscore /quoteleft /a /b /c /d /e /f /g /h /i /j /k /l
-/m /n /o /p /q /r /s /t /u /v /w /x /y /z /braceleft /bar /braceright
-/asciitilde /dieresis /visiblespace /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /space /Gamma /Delta /Theta /Lambda /Xi /Pi
-/Sigma /Upsilon /Phi /Psi /.notdef /.notdef /Omega /arrowup /arrowdown
-/quotesingle /exclamdown /questiondown /dotlessi /dotlessj /grave /acute
-/caron /breve /macron /ring /cedilla /germandbls /ae /oe /oslash /AE
-/OE /Oslash /visiblespace /dieresis /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-] def
-
-%%EndProcSet
-%%BeginProcSet: b6a4d7c7.enc
-% Thomas Esser, Dec 2002. public domain
-%
-% Encoding for:
-% cmitt10
-%
-/TeXb6a4d7c7Encoding [
-/Gamma /Delta /Theta /Lambda /Xi /Pi /Sigma /Upsilon /Phi /Psi /Omega
-/arrowup /arrowdown /quotesingle /exclamdown /questiondown /dotlessi
-/dotlessj /grave /acute /caron /breve /macron /ring /cedilla /germandbls
-/ae /oe /oslash /AE /OE /Oslash /visiblespace /exclam /quotedbl
-/numbersign /sterling /percent /ampersand /quoteright /parenleft
-/parenright /asterisk /plus /comma /hyphen /period /slash /zero /one
-/two /three /four /five /six /seven /eight /nine /colon /semicolon /less
-/equal /greater /question /at /A /B /C /D /E /F /G /H /I /J /K /L /M /N
-/O /P /Q /R /S /T /U /V /W /X /Y /Z /bracketleft /backslash /bracketright
-/asciicircum /underscore /quoteleft /a /b /c /d /e /f /g /h /i /j /k /l
-/m /n /o /p /q /r /s /t /u /v /w /x /y /z /braceleft /bar /braceright
-/asciitilde /dieresis /visiblespace /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /space /Gamma /Delta /Theta /Lambda /Xi /Pi
-/Sigma /Upsilon /Phi /Psi /.notdef /.notdef /Omega /arrowup /arrowdown
-/quotesingle /exclamdown /questiondown /dotlessi /dotlessj /grave /acute
-/caron /breve /macron /ring /cedilla /germandbls /ae /oe /oslash /AE
-/OE /Oslash /visiblespace /dieresis /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-/.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef
-] def
-
-%%EndProcSet
-%%BeginProcSet: texps.pro
-%!
-TeXDict begin/rf{findfont dup length 1 add dict begin{1 index/FID ne 2
-index/UniqueID ne and{def}{pop pop}ifelse}forall[1 index 0 6 -1 roll
-exec 0 exch 5 -1 roll VResolution Resolution div mul neg 0 0]FontType 0
-ne{/Metrics exch def dict begin Encoding{exch dup type/integertype ne{
-pop pop 1 sub dup 0 le{pop}{[}ifelse}{FontMatrix 0 get div Metrics 0 get
-div def}ifelse}forall Metrics/Metrics currentdict end def}{{1 index type
-/nametype eq{exit}if exch pop}loop}ifelse[2 index currentdict end
-definefont 3 -1 roll makefont/setfont cvx]cvx def}def/ObliqueSlant{dup
-sin S cos div neg}B/SlantFont{4 index mul add}def/ExtendFont{3 -1 roll
-mul exch}def/ReEncodeFont{CharStrings rcheck{/Encoding false def dup[
-exch{dup CharStrings exch known not{pop/.notdef/Encoding true def}if}
-forall Encoding{]exch pop}{cleartomark}ifelse}if/Encoding exch def}def
+TeXDict begin 40258431 52099146 1000 600 600 (Manual.dvi)
+ at start
+%DVIPSBitmapFont: Fa cmtt9 9 50
+/Fa 50 125 df<EB01C0EB03E0130F131FEB3FC0EB7F80EBFE00485A5B1203485A5B485A
+A2485AA248C7FCA3127EA45AAC127EA47EA36C7EA26C7EA26C7E7F6C7E12017F6C7EEB7F
+80EB3FC0EB1FE0130F1303EB01C0133A73B327>40 D<127012F812FE7E6C7E6C7EEA0FE0
+6C7E12037F6C7E1200137EA27FA2EB1F80A3EB0FC0A4EB07E0ACEB0FC0A4EB1F80A3EB3F
+00A2137EA25B1201485A5B1207485AEA3FC0485A48C7FC5A12F81270133A7AB327>I<13
+0F497EA60078EB81E000FEEB87F000FF138FEBDFBF6CB512E06C14C0000F1400000313FC
+C613F0A2000313FC000F13FF003F14C04814E039FFDFBFF0EB1F8F00FE13870078EB81E0
+0000EB8000A66DC7FC1C207BA627>I<EB03C0497EAD007FB512FEB7FCA46C14FE390007
+E000AD6D5A20227DA727>I<007FB512F8B612FCA46C14F81E067C9927>45
+D<121EEA7F80A2EAFFC0A4EA7F80A2EA1E000A0A728927>I<1538157C15FCA2140115F8
+140315F0140715E0140F15C0141F1580143F1500A25C147E14FE5C13015C13035C13075C
+130F5CA2131F5C133F91C7FC5B137E13FE5B12015B12035BA212075B120F5B121F5B123F
+90C8FC5A127E12FE5AA25A12781E3A7CB327>I<EB07E0EB3FFC497E90B5FC4814803903
+FC3FC03907F00FE0390FE007F0EBC003391F8001F8A248C712FCA2003E147C007E147EA3
+007C143E00FC143FAC007E147EA46C14FCA2EB8001001F14F8EBC003000F14F0EBE00739
+07F00FE03903FC3FC06CB512806C14006D5A6D5AEB07E020307DAE27>I<EB3FE03801FF
+F84813FE000FEBFF804814C0393FE07FE0EB800F397F0007F0007EEB03F800FE13015A6C
+14FC1400A3127CC8FCA2140115F8A2140315F01407EC0FE0EC1FC0143FEC7F80ECFF0049
+5A495A495A495A495A495A495A01FEC7FC485AD807F81378484813FC485A485A48B5FCB6
+FCA36C14F81E2F7CAE27>50 D<EB1FF8EBFFFE0003EBFF80000F14C015E0391FF01FF039
+3FC007F8EB800115FC1400A26CC7FC1204C8FC140115F81403EC07F0140FEC3FE090381F
+FFC0491380A215E06D13F09038001FF8EC03FC1401EC00FE157E157F153FA21238127C12
+FEA2157F48147E6C14FE007FEB01FCEB8003393FF01FF86CB512F06C14E000031480C6EB
+FE00EB1FF820307DAE27>I<EC3F804A7EA214FF5BA2EB03F7EB07E7A2EB0FC71487131F
+EB3F07A2137E13FCA2EA01F813F01203EA07E0A2EA0FC0EA1F80A2EA3F00123E127E5AB7
+128016C0A36C1580C73807C000A849B5FC491480A36D1400222F7EAE27>I<001FB512E0
+4814F0A315E090C8FCACEB1FF0EBFFFC14FF158015C09038F03FE09038C00FF0EB000700
+3EEB03F8001C1301C7FC15FC1400A3127C12FEA2140115F84813036C14F0007F130F9038
+801FE0393FE07FC06CB512806C14006C5B000113F838007FC01E2F7CAD27>I<14FF0107
+13C0011F13F04913F890B5FC48EB81FC3803FE0113F8EA07F0EA0FE09038C000F8001F14
+00485A90C8FCA25A127EEB0FF838FE3FFE48B51280B612C015E09038F80FF09038E007F8
+90388001FC90C7FC15FE48147E157F153F5A7E127EA3127F6C147F157E6C6C13FE9038C0
+01FC120F9038F007F83907F81FF06CB512E06C14C06C148090383FFE00EB0FF820307DAE
+27>I<1278B612FE15FFA315FE39FC0001FCEC03F8EC07F0007814E0C7120FEC1FC01580
+143FEC7F00147E14FE5C13015C13035C13075CA2495AA3495AA3133F91C7FCA55B137EA9
+133C20307DAE27>I<EB0FF0EB7FFE48B512804814C0000F14F0EBF81F391FE007F8393F
+8001FC90C7FC4814FE007E147EA56C14FCEB8001391FC003F8390FE007F03907FC3FE000
+01B5128039007FFE006D5A90B5FC000314C0390FF00FF0391FC003F8393F8001FC90C7FC
+007E147EA248143FA6007E147EA2007F14FE393F8001FC391FE007F8EBF81F6CB512F06C
+14E00001148039007FFE00EB0FF020307DAE27>I<EB0FF0EB7FFC48B5FC4814804814C0
+390FF81FE0391FE007F0393FC003F8EB8001D87F0013FC007E130012FE48147EA4157F15
+3F157F7E127E007F14FF7E6D5A381FE007380FF01F6CB6FC7E6C143F39007FFC7F90381F
+F07E90C7FCA215FCA2140115F8001F1303393F8007F0EC0FE0141FEC3FC09038C0FF806C
+B512005C6C13F8000313E0C6138020307DAE27>I<121EEA7F80A2EAFFC0A4EA7F80A2EA
+1E00C7FCAC121EEA7F80A2EAFFC0A4EA7F80A2EA1E000A20729F27>I<153815FC140114
+07140FEC3FF8EC7FE0ECFFC001031300495AEB1FF8495A495A3801FF804890C7FCEA0FFC
+485AEA7FF0EAFFC05BA27FEA7FF0EA1FF86C7EEA03FF6C7F38007FE06D7E6D7EEB07FE6D
+7E010013C0EC7FE0EC3FF8EC0FFC14071401140015381E287CAA27>60
+D<127012FC7E6C7E7FEA7FF0EA1FF86C7EEA03FF6C7F38007FE06D7E6D7EEB07FE6D7E01
+0013C0EC7FE0EC3FF8EC0FFC1407A2140FEC3FF8EC7FE0ECFFC001031300495AEB1FF849
+5A495A3801FF804890C7FCEA0FFC485AEA7FF0EAFFC05B48C8FC5A12701E287CAA27>62
+D<EB03F0497EA2497EA4143CEB1F3EA5EB3F3FA3EB3E1FA2017E7FA4496C7EA548486C7E
+A390B5FCA24880A3EBF003A248486C7EA4000F803A7FFC0FFF8000FF15C06D5A497E007F
+1580222F7EAE27>65 D<007FB5FCB612C08115F87E3907E003FCEC00FE157E157F81A615
+7EA25D1403EC0FF890B55A15C015F081819038E000FE157FED3F80151FA2ED0FC0A6151F
+1680153FED7F004A5A007FB55AB65A5D15E06C1480222E7FAD27>I<903803F80E90381F
+FE1F90383FFFBF90B6FC5A3803FE0F3807F803497E48487E485A49137FA248C7123FA25A
+127E151E150012FE5AAA7E127EA2151E007F143F7EA26C7E157F6D137E6C6C13FE3907F0
+01FCEBF8033903FE0FF86CB512F06C14E0013F13C06D1300EB03F820307DAE27>I<387F
+FFFC14FFB612C06C80813907E00FF81407EC01FC6E7EA2157E157F811680151FA316C015
+0FABED1F80A3153F1600A25D15FEA24A5A4A5A140F007FB55A5DB65A6C91C7FC14FC222E
+7FAD27>I<007FB61280B712C0A37E3907E0000FA6ED078092C7FCA4EC07804A7EA390B5
+FCA5EBE00FA36E5A91C8FCA4ED03C0ED07E0A7007FB6FCB7FCA36C15C0232E7FAD27>I<
+007FB61280B712C0A37E3907E0000FA6ED078092C7FCA4EC07804A7EA390B5FCA5EBE00F
+A36E5A91C8FCAC387FFF80B57EA36C5B222E7EAD27>I<903807F03890381FFC7C90387F
+FFFC90B5FC5A3803FC1F3807F00F380FE007EBC003001F13011380123F90C7FCA2127EA2
+157892C7FC5AA8EC1FFF4A1380A3007E6D1300EC00FCA36C1301A21380121FEBC003120F
+EBE0073807F00F3803FC1F6CB5FC7EEB7FFE90381FFC78D907F0C7FC21307DAE27>I<00
+7FB512E0B612F0A36C14E039001F8000B3B2007FB512E0B612F0A36C14E01C2E7BAD27>
+73 D<387FFFC080B5FC7E5CD803F0C8FCB3AAED0780ED0FC0A7007FB6FCA2B7FC7E1680
+222E7FAD27>76 D<007FB5FCB612E081816C803907E003FEEC00FF81ED3F80151F16C015
+0FA6151F1680153FED7F005DEC03FE90B55A5D5D5D92C7FC01E0C8FCADEA7FFEB5FCA36C
+5A222E7FAD27>80 D<90387FC0E03901FFF1F0000713FF5A5AEA3FE0EB801F387F000F00
+7E130712FE5A1403A3EC01E06C90C7FC127E127FEA3FC013F86CB47E6C13F86C13FE6CEB
+FF80C614C0010F13E0010013F0140FEC07F81403140115FC1400127812FCA46CEB01F8A2
+6C130390388007F09038F01FE090B5FC15C0150000F85B38701FF81E307CAE27>83
+D<007FB61280B712C0A439FC03F00FA60078EC0780000091C7FCB3AB90B512C04880A36C
+5C222E7EAD27>I<3803FFC0000F13F04813FC4813FF811380EC1FC0381F000F000480C7
+1207A2EB0FFF137F0003B5FC120F5A383FFC07EA7FC0130012FE5AA46C130F007F131FEB
+C0FF6CB612806C15C07E000313F1C69038807F8022207C9F27>97
+D<EA7FE0487EA3127F1203A914FF01F313C090B512F08181EC81FE49C67E49EB3F804913
+1F16C049130FA216E01507A6150F16C07F151F6DEB3F80157F6DEBFF009038FF83FEECFF
+FC5D5D01F313C02601E0FEC7FC232E7FAD27>I<EB0FFF017F13C048B512E04814F05A38
+0FF807EA1FE0393FC003E0903880008048C8FC127EA212FE5AA67E127EA2007F14F0393F
+8001F813C0381FE003390FF80FF06CB5FC6C14E06C14C06C6C1300EB0FF81D207B9F27>
+I<EC3FF04A7EA3143F1401A9EB0FE1EB7FFD48B5FC5A5A380FF83F381FE00F383FC007EB
+8003EA7F00007E1301A212FE5AA67E007E1303A2127F6C1307EB800F381FE01F380FF03F
+6CB612C06C15E06C13FD38007FF9D91FE013C0232E7EAD27>I<EB0FF8EB3FFE90B51280
+000314C04814E0390FFC0FF0391FE003F8EBC001D83F8013FC48C7FC127E157E12FEB612
+FEA415FC00FCC8FC7E127E127F6C143C6D137E6C7E01F013FE390FFC07FC6CB5FC000114
+F86C14F0013F13C0903807FE001F207D9F27>I<153F90391FC0FF80D97FF313C048B612
+E05A4814EF390FF07F873A1FC01FC3C0EDC000EB800F48486C7EA66C6C485AEBC01FA239
+0FF07F8090B5C7FC5C485BEB7FF0EB1FC090C9FCA27F6CB5FC15E015F84814FE4880EB80
+01007EC7EA3F80007C140F00FC15C0481407A46C140F007C1580007F143F6C6CEB7F0090
+38F807FF6CB55A000714F86C5CC614C0D90FFCC7FC23337EA027>103
+D<EA7FE0487EA3127F1203A9147F9038F1FFC001F713F090B5FC8114C1EC01FCEBFE005B
+5BA25BB03A7FFF83FFE0B500C713F0A36C018313E0242E7FAD27>I<130F497E497EA46D
+5A6DC7FC90C8FCA7383FFF80487FA37EEA000FB3A4007FB512F0B6FC15F815F07E1D2F7B
+AE27>I<387FFF80B57EA37EEA000FB3B2007FB512F8B612FCA36C14F81E2E7CAD27>108
+D<397F07C01F3AFF9FF07FC09039FFF9FFE091B57E7E3A0FFC7FF1F89038F03FC001E013
+8001C01300A3EB803EB03A7FF0FFC3FF486C01E3138001F913E701F813E36C4801C31300
+2920819F27>I<387FE07F39FFF1FFC001F713F090B5FC6C80000313C1EC01FCEBFE005B
+5BA25BB03A7FFF83FFE0B500C713F0A36C018313E024207F9F27>I<EB1FE0EB7FF83801
+FFFE487F481480390FF03FC0391FC00FE0393F8007F0EB00034814F8007E1301A248EB00
+FCA76C1301007E14F8A2007F1303393F8007F0A2391FE01FE0390FF03FC06CB512806C14
+006C5B38007FF8EB1FE01E207C9F27>I<387FE0FFD8FFF313C090B512F0816C800003EB
+81FE49C67E49EB3F8049131F16C049130FA216E01507A6150F16C07F151F6DEB3F80157F
+6DEBFF009038FF83FEECFFFC5D5D01F313C0D9F0FEC7FC91C8FCAC387FFF80B57EA36C5B
+23317F9F27>I<90380FF03C90383FFE7E90B5FC000314FE5A380FFC1F381FE007EBC003
+383F800148C7FC127EA200FE147E5AA67E007E14FEA2007F1301EA3F80EBC003381FE007
+380FF81F6CB5FC7E6C147E38007FFCEB0FF090C7FCAC91381FFFF8A24A13FC6E13F8A226
+317E9F27>I<397FFC03FC39FFFE0FFF023F13804A13C0007F90B5FC39007FFE1F14F891
+38F00F809138E002004AC7FC5CA291C8FCA2137EAD007FB57EB67EA36C5C22207E9F27>
+I<9038FFF3800007EBFFC0121F5A5AEB803F38FC000F5AA2EC07806C90C7FCEA7F8013FC
+383FFFF06C13FC000713FF00011480D8000F13C09038003FE014070078EB03F000FC1301
+A27E14036CEB07E0EBE01F90B512C01580150000FB13FC38707FF01C207B9F27>I<133C
+137EA8007FB512F0B612F8A36C14F0D8007EC7FCAE1518157EA415FE6D13FC1483ECFFF8
+6D13F06D13E0010313C0010013001F297EA827>I<3A7FFC0FFF80486C4813C0A36C486C
+13803A07E000F800000313015D13F00001130301F85B1200A26D485A137CA290387E0F80
+133EA2011F90C7FC5CA2130F149E14BE130714FC1303A25C1301A25CA213035CA213075C
+1208EA3E0F007F5B131FD87E7FC8FCEA7FFE6C5A5B6C5AEA07C022317E9F27>121
+D<127812FCB3B3B3A21278063A70B327>124 D E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fb cmitt10 10.95 13
+/Fb 13 118 df<007FB612E016F0B712F8A36C15F016E02507749E30>45
+D<EA7FFEB5FCA47EC6FC5BA21201A25BA21203A25B147F3907F9FFC090B512F081815AEC
+C1FE1400497F48487F5B5BED3F80485A5BA25B007F147F160090C7FCA25D485C5A14015D
+14035D14074A5A7E6C495A4A5AEB80FFD83FC35B90B5C7FC6C5B6C13F86C5B6C13C0C690
+C8FC213974B730>98 D<EC1FE0ECFFF8010313FE497F131F49148090387FF07F9039FFC0
+3FC0481300485A4848EB7F805B4848133F48481400150C484890C7FC5BA2127F90C9FCA3
+5A5AA57E7E15076DEB0F80003FEC1FC06DEB7FE03A1FF007FFC090B6FC6C15806CECFE00
+6C5CC614E0013F90C7FC232974A730>I<EDFFF84A13FCA480150316F8A21507A216F0A2
+150FA216E014FE903803FF9F010F13DF49EBFFC05B5BEBFFC7480103138048487E13FCEA
+07F848486C13005B121F5B003F5C5B1401127F01005BA214035A485C0207137016FC15F9
+EC0FF1141FA2EC3FF36C90387FE3F86C13FF018113E7D83F87EBF7F090B6FC6C15E014F3
+6C01C313C00003018013803A00FC007E00263975B730>I<EC1FE0ECFFF8010313FE010F
+7F4914805B90397FF07FC09038FFC01F481300485A485A5B485A4848133FED7F80393FC0
+01FFD9803F130090B55A485C5D15E092C7FCB512F048C9FCA57E7E15076DEB0F80003FEC
+1FC06DEB7FE03A1FF007FFC090B6FC6C15806CECFE006C5CC614E0013F90C7FC232974A7
+30>I<EC03C0EC07E0EC0FF0A315E0A2EC038091C7FCA9EB1FC0EB7FF048487E487F5A48
+7F13F0EA1FE013C0123F1380EA7F015CEAFF035C127EEA00075C130F5CA2131F5CA2013F
+1370EC80FCEB7F811401A2EBFF0301FE13F8140715F0140FEC3FE090B512C015806D1300
+6D5A6D5AEB07F01E3A73B830>105 D<91390FC007E0903A3C7FF01FF8903A7EFFF87FFC
+017F9038FCFFFE15FD90B8FC02F8EBFC3F9138E07FF802C013F048018013E016C0140049
+1480000302FF137F49EC007EA25D2607F80114FE17FC01F05B1601000F010314F801E013
+F81603001F010714F001C013F0160717E0003F130F018013E0160F17C0007F131F010013
+C017F017F848013F1307481480EE03F016000038010EC8FC30297CA730>109
+D<01F813FE3A03FE07FF80486C487F48013F7F4890B57EA2ED87F8393F9FFE0314FC387F
+BFF8EB3FF0A214E0D8FF7F130702C05B127E0000138001FF130F02005BA34848131F5EA2
+49EB3FC70003ED8FC0169F49137F161F0007153F03FF13804913FE167F000F16005E496D
+5A5E157F495CED3FE06C48EB0FC02A2979A730>I<EC3FC0903801FFF001077F497F497F
+017F7FD9FFE0138048EB807F9138003FC0D803FC131F485AA2485A4848EB0FE05B123F5B
+ED1FC0127F90C7FCA2153F4815805A157F16005D5D14016C495A6C13074A5A6D485A003F
+495A9038E0FFC06CB55A92C7FC6C5B6C13F8000113E038007F80232975A730>I<903903
+E003F890390FF80FFE90391FFC3FFF496C48138091B612C04915E06E131F01FE9038FC0F
+F091383FF807EC7FF0D801FC13E09238C003F81580000313FF15006C5AC75A0101140717
+F05CA20103140F17E05C161F010715C0A2EE3F80167F010F15005E6E485A1503496C485A
+ED1FF891B55A5E495C93C7FCEC8FFEEC83F0D97F80C8FCA291C9FCA25BA25BA21201A25B
+A21203387FFFF0B57EA46C5B2D3C7FA730>I<017EEB1FF03A01FF80FFFE4801C3EBFF80
+4801E714C04890B612E0A2D81FC79038F03FF0EDC00FD83F83EB800701871300007F4913
+0F13075C484848EB07E0EE03C0007E92C7FC00005B131F5CA3495AA35C137FA291C9FCA2
+5BA25BA21201A25BA35BA26C5A2C2978A730>114 D<EC1FF8ECFFFE0103EBFF804914C0
+4914E05B90393FF01FF090387F800F1400137E01FE14E05BED07C0ED03006D90C7FCEB7F
+C014FE90383FFFE015F8010F7F6D7F01007F02071380EC007FED1FC0150F121C123F5A15
+1F481580153FED7F004A5A397FE00FFE90B55A6C5C6C5C6C14C0000391C7FC38007FF824
+2977A730>I<133ED9FF801370486D13F8486D487E5A48EBF003D81FE75C13C7123F0187
+1307D87F8F5CEB0FE0A2D8FF1F130F02C05BEA7E3F00001380151F017F5C1400A2153F49
+5C5B168792387F8FC00001151F5B15FF163FDA01FE1380A21403D9FE07EB7F000000131F
+90B7FC6D5CEDBFFC6D133F90391FFE1FF0903903F007E02A2979A730>117
+D E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fc cmtt10 10 71
+/Fc 71 123 df<010F133C90381F807EA8013F13FE4A5AA4007FB612F0B712F8A4003F15
+F03A007E01F800A5EBFE0301FC5BA6003FB612F0B712F8A46C15F03A01F807E000A30003
+130F01F05BA86C486C5A25337DB22C>35 D<D807801307D81FE0EB0F80151F487E486C13
+3F1600007C5CD8FCFC137EEAF87C15FE5D14015DA21403D8FCFC5BEA7CF8007F13075D38
+3FF00FD81FE05BA23807801FC75B143F92C7FCA25C147E14FE5CA213015CA213035C1307
+5CA2130F5C131FEC800FED3FC0013FEB7FE0140049EBFFF0017E13F9A2D9FE0113F801FC
+13F0A2120113F8120313F015F90007010013F05B000F14FF49EB7FE0A20007EC3FC06C48
+EB0F0025417DB92C>37 D<EB0FC0EB3FE0497E497E80EA01F8EBF07C147E0003133E13E0
+A5147E147C9138FC3FF89039F0F87FFCEA01F1EBF3F001F7EB3FF89138E01F009038FFC0
+3F6CEB803EA2EC007E49137C485A486C13FC00075CEBFF01D80FDF5B381F9F81383F8F83
+90380FC3E0387E07E75D38FC03F7EB01FF5D6D1410ED007C80A26CEBFF80D87E0113C0D8
+7F03EBE0FC3A3F87F7F1F89038FFE3FF6C01C113F06C13806C9038007FC0D801FCEB1F80
+26357EB32C>I<143814FC13011303EB07F8EB0FF0EB1FC0EB3F80EB7F0013FE485A485A
+5B12075B120F5B485AA2123F90C7FCA25A127EA312FE5AAC7E127EA3127F7EA27F121FA2
+6C7E7F12077F12037F6C7E6C7E137FEB3F80EB1FC0EB0FF0EB07F8EB03FC130113001438
+164272B92C>40 D<127012FC7E7E6C7E6C7EEA0FE06C7E6C7E6C7E6C7E137F7F1480131F
+14C0130FEB07E0A214F01303A214F81301A314FC1300AC130114F8A3130314F0A2130714
+E0A2EB0FC0131F1480133F14005B13FE485A485A485A485AEA3FC0485A48C7FC5A5A1270
+164279B92C>I<EB0380497EA60020140800F8143E00FE14FE00FF13C1EBC7C7EBE7CF00
+3FB512F8000F14E0000314806C140038007FFCA248B5FC481480000F14E0003F14F839FF
+E7CFFEEBC7C7EB07C100FE13C000F8143E0020140800001400A66D5A1F247AAA2C>I<14
+7814FCAF007FB612F0B712F8A46C15F0C700FCC7FCAF147825267DAB2C>I<EA0F80EA1F
+E0EA3FF0EA7FF8A213FCA3123F121F120F120013F8A21201EA03F01207EA1FE0EA7FC0EA
+FF80130012FC12700E17718A2C>I<007FB6FCB71280A46C150021067B9B2C>I<121FEA3F
+80EA7FC0EAFFE0A5EA7FC0EA3F80EA1F000B0B708A2C>I<1507ED0F80151FA2153F1600
+5D157E15FE5D14015D14035DA214075D140F5D141F5D143F92C7FC5C147E14FE5CA21301
+5C13035C13075C130F5C131F5CA2133F91C8FC5B137E13FE5B12015B12035B12075BA212
+0F5B121F5B123F90C9FC5A127E12FE5AA25A127821417BB92C>I<EB03F8EB0FFE90383F
+FF80497F90B57E3901FE0FF03903F803F848486C7EEBE0004848137EA248487FA248C7EA
+1F80A2003E140F007E15C0A3007C140700FC15E0AC6C140F007E15C0A46CEC1F80A36C6C
+EB3F00A26C6C137E6D13FE00075CEBF0016C6C485A3901FE0FF06CB55A6D5B6D5BD90FFE
+C7FCEB03F823357CB32C>I<1307497EA2131FA2133F137F13FF5A1207127FB5FC13DF13
+9FEA7C1F1200B3AE007FB512E0B612F0A36C14E01C3477B32C>I<EB0FF890387FFF8048
+B512E00007804814FC391FF80FFE393FE001FF903880007F48C7EA3F80007E141F00FE15
+C0150F6C15E01507A3127E123CC8FCA2150F16C0151F1680153F16005D15FE4A5A14034A
+5A4A5A4A5A4A5AECFF804948C7FC495A495A495AEB3FE0EB7F8049C8FC485A4848EB03C0
+4848EB07E0EA1FE0485A48B6FCB7FCA36C15C023347CB32C>I<EB0FFC90387FFF8048B5
+12E0000714F84880391FF807FEEBC0004848137F6D7F1680151FA26C5A6CC7FCC8FC153F
+16005D15FE14014A5AEC1FF890381FFFF0495BA215F86D7F90380007FEEC00FF81ED3F80
+ED1FC0150FA216E01507A2123C127EB4FC150F16C0A248141F007FEC3F806DEB7F006C6C
+5B391FF807FE6CB55A6C5C6C14E0C66C1380D90FFCC7FC23357CB32C>I<EC07F04A7E14
+1F143FA2147EA214FCEB01F8A2EB03F0EB07E0A2EB0FC0EB1F80A2EB3F00137EA25B485A
+A2485A5B1207485AA2485A48C7FCA2127E5AB712FC16FEA36C15FCC8EAF800AA91387FFF
+F091B512F8A36E13F027347EB32C>I<000FB512FE4880A35D0180C8FCADEB83FE90389F
+FF8090B512E015F8819038FE03FE9038F000FF01C07F49EB3F8090C7121F6C15C0C8120F
+A2ED07E0A4123C127EB4FC150F16C0A248141F007EEC3F80007FEC7F006C6C5B6D485A39
+1FF80FFC6CB55A6C5C000114C06C6C90C7FCEB0FF823347CB22C>I<EC3FC0903801FFF8
+01077F011F7F497F90387FE07F9039FF003F804848137FEA03F8485A5B000FEC3F004848
+131E4990C7FC123F90C9FCA25A127EEB03FE90381FFF80D8FC7F13E000FDB57EB67E9038
+FE07FC9038F001FE9038C0007F49EB3F8090C7121F16C048140F16E01507A3127EA47E15
+0F6D14C0001F141F6D1480000F143F6DEB7F003907F801FE3903FE07FC6CB55A6C5C6D5B
+011F1380D907FCC7FC23357CB32C>I<1278B712C016E0A316C000FCC7EA3F80ED7F0015
+FE00785CC712014A5A4A5A5D140F5D4A5A143F92C7FC5C147E14FE5C13015CA2495AA213
+075CA3495AA4495AA5133F91C8FCAA131E23357CB32C>I<EB07FC90383FFF8090B512E0
+000314F84880390FFC07FE391FF001FF9038C0007F4848EB3F8090C7121F4815C0007E14
+0FA56CEC1F80A26C6CEB3F006D5B390FF001FE3903FC07F86CB55A6C6C13C0D907FCC7FC
+90387FFFC048B512F03903FC07F8390FF001FE391FC0007F497F48C7EA1F80007EEC0FC0
+A248EC07E0A7007EEC0FC0A2007F141F6C6CEB3F806C6CEB7F009038F001FF390FFC07FE
+6CB55A6C5CC614E0013F1380D907FCC7FC23357CB32C>I<EB07FCEB3FFF90B512C04880
+48803907FC07F8390FF001FC48486C7ED83F80137E157F48C77E007EEC1F8012FE5AED0F
+C0A416E0A37E127E007F141F7E6D133F6C6C137F390FF001FF3807FC0F6CB6FC6C14F76C
+14C7013F130FD90FF813C090C7FCA2151F1680153F1600000F5C486C137E486C13FE4A5A
+4A5A14079038801FF0391FE07FE090B55A6C91C7FC6C5B000113F838007FC023357CB32C
+>I<121FEA3F80EA7FC0EAFFE0A5EA7FC0EA3F80EA1F00C7FCAE121FEA3F80EA7FC0EAFF
+E0A5EA7FC0EA3F80EA1F000B2470A32C>I<1507ED1F80153F15FF14034A1300EC1FFC4A
+5AECFFE0491380010790C7FCEB0FFCEB3FF8EB7FE048485A4890C8FCEA0FFEEA1FF8EA7F
+F0EAFFC05BA27FEA7FF0EA1FF8EA0FFEEA03FF6C13C06C6C7EEB3FF8EB0FFC6DB4FC0101
+7F6D13E0EC3FF86E7EEC07FF6E13801400153F151FED0700212A7BAD2C>60
+D<007FB612F0B712F8A4003F15F0CAFCA8003FB612F0B712F8A46C15F025147DA22C>I<
+127012FC7E6C7E13E06C7EEA1FFC6C7E3803FF80C67FEB7FF0EB1FF8EB0FFEEB03FF6D13
+C06D6C7EEC3FF8EC0FFC6EB4FC0201138080A25C02071300EC0FFCEC3FF8EC7FE049485A
+4990C7FCEB0FFEEB1FF8EB7FF0EBFFC000035BD80FFEC8FC485AEA7FF0485A138048C9FC
+5A1270212A7BAD2C>I<14FE497EA4497FA214EFA2130781A214C7A2010F7FA314C39038
+1F83F0A590383F01F8A490387E00FCA549137E90B512FEA34880A29038F8003FA34848EB
+1F80A4000715C049130FD87FFEEBFFFC6D5AB514FE6C15FC497E27347EB32C>65
+D<007FB512E015F8B612FE6C8016C03903F0003FED0FE0ED07F01503A2ED01F8A6ED03F0
+A21507ED0FE0ED1FC0EDFF8090B612005D5D15FF16C09039F0001FE0ED07F0ED03F81501
+ED00FCA216FE167EA616FE16FC1501ED03F8150FED3FF0007FB612E016C0B712806CECFE
+0015F027337FB22C>I<02FF13700107EBE0F84913F9013F13FD4913FFEBFF813901FE00
+7F4848131FD807F0130F1507485A491303485A150148C7FCA25A007EEC00F01600A212FE
+5AAB7E127EA3007F15F06CEC01F8A26C7EA26C6C13036D14F06C6C130716E0D803FC131F
+6C6CEB3FC03A00FF81FF806DB512006D5B010F5B6D13F00100138025357DB32C>I<007F
+B5FCB612C015F0816C803907E003FEEC00FFED7F80153FED1FC0ED0FE0A2150716F01503
+16F81501A4ED00FCACED01F8A3150316F0A2150716E0150FED1FC0153FED7F80EDFF00EC
+03FE007FB55AB65A5D15C06C91C7FC26337EB22C>I<007FB612F0B712F8A37E3903F000
+01A7ED00F01600A4EC01E04A7EA490B5FCA5EBF003A46E5A91C8FCA5163C167EA8007FB6
+12FEB7FCA36C15FC27337EB22C>I<007FB612F8B712FCA37ED803F0C7FCA716781600A5
+15F04A7EA490B5FCA5EBF001A46E5A92C7FCAD387FFFE0B5FC805C7E26337EB22C>I<90
+3901FC038090390FFF87C04913EF017F13FF90B6FC4813073803FC01497E4848137F4848
+133F49131F121F5B003F140F90C7FCA2127EED078092C7FCA212FE5AA8913803FFF84A13
+FCA27E007E6D13F89138000FC0A36C141FA27F121F6D133F120F6D137F6C7E6C6C13FF6D
+5A3801FF076C90B5FC6D13EF011F13CF6DEB0780D901FCC7FC26357DB32C>I<D87FFEEB
+FFFCB54813FEA36C486C13FCD807E0EB0FC0B190B6FCA59038E0000FB3D87FFEEBFFFCB5
+4813FEA36C486C13FC27337EB22C>I<007FB512F8B612FCA36C14F839000FC000B3B3A5
+007FB512F8B612FCA36C14F81E3379B22C>I<D87FFCEB7FF8486CEBFFFCA36C48EB7FF8
+D807C0EB1F80153FED7F00157E5D4A5A14034A5A5D4A5A4A5A143F4AC7FC147E5CEBC1F8
+13C3EBC7FCA2EBCFFEEBDFBEEBFFBF141F01FE7F496C7E13F86E7EEBF00301E07FEBC001
+816E7EA2157E153E153F811680ED0FC0A2ED07E0D87FFCEB1FFC486CEB3FFEA36C48EB1F
+FC27337EB22C>75 D<387FFFE0B57EA36C5BD803F0C8FCB3AE16F0ED01F8A8007FB6FCB7
+FCA36C15F025337DB22C>I<D87FE0EB0FFC486CEB1FFEA26D133F007F15FC000F15E001
+BC137BA4019E13F3A3EB9F01A2018F13E3A21483A2018713C314C7A201831383A214EFA2
+01811303A214FFEB80FEA3147C14381400ACD87FF0EB1FFC486CEB3FFEA36C48EB1FFC27
+337EB22C>I<D87FF0EB7FFC486CEBFFFEA27F007FEC7FFCD807FEEB07C013DEA213DF13
+CFA2148013C714C0A213C314E0A213C114F0A213C014F8A2147CA3143EA2141E141FA214
+0F1587A2140715C7A2140315E71401A215F71400A215FFD87FFC137F487E153FA26C48EB
+1F8027337EB22C>I<EB7FFF0003B512E0000F14F848804880EBE003EB800048C7127FA2
+007E80A300FE158048141FB3A86C143FA2007E1500A3007F5CA26C6C13FEEBF00790B5FC
+6C5C6C5C000314E0C66C90C7FC21357BB32C>I<007FB512C0B612F88115FF6C15802603
+F00013C0153FED0FE0ED07F0A2150316F81501A6150316F01507A2ED0FE0ED3FC015FF90
+B61280160015FC5D15C001F0C8FCB0387FFF80B57EA36C5B25337EB22C>I<387FFFFCB6
+7E15E015F86C803907E007FE1401EC007F6F7E151FA26F7EA64B5AA2153F4BC7FCEC01FE
+140790B55A5D15E081819038E007FCEC01FE1400157F81A8160FEE1F80A5D87FFEEB1FBF
+B5ECFF00815E6C486D5AC8EA01F029347EB22C>82 D<90381FF80790B5EA0F804814CF00
+0714FF5A381FF01F383FC003497E48C7FC007E147F00FE143F5A151FA46CEC0F00007E91
+C7FC127F7FEA3FE0EA1FFCEBFFC06C13FC0003EBFFC06C14F06C6C7F01077F9038007FFE
+EC07FF02001380153FED1FC0A2ED0FE0A20078140712FCA56CEC0FC0A26CEC1F806D133F
+01E0EB7F009038FE01FF90B55A5D00F914F0D8F83F13C0D8700790C7FC23357CB32C>I<
+007FB612FCB712FEA43AFC007E007EA70078153CC71400B3AF90383FFFFCA2497F6D5BA2
+27337EB22C>I<3B7FFF803FFFC0B56C4813E0A36C496C13C03B03F00001F800B3AF6D13
+0300015DA26D130700005D6D130F017F495A6D6C485AECE0FF6DB5C7FC6D5B010313F86D
+5B9038003F802B3480B22C>I<D87FFCEB7FFC486CEBFFFEA36C48EB7FFCD80FC0EB07E0
+6D130F000715C0A36D131F00031580A36D133F00011500A36D5B0000147EA4017E5BA46D
+485AA490381F83F0A4010F5B14C7A301075BA214EFA201035BA214FFA26D90C7FCA46D5A
+27347EB22C>I<D87FF0EB07FF486C491380A36C486D1300001FC8127CA46C6C5CA76C6C
+495AA4143E147FA33A03E0FF83E0A214F7A201E113C3A3000101E35BA201F113C701F313
+E7A314C1A200005DA201F713F71480A301FF13FF017F91C7FC4A7EA4013E133E29347FB2
+2C>I<D87FFCEB7FFC486CEBFFFEA36C48EB7FFCD807F0EB0FC0151F000315806D133F12
+016DEB7F0012006D137E017E13FE017F5BEB3F01EC81F8131FEC83F0EB0FC314C7903807
+E7E0A201035B14EF6DB45AA292C7FC7F5C147EB0903807FFE0497FA36D5B27337EB22C>
+89 D<3801FFF0000713FE001F6D7E15E048809038C01FF81407EC01FC381F80000006C7
+7EC8127EA3ECFFFE131F90B5FC1203120F48EB807E383FF800EA7FC090C7FC12FE5AA47E
+007F14FEEB8003383FE01F6CB612FC6C15FE6C14BF0001EBFE1F3A003FF007FC27247CA3
+2C>97 D<EA7FF0487EA3127F1201AAEC1FE0ECFFF801FB13FE90B6FC16809138F07FC091
+38801FE091380007F049EB03F85BED01FC491300A216FE167EA816FE6D14FCA2ED01F86D
+13036DEB07F0150F9138801FE09138E07FC091B51280160001FB5B01F813F83900F03FC0
+27337FB22C>I<903803FFE0011F13F8017F13FE48B5FC48804848C6FCEA0FF0485A4913
+7E4848131890C9FC5A127EA25AA8127EA2127F6C140F6DEB1F806C7E6D133F6C6CEB7F00
+3907FE03FF6CB55A6C5C6C6C5B011F13E0010390C7FC21247AA32C>I<EC0FFE4A7EA380
+EC003FAAEB07F8EB3FFE90B512BF4814FF5A3807FC0F380FF00348487E497E48487F90C7
+FC007E80A212FE5AA87E007E5CA2007F5C6C7E5C6C6C5A380FF0073807FC1F6CB612FC6C
+ECBFFE6C143FEB3FFC90390FF01FFC27337DB22C>I<EB03FE90381FFFC0017F13F048B5
+7E48803907FE03FE390FF800FFD81FE0EB3F805B4848EB1FC090C7120F5A007E15E01507
+5AB7FCA416C000FCC9FC7E127EA2127F6CEC03C06DEB07E06C7ED80FF0130F6C6CEB3FC0
+01FF13FF000190B512806C1500013F13FC010F13F00101138023247CA32C>I<EC0FF8EC
+3FFE91B5FC4914805B903807FC7F14F090390FE03F0014C092C7FCA6007FB512FEB7FCA3
+6C5C26000FC0C7FCB3A8003FB512F04880A36C5C21337DB22C>I<ED03F8903907F80FFC
+90391FFE3FFE017FB6FC48B7FC48ECFE7F9038FC0FF82607F003133E3A0FE001FC1CD9C0
+001300001F8049137EA66D13FE000F5CEBE0016C6C485A3903FC0FF048B5FC5D481480D9
+9FFEC7FCEB87F80180C8FCA37F6C7E90B512F06C14FE48ECFF804815E04815F03A3FC000
+1FF848C7EA03FC007E1400007C157C00FC157E48153EA46C157E007E15FCD87F801303D8
+3FE0EB0FF8D81FFCEB7FF06CB612E0000315806C1500D8003F13F8010713C028387EA42C
+>I<EA7FF0487EA3127F1201AAEC1FE0EC7FFC9038F9FFFE01FB7F90B6FC9138F03F80EC
+C01F02807FEC000F5B5BA25BB3267FFFE0B5FCB500F11480A36C01E0140029337FB22C>
+I<1307EB1FC0A2497EA36D5AA20107C7FC90C8FCA7387FFFC080B5FC7EA2EA0007B3A800
+7FB512FCB612FEA36C14FC1F3479B32C>I<387FFFE0B57EA37EEA0003B3B3A5007FB612
+80B712C0A36C158022337BB22C>108 D<3A7F83F007E09039CFFC1FF83AFFDFFE3FFCD8
+7FFF13FF91B57E3A07FE1FFC3E01FCEBF83F496C487E01F013E001E013C0A301C01380B3
+3B7FFC3FF87FF0027F13FFD8FFFE6D13F8D87FFC4913F0023F137F2D2481A32C>I<397F
+F01FE039FFF87FFC9038F9FFFE01FB7F6CB6FC00019038F03F80ECC01F02807FEC000F5B
+5BA25BB3267FFFE0B5FCB500F11480A36C01E0140029247FA32C>I<EB07FCEB1FFF017F
+13C048B512F048803907FC07FC390FF001FE48486C7E0180133F003F158090C7121F007E
+EC0FC0A348EC07E0A76C140F007E15C0A2007F141F6C15806D133F6C6CEB7F006D5B6C6C
+485A3907FC07FC6CB55A6C5C6C6C13C0011F90C7FCEB07FC23247CA32C>I<397FF01FE0
+39FFF8FFF801FB13FE90B6FC6C158000019038F07FC09138801FE091380007F049EB03F8
+5BED01FC491300A216FE167EA816FE6D14FCA2ED01F86D13036DEB07F0150F9138801FE0
+9138E07FC091B51280160001FB5B01F813F8EC3FC091C8FCAD387FFFE0B57EA36C5B2736
+7FA32C>I<903903FC078090391FFF0FC0017F13CF48B512EF4814FF3807FE07380FF001
+48487E49137F4848133F90C7FC48141F127E150F5AA87E007E141FA26C143F7F6C6C137F
+6D13FF380FF0033807FC0F6CB6FC6C14EF6C6C138F6D130FEB07F890C7FCAD0203B5FC4A
+1480A36E140029367DA32C>I<D87FFEEB3FC0B53801FFF0020713F8021F13FC6C5B3900
+3F7FE1ECFF019138FC00F84A13704A13005CA25C5CA391C8FCAF007FB512E0B67EA36C5C
+26247EA32C>I<90387FF8700003B512F8120F5A5A387FC00F387E00034813015AA36CEB
+00F0007F140013F0383FFFC06C13FE6CEBFF80000314E0C66C13F8010113FCEB0007EC00
+FE0078147F00FC143F151F7EA26C143F6D133E6D13FE9038F007FC90B5FC15F815E000F8
+148039701FFC0020247AA32C>I<131E133FA9007FB6FCB71280A36C1500D8003FC8FCB1
+ED03C0ED07E0A5EC800F011FEB1FC0ECE07F6DB51280160001035B6D13F89038003FE023
+2E7EAD2C>I<3A7FF003FF80486C487FA3007F7F0001EB000FB3A3151FA2153F6D137F39
+00FE03FF90B7FC6D15807F6D13CF902603FE07130029247FA32C>I<3A7FFF01FFFCB514
+FE148314016C15FC3A03E0000F80A26D131F00011500A26D5B0000143EA26D137E017C13
+7CA2017E13FC013E5BA2EB3F01011F5BA21483010F5BA214C701075BA214EF01035BA214
+FF6D90C7FCA26D5A147C27247EA32C>I<D87FFFEB7FFF6EB5FCB515806C16004A7ED807
+C0EB01F0A66C6C495AA3143E147FA2D801F0495AECFF87A214F7A201F113C700005D9038
+F9E3CFA201FB13EFA3D97BC190C7FC017F13FFA21480A2013F5B90381F007C29247FA32C
+>I<3A3FFF03FFF048018713F8A36C010313F03A00FC007E005D90387E01F8013F5BEB1F
+83EC87E090380FCFC0903807EF80EB03FF6D90C7FC5C6D5A147C14FE130180903803EF80
+903807CFC0EB0FC7EC83E090381F01F0013F7FEB7E00017C137C49137E0001803A7FFF01
+FFFC1483B514FE6C15FC140127247EA32C>I<3A7FFF01FFFCB5008113FE148314816C01
+0113FC3A03E0000F806C7E151F6D140012005D6D133E137C017E137E013E137CA2013F13
+FC6D5BA2EB0F815DA2EB07C1ECC3E0A2EB03E3ECE7C0130114F75DEB00FFA292C7FC80A2
+143EA2147E147CA214FC5CA2EA0C01003F5BEA7F83EB87E0EA7E0F495A387FFF806C90C8
+FC6C5A6C5AEA07E027367EA32C>I<003FB612E04815F0A4007EC7EA1FE0ED3FC0ED7F80
+EDFF004A5A003C495AC7485A4A5A4A5A4A5A4A5A4AC7FCEB01FC495AEB0FF0495A495A49
+5A49C8FC4848EB01E04848EB03F0485A485A485A485A485AB7FCA46C15E024247DA32C>
+I E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fd cmtt10 10.95 61
+/Fd 61 123 df<903907C007C0A2496C487EA8011F131FA202C05BA3007FB7FCA2B81280
+A36C16006C5D3A007F807F80A2020090C7FCA9495BA2003F90B512FE4881B81280A36C16
+00A22701FC01FCC7FCA300031303A201F85BA76C486C5AA229387DB730>35
+D<EA07C0EA0FF0EA1FF8A213FCA213FE120F1207EA007EA513FE13FCA2120113F81203EA
+07F0120FEA1FE0127FEAFFC013801300127C12380F1D70B730>39
+D<141E147F14FF5BEB03FEEB07FCEB0FF0EB1FE0EB3FC0EB7F80EBFF00485A5B12035B48
+5A120F5BA2485AA2123F5BA2127F90C7FCA412FEAD127FA47F123FA27F121FA26C7EA27F
+12076C7E7F12017F6C7EEB7F80EB3FC0EB1FE0EB0FF0EB07FCEB03FEEB01FF7F147F141E
+184771BE30>I<127812FE7E7F6C7E6C7EEA0FF06C7E6C7E6C7E6C7EEB7F80133F14C013
+1FEB0FE014F01307A2EB03F8A214FC1301A214FE1300A4147FAD14FEA4130114FCA21303
+14F8A2EB07F0A2130F14E0EB1FC0133F1480137FEBFF00485A485A485A485AEA3FE0485A
+485A90C7FC5A1278184778BE30>I<14E0497E497EA60038EC0380007EEC0FC0D8FF83EB
+3FE001C3137F9038F3F9FF267FFBFB13C06CB61280000FECFE00000314F86C5C6C6C13C0
+011F90C7FC017F13C048B512F04880000F14FE003FECFF80267FFBFB13C026FFF3F913E0
+9038C3F87F0183133FD87E03EB0FC00038EC0380000091C7FCA66D5A6D5A23277AAE30>
+I<143EA2147FAF007FB7FCA2B81280A36C1600A2C76CC8FCAF143EA229297DAF30>I<00
+7FB612F0A2B712F8A36C15F0A225077B9E30>45 D<120FEA3FC0EA7FE0A2EAFFF0A4EA7F
+E0A2EA3FC0EA0F000C0C6E8B30>I<14FE903807FFC0497F013F13F8497F90B57E48EB83
+FF4848C6138049137F4848EB3FC04848EB1FE049130F001F15F0491307A24848EB03F8A2
+90C712014815FCA400FEEC00FEAD6C14016C15FCA36D1303003F15F8A26D1307001F15F0
+A26D130F6C6CEB1FE0A26C6CEB3FC06C6CEB7F806D13FF2601FF8313006CEBFFFE6D5B6D
+5B010F13E06D5BD900FEC7FC273A7CB830>48 D<EB03C0497EA2130FA2131FA2133F137F
+13FF1203123FB5FCA213EF138FEA7E0F1200B3B0003FB512F84814FCB612FEA26C14FC6C
+14F81F3977B830>I<EB07FC90383FFFC090B512F00003804814FE4880261FF80F138026
+3FE00113C09038C0007F4848EB3FE090C7121FED0FF04814075A6C15F81503A3127E1218
+C8FCA2150716F0150F16E0151F16C0153FED7F8015FF4A13005DEC07FC4A5A4A5A4A5A4A
+5A4A5A4990C7FC495A495AEB0FF0EB3FE0495A495A4890C8FC4848EB01F04848EB03F848
+5AEA1FE048B6FCB7FCA37E6C15F025397BB830>I<EB03FF013F13E090B512F84814FE48
+80481580260FFE0113C09038F0007F4848EB1FE0150F16F01507A26C5A6C5AC8FC150F16
+E0A2151FED3FC0157FEDFF8002071300903807FFFE495B5D8115FF6D1480D9000113C091
+38003FE0ED1FF0ED07F8150316FC150116FE1500A21218127EB4FCA2150116FC4814036C
+15F86C6C13076DEB1FF0D83FF0133F3A1FFE01FFE06CB612C06C15806CECFE00C65C013F
+13F001031380273A7CB830>I<EC0FF8EC7FFF49B51280010714E0131F4914F090387FF8
+0F9039FFC007F84813803803FE005B485A4848EB03F0ED01E0484890C7FC5B123F5BA212
+7FEB000C903803FFE0010F13F8D8FF3F13FE48B6FCB7128016C09039FE007FE001F8EB1F
+F001E0130F49EB07F849EB03FCA290C7120116FE1500A37EA46C7E15016D14FC121F6D13
+03000FEC07F86D130F6C6CEB1FF06DEB3FE03A03FF81FFC06C90B512806C15006D5B011F
+13F8010713E001011380273A7CB830>54 D<127CB712FC16FEA416FC48C7EA0FF816F0ED
+1FE0007CEC3FC0C8EA7F80EDFF00A24A5A4A5A5D14075D140F5D4A5AA24A5AA24AC7FCA2
+5C5C13015CA213035CA213075CA4495AA6131F5CA96D5A6DC8FC273A7CB830>I<49B4FC
+011F13F0017F13FC90B57E0003ECFF804815C048010113E03A1FF8003FF049131FD83FC0
+EB07F8A24848EB03FC90C71201A56D1303003F15F86D13076C6CEB0FF06C6CEB1FE0D807
+FCEB7FC03A03FF83FF806C90B512006C6C13FC011F13F0497F90B512FE48802607FE0013
+C0D80FF8EB3FE0D81FE0EB0FF04848EB07F8491303007F15FC90C712014815FE481400A6
+6C14016C15FC6D1303003F15F86D1307D81FF0EB1FF06D133F3A0FFF01FFE06C90B512C0
+6C1580C6ECFE006D5B011F13F0010190C7FC273A7CB830>I<120FEA3FC0EA7FE0A2EAFF
+F0A4EA7FE0A2EA3FC0EA0F00C7FCAF120FEA3FC0EA7FE0A2EAFFF0A4EA7FE0A2EA3FC0EA
+0F000C276EA630>58 D<16F01503ED07F8151F157FEDFFF014034A13C0021F138091383F
+FE00ECFFF8495B010713C0495BD93FFEC7FC495A3801FFF0485B000F13804890C8FCEA7F
+FC5BEAFFE05B7FEA7FF87FEA1FFF6C7F000313E06C7F38007FFC6D7E90380FFF806D7F01
+0113F06D7FEC3FFE91381FFF80020713C06E13F01400ED7FF8151F1507ED03F01500252F
+7BB230>60 D<007FB7FCA2B81280A36C16006C5DCBFCA7003FB612FE4881B81280A36C16
+00A229157DA530>I<1278127EB4FC13C07FEA7FF813FEEA1FFF6C13C000037F6C13F86C
+6C7EEB1FFF6D7F010313E06D7F9038007FFC6E7E91380FFF806E13C0020113F080ED3FF8
+151F153FEDFFF05C020713C04A138091383FFE004A5A903801FFF0495B010F13804990C7
+FCEB7FFC48485A4813E0000F5B4890C8FCEA7FFE13F8EAFFE05B90C9FC127E1278252F7B
+B230>I<147F4A7EA2497FA4497F14F7A401077F14E3A3010F7FA314C1A2011F7FA49038
+3F80FEA590387F007FA4498049133F90B6FCA34881A39038FC001F00038149130FA40007
+81491307A2D87FFFEB7FFFB56CB51280A46C496C130029397DB830>65
+D<007FB512F0B612FE6F7E82826C813A03F8001FF815076F7E1501A26F7EA615015EA24B
+5A1507ED1FF0ED7FE090B65A5E4BC7FC6F7E16E0829039F8000FF8ED03FC6F7E1500167F
+A3EE3F80A6167F1700A25E4B5A1503ED1FFC007FB6FCB75A5E16C05E6C02FCC7FC29387E
+B730>I<91387F803C903903FFF03E49EBFC7E011F13FE49EBFFFE5B9038FFE07F48EB80
+1F3903FE000F484813075B48481303A2484813015B123F491300A2127F90C8FC167C1600
+5A5AAC7E7EA2167C6D14FE123FA27F121F6D13016C6C14FCA26C6CEB03F86D13076C6CEB
+0FF03901FF801F6C9038E07FE06DB512C06D14806D1400010713FC6D13F09038007FC027
+3A7CB830>I<003FB512E04814FCB67E6F7E6C816C813A03F8007FF0ED1FF8150F6F7E6F
+7E15016F7EA2EE7F80A2163F17C0161FA4EE0FE0AC161F17C0A3163F1780A2167F17005E
+4B5A15034B5A150F4B5AED7FF0003FB65A485DB75A93C7FC6C14FC6C14E02B387FB730>
+I<007FB7FCB81280A47ED803F8C7123FA8EE1F0093C7FCA4157C15FEA490B5FCA6EBF800
+A4157C92C8FCA5EE07C0EE0FE0A9007FB7FCB8FCA46C16C02B387EB730>I<003FB71280
+4816C0B8FCA27E7ED801FCC7121FA8EE0F8093C7FCA5153E157FA490B6FCA69038FC007F
+A4153E92C8FCAE383FFFF8487FB5FCA27E6C5B2A387EB730>I<02FF13F00103EBC0F801
+0F13F1013F13FD4913FF90B6FC4813C1EC007F4848133F4848131F49130F485A49130712
+1F5B123F491303A2127F90C7FC6F5A92C8FC5A5AA892B5FC4A14805CA26C7F6C6D1400ED
+03F8A27F003F1407A27F121F6D130F120F7F6C6C131FA2D803FE133F6C6C137FECC1FF6C
+90B5FC7F6D13FB010F13F30103EBC1F0010090C8FC293A7DB830>I<007FB6FCB71280A4
+6C1500260007F0C7FCB3B3A8007FB6FCB71280A46C1500213879B730>73
+D<D83FFC90381FFF80486C4913C0B54913E0A26C6D6C13C06C6E13800003913801F800EB
+F7C0A3EBF3E0A314F013F1A214F8A213F014FCA2147C147EA2143E143FA2141FA21581A2
+140F15C1A2140715E1A2140315F1A21401A215F91400A3157DA3153FEA3FFF481380B5EA
+C01FA26CEB800F6C496C5A2B387EB730>78 D<90383FFFE048B512FC000714FF48158048
+15C04815E0EBF80001E0133FD87F80EB0FF0A290C71207A44815F8481403B3A96C1407A2
+6C15F0A36D130FA26D131F6C6CEB3FE001F813FF90B6FC6C15C06C15806C1500000114FC
+D8003F13E0253A7BB830>I<007FB512F0B612FE6F7E16E0826C813903F8003FED0FFCED
+03FE15016F7EA2821780163FA6167F17005EA24B5A1503ED0FFCED3FF890B6FC5E5E1680
+4BC7FC15F001F8C9FCB0387FFFC0B57EA46C5B29387EB730>I<90383FFFE048B512FC00
+0714FF4815804815C04815E0EBF80001E0133F4848EB1FF049130F90C71207A44815F848
+1403B3A8147E14FE6CEBFF076C15F0EC7F87A2EC3FC7018013CF9038C01FFFD83FE014E0
+EBF80F90B6FC6C15C06C15806C1500000114FCD8003F7FEB00016E7EA21680157F16C015
+3F16E0151F16F0150FED07E025467BB830>I<003FB57E4814F0B612FC15FF6C816C8126
+03F8017F9138003FF0151F6F7E15071503821501A515035E1507150F4B5A153F4AB45A90
+B65A5E93C7FC5D8182D9F8007FED3FE0151F150F821507A817F8EEF1FCA53A3FFF8003FB
+4801C0EBFFF8B56C7E17F06C496C13E06C49EB7FC0C9EA1F002E397FB730>I<90390FF8
+03C0D97FFF13E048B512C74814F74814FF5A381FF80F383FE001497E4848137F90C7123F
+5A48141FA2150FA37EED07C06C91C7FC7F7FEA3FF0EA1FFEEBFFF06C13FF6C14E0000114
+F86C80011F13FF01031480D9003F13C014019138007FE0151FED0FF0A2ED07F8A2007C14
+0312FEA56C140716F07F6DEB0FE06D131F01F8EB3FC001FF13FF91B51280160000FD5CD8
+FC7F13F8D8F81F5BD878011380253A7BB830>I<003FB712C04816E0B8FCA43AFE003F80
+0FA8007CED07C0C791C7FCB3B1011FB5FC4980A46D91C7FC2B387EB730>I<3B7FFFC007
+FFFCB56C4813FEA46C496C13FCD803F8C7EA3F80B3B16D147F00011600A36C6C14FE6D13
+016D5CEC800390393FE00FF890391FF83FF06DB55A6D5C6D5C6D91C7FC9038007FFCEC1F
+F02F3980B730>I<007FB5FCB61280A4150048C8FCB3B3B3A5B6FC1580A46C140019476D
+BE30>91 D<007FB5FCB61280A47EC7123FB3B3B3A5007FB5FCB6FCA46C140019477DBE30
+>93 D<EB7FF80003B5FC4814C04880488048809038E01FFC9038C003FE14016E7E6C487F
+6CC77FC8123FA491B5FC130F137F48B6FC12075A48EB803F383FF800EA7FE0138048C7FC
+5AA4157F7E6C6C13FFEBC003263FF01FEBFF8090B712C07E6C14EF000314876CD9FE0113
+8026003FE0C8FC2A2A7BA830>97 D<EA3FFC487E12FFA2127F123F1200AAEC03FE91381F
+FF80027F13E091B57E90B612FC82ECFE079138F001FF4A6C13804A137F4AEB3FC091C712
+1F17E049140FA217F01607A8160FA217E07F161F6EEB3FC0A26EEB7F806E13FFDAF00313
+009138FC0FFE91B55A5E495CD97E7F13C0D93C1F90C7FC90380003FC2C3980B730>I<EC
+FFE0010713FC011F7F017F7F90B612804815C048EB807F3907FC003F485A485A49EB1F80
+4848EB0F004990C7FC127F90C9FCA25A5AA87E7EA27F003FEC07C06DEB0FE06C7E6D131F
+6C6C14C0D807FE133F9039FFC0FF806C90B5FCC615006D5B011F13F801075B0101138023
+2A7AA830>I<913801FFE04A7F5CA28080EC0007AAEB03FE90381FFF874913E790B6FC5A
+5A481303380FFC00D81FF0133F49131F485A150F4848130790C7FCA25AA25AA87E6C140F
+A27F003F141F6D133F6C7E6D137F390FF801FF2607FE07EBFFC06CB712E06C16F06C14F7
+6D01C713E0011F010313C0D907FCC8FC2C397DB730>I<49B4FC010713E0011F13F8017F
+7F90B57E488048018113803A07FC007FC04848133FD81FE0EB1FE0150F484814F0491307
+127F90C7FCED03F85A5AB7FCA516F048C9FC7E7EA27F003FEC01F06DEB03F86C7E6C7E6D
+1307D807FEEB1FF03A03FFC07FE06C90B5FC6C15C0013F14806DEBFE00010713F8010013
+C0252A7CA830>I<EDFF80020713E0021F13F05C4A13F891B5FC491387903803FE079138
+FC03F0903907F800C04A1300A8003FB612C04815E0B7FCA36C15C0260007F0C7FCB3A900
+3FB512FE4880B71280A26C15006C5C25397DB830>I<D903FC13FF90261FFF8713C04913
+DF90B712E05A5A2607FE07138F903AF801FE07C048486C6CC7FCA2497F001F8149133FA5
+6D137F000F92C7FC6D5BA26C6C485AEBFE0790B55A5D485C15C001DF5BD9C3FCC8FC01C0
+C9FCA37F7F6CB512F015FF6C15C04815F0488148813A3FE0001FFE0180130148C8127F00
+7E8100FE168048151FA56C153F007FED7F006D5C6C6C495A01F013076CB4EB7FFC6C90B5
+5A6C5D000115C06C6C91C7FC011F13FC010113C02B3E7DA730>I<EA3FFC487E12FFA212
+7F123F1200AAEC01FE91380FFF80023F13E091B57E90B67EA29138FE07FCECF8039138E0
+01FE14C0EC8000A291C7FCA25BB3A23B3FFFF81FFFF8486D4813FCB500FE14FEA26C01FC
+14FC6C496C13F82F3880B730>I<14E0EB03F8A2497EA36D5AA2EB00E091C8FCA9381FFF
+F8487F5AA27E7EEA0001B3A9003FB612C04815E0B7FCA27E6C15C023397AB830>I<387F
+FFF8B57EA47EEA0001B3B3A8007FB612F0B712F8A46C15F025387BB730>108
+D<02FC137E3B7FC3FF01FF80D8FFEF01877F90B500CF7F15DF92B57E6C010F13872607FE
+07EB03F801FC13FE9039F803FC01A201F013F8A301E013F0B3A23C7FFE0FFF07FF80B548
+018F13C0A46C486C01071380322881A730>I<EC01FE3A3FFC0FFF80267FFE3F13E000FF
+90B57E90B67E7E6C9038FE07FCC6EBF8039138E001FE14C0EC8000A291C7FCA25BB3A23B
+3FFFF81FFFF8486D4813FCB500FE14FEA26C01FC14FC6C496C13F82F2880A730>I<49B4
+FC010F13E0013F13F8497F90B57E0003ECFF8014013A07FC007FC04848EB3FE0D81FE0EB
+0FF0A24848EB07F8491303007F15FC90C71201A300FEEC00FEA86C14016C15FCA26D1303
+003F15F86D13076D130F6C6CEB1FF06C6CEB3FE06D137F3A07FF01FFC06C90B512806C15
+006C6C13FC6D5B010F13E0010190C7FC272A7CA830>I<EC03FE3A3FFC1FFF80267FFE7F
+13E000FF90B57E90B612FC6C816CEBFE07C69038F001FF4A6C13804A137F4AEB3FC091C7
+121F17E049140FA217F01607A8160FA217E07F161F6EEB3FC0A26EEB7F806E13FFDAF003
+13009138FC0FFE91B55A5E495C6E13C0021F90C7FCEC03FC91C9FCAD383FFFF8487FB57E
+A26C5B6C5B2C3C80A730>I<49B413F8010FEBC1FC013F13F14913FD48B6FC5A48138139
+0FFC007F49131F4848130F491307485A491303127F90C7FC15015A5AA77E7E15037FA26C
+6C1307150F6C6C131F6C6C133F01FC137F3907FF01FF6C90B5FC6C14FD6C14F9013F13F1
+010F13C1903803FE0190C7FCAD92B512F84A14FCA46E14F82E3C7DA730>I<ED07F83A3F
+FF803FFF486DB51280B512C302CF14C06C13DF6C9038FFFC3FD8001F13E09238801F8092
+38000F004A90C7FC5C5C5CA25CA45CAF003FB512FC4880B7FCA26C5C6C5C2A287EA730>
+I<90381FFC1E48B5129F000714FF5A5A5A387FF007EB800100FEC7FC4880A46C143E007F
+91C7FC13E06CB4FC6C13FC6CEBFF806C14E0000114F86C6C7F01037F9038000FFF020013
+80007C147F00FEEC1FC0A2150F7EA27F151F6DEB3F806D137F9039FC03FF0090B6FC5D5D
+00FC14F0D8F83F13C026780FFEC7FC222A79A830>I<EB0780497E131FA9003FB612E048
+15F0B7FCA36C15E026001FC0C7FCB216F8ED01FCA5ECE003010FEB07F814F09138FC1FF0
+6DB512E06D14C016806D14009038007FFCEC1FF026337EB130>I<D83FFCEB3FFC486C49
+7E00FF14FFA2007F147F003F143F00001400B3A41501A2150315076D130F903A7FC07FFF
+F891B612FC6D15FE7F6D4913FC6D9038F87FF8010001C0C7FC2F2880A630>I<3B3FFFC0
+7FFF80486DB512C0B515E0A26C16C06C496C13803B01F80003F000A26D130700005DA26D
+130F017E5CA2017F131F6D5CA2EC803F011F91C7FCA26E5A010F137EA2ECE0FE01075BA2
+14F101035BA3903801FBF0A314FF6D5BA36E5A6E5A2B277EA630>I<3B3FFFC01FFFE048
+6D4813F0B515F8A26C16F06C496C13E0D807E0C7EA3F00A26D5C0003157EA56D14FE0001
+5DEC0F80EC1FC0EC3FE0A33A00FC7FF1F8A2147DA2ECFDF9017C5C14F8A3017E13FBA290
+393FF07FE0A3ECE03FA2011F5C90390F800F802D277FA630>I<3A3FFF81FFFC4801C37F
+B580A26C5D6C01815BC648C66CC7FC137FEC80FE90383F81FC90381FC3F8EB0FE3ECE7F0
+6DB45A6D5B7F6D5B92C8FC147E147F5C497F81903803F7E0EB07E790380FE3F0ECC1F890
+381F81FC90383F80FE90387F007E017E137F01FE6D7E48486D7E267FFF80B5FCB500C114
+8014E3A214C16C0180140029277DA630>I<3B3FFFC07FFF80486DB512C0B515E0A26C16
+C06C496C13803B01FC0003F000A2000014076D5C137E150F017F5C7F151FD91F805BA214
+C0010F49C7FCA214E00107137EA2EB03F0157C15FCEB01F85DA2EB00F9ECFDF0147D147F
+A26E5AA36E5AA35DA2143F92C8FCA25C147EA2000F13FE486C5AEA3FC1EBC3F81387EB8F
+F0EBFFE06C5B5C6C90C9FC6C5AEA01F02B3C7EA630>I<001FB612FC4815FE5AA316FC90
+C7EA0FF8ED1FF0ED3FE0ED7FC0EDFF80003E491300C7485A4A5A4A5A4A5A4A5A4A5A4A5A
+4990C7FC495A495A495A495A495A495A4948133E4890C7127F485A485A485A485A485A48
+B7FCB8FCA46C15FE28277DA630>I E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fe cmmi10 10.95 1
+/Fe 1 61 df<183818FC1703EF0FF8EF3FE0EFFF80933803FE00EE0FF8EE3FE0EEFF80DB
+03FEC7FCED0FF8ED3FE0EDFF80DA03FEC8FCEC0FF8EC3FE0ECFF80D903FEC9FCEB0FF8EB
+3FE0EBFF80D803FECAFCEA0FF8EA3FE0EA7F8000FECBFCA2EA7F80EA3FE0EA0FF8EA03FE
+C66C7EEB3FE0EB0FF8EB03FE903800FF80EC3FE0EC0FF8EC03FE913800FF80ED3FE0ED0F
+F8ED03FE923800FF80EE3FE0EE0FF8EE03FE933800FF80EF3FE0EF0FF8EF03FC17001838
+363678B147>60 D E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Ff cmbx10 10.95 24
+/Ff 24 124 df<EA0FC0EA1FE0EA3FF0EA7FF8EAFFFCA313FEA3127F123F121FEA0FDEEA
+001EA2133E133CA2137C1378A213F8EA01F0A2EA03E0EA07C0EA0F80121FEA3F00121E12
+0C0F20798D1D>44 D<ECFFE0010713FC011F13FF017F14C0D9FFE07F489038803FF03A03
+FE000FF848486D7EA248486D7E001F81A348486D1380A3007F16C0A500FF16E0B3A2007F
+16C0A5003F16806D5BA2001F1600A2000F5D6D13076C6C495A6C6C495A6C6D485A6C9038
+E0FFE06DB55A011F91C7FC010713FC010013E02B3D7CBB34>48 D<903803FF80013F13F8
+90B512FE00036E7E4881260FF80F7F261FC0037F4848C67F486C6D7E6D6D7E487E6D6D7E
+A26F1380A46C5A6C5A6C5A0007C7FCC8FC4B1300A25E153F5E4B5AA24B5A5E4A5B4A5B4A
+48C7FC5D4A5AEC1FE04A5A4A5A9139FF000F80EB01FC495A4948EB1F00495AEB1F8049C7
+FC017E5C5B48B7FC485D5A5A5A5A5AB7FC5EA4293C7BBB34>50 D<00071538D80FE0EB01
+F801FE133F90B6FC5E5E5E5E93C7FC5D15F85D15C04AC8FC0180C9FCA9ECFFC0018713FC
+019F13FF90B67E020113E09039F8007FF0496D7E01C06D7E5B6CC77FC8120F82A31780A2
+1207EA1FC0487E487E12FF7FA21700A25B4B5A6C5A01805C6CC7123F6D495AD81FE0495A
+260FFC075B6CB65A6C92C7FCC614FC013F13F0010790C8FC293D7BBB34>53
+D<16FCA24B7EA24B7EA34B7FA24B7FA34B7FA24B7FA34B7F157C03FC7FEDF87FA2020180
+EDF03F0203804B7E02078115C082020F814B7E021F811500824A81023E7F027E81027C7F
+A202FC814A147F49B77EA34982A2D907E0C7001F7F4A80010F835C83011F8391C87E4983
+133E83017E83017C81B500FC91B612FCA5463F7CBE4F>65 D<B812F8EFFF8018F018FC84
+26003FFCC7EA3FFF050F13807113C07113E08319F0A27113F8A719F05FA24D13E019C04D
+13804D1300EF3FFE933801FFF891B712E0188018F818FE02FCC7380FFF80050313C07113
+E07113F019F8F07FFCA2F03FFEA219FFA38460A419FE187FA2F0FFFC4D13F85F4D13F005
+3F13E0BA12C0190018FC18F095C7FC403E7DBD4A>I<922607FFC0130E92B500FC131E02
+0702FF133E023FEDC07E91B7EAE1FE01039138803FFB499039F80003FF4901C01300013F
+90C8127F4948151FD9FFF8150F48491507485B4A1503481701485B18004890CAFC197E5A
+5B193E127FA349170012FFAC127F7F193EA2123FA27F6C187E197C6C7F19FC6C6D16F86C
+6D150119F06C6D15036C6DED07E0D97FFEED0FC06D6CED3F80010F01C0ECFF006D01F8EB
+03FE6D9039FF801FFC010091B55A023F15E002071580020002FCC7FC030713C03F407ABE
+4C>I<B812F8EFFF8018F018FC18FF26003FFCC76C13C005077F05017F716C7E727E727E
+727E721380A27213C0A27213E0A21AF084A21AF8A41AFCA5197FA319FFA51AF8A41AF0A2
+601AE0A24E13C0A24E13804E1300604E5A4E5A4D485A050713E0057F5BBA5A4EC7FC18F8
+18C005F8C8FC463E7DBD50>I<BAFCA4198026003FFEC7123F1707170183183FA2181FF0
+0FC0A31807EE07C0A3F003E0A3160F95C7FC161F163F16FF91B6FCA54AC6FC163F161F04
+0F147CA2160719F8A593C71201A219F01803A21807A2180FF01FE0183F18FF1703173FBA
+FCA219C0A33E3D7DBC45>I<B912FEA48426003FFEC77E170F1703170084A284F01F80A3
+180FA2EE07C0A2F007C0A4040F90C7FCA2161F163F16FF91B6FCA54AC6FC163F161F160F
+A21607A693C9FCACB712E0A53A3D7DBC42>I<922607FFC0130E92B500FC131E020702FF
+133E023FEDC07E91B7EAE1FE01039138803FFB499039F80003FF4901C01300013F90C812
+7F4948151FD9FFF8150F48491507485B4A1503481701485B18004890CAFC197E5A5B193E
+127FA34994C7FC12FFAB0407B612FC127F7FA3003F92C7383FFE00A27F7EA26C7FA26C7F
+6C7FA26C7F6C7FD97FFE157F6D6C7E010F01E014FF6D01F813036D9038FF801F010091B5
+12F3023F15C00207ED803E02009138FE000E030701E090C7FC46407ABE52>I<B71280A5
+26003FFEC7FCB3B3B0B71280A5213E7DBD28>73 D<B712E0A526003FFEC9FCB3AD183EA4
+187E187CA418FCA21701A2EF03F8A21707170F171F177FEE01FF160FB9FC18F0A4373E7D
+BD3F>76 D<B6051FB512C06F5EA26F5EA2D8003F97C7FC6F16F7A26E6CED01E7A26E6CED
+03C7A36E6CED0787A26E6CED0F07A26E6C151EA36E6D143CA26E6D1478A26E6D14F0A26F
+6CEB01E0A36F6CEB03C0A26F6CEB0780A26F6CEB0F00A36F6C131EA26F6D5AA26F6D5AA2
+6F6D5AA393387FF1E0A293383FFBC0A270B45AA37090C7FCA2705AA2705AB600C0031FB6
+12C0A2705AA2705A5A3E7CBD63>I<B6037FB512E0A2818181D8003F6D9139001F800081
+A281816E7E6E7F6E7F80826E7F6E7F6E7F6E7F157F826F7F6F7F6F7F6F7F81836F7F6F7F
+707E701380A27013C07013E07013F07013F87013FCA27013FEEF7FFF71139F7113DF8319
+FF8383838384A28484848484A284B600C080197F193F191FA24B3E7DBD52>I<ED3FFF02
+03B512F0021F14FE027F6E7E902701FFF80713E00107D9C00013F84990C7EA3FFCD93FFC
+EC0FFF49486E7F49486E7F48496E7F4A80488448496F7EA24890C96C7E4884A249161F00
+3F84A34848701380A400FF19C0AD007F19806D5EA3003F1900A26D5E6C60A26C6D4B5AA2
+6C6D4B5A6C6D4A5BA26C6D4A5B6C6D4A5B6D6C4A5B6DB4023F90C7FC6D01C0EBFFFE0107
+D9F80713F8010190B612E06D5E021F4AC8FC020314F0DA003F90C9FC42407ABE4F>I<B8
+12F017FF18C018F018FC26003FFCC77FEF1FFF7113807113C07113E0A27113F0A319F8A8
+19F0A34D13E019C05F4D1380053F1300EFFFFE91B712F860188005FCC7FC4ACAFCB3A4B7
+7EA53D3E7DBD47>I<B87E17FCEFFF8018F08428003FFC000113FE9338003FFF050F7F71
+7F717FA2858385A761A25F61614D5B4D90C8FCEF3FFE4CB45A91B712F018C04DC9FC717E
+9126FC000F7F040113F0707F717EA2717EA2717EA685A6F207C019C0A271140F07E01380
+B76DEBF01F719038FC3F007190B5FC716C5B061F13F8CB000113E04A3F7DBD4E>82
+D<903A03FFC001C0011FEBF803017FEBFE0748B6128F4815DF48010013FFD80FF8130F48
+481303497F4848EB007F127F49143F161F12FF160FA27F1607A27F7F01FC91C7FCEBFF80
+6C13F8ECFFC06C14FCEDFF806C15E016F86C816C816C816C16806C6C15C07F010715E0EB
+007F020714F0EC003F1503030013F8167F163F127800F8151FA2160FA27EA217F07E161F
+6C16E06D143F01E015C001F8EC7F8001FEEB01FF9026FFE00713004890B55A486C14F8D8
+F81F5CD8F00314C027E0003FFEC7FC2D407ABE3A>I<003FB912FCA5903BFE003FFE003F
+D87FF0EE0FFE01C0160349160190C71500197E127EA2007C183EA400FC183F48181FA5C8
+1600B3AF010FB712F8A5403D7CBC49>I<B76C90B61280A526003FFEC9003EC7FCB3B3A4
+197E011F177C80A26D17FC616D6D14014E5A6D6D4A5A6D6D140F6D01F8EC3FC0DA7FFEEC
+FF8091273FFFC00F90C8FC020F90B512FC02035D020015E0031F1480030101F8C9FC493F
+7DBD50>I<B6D8FC03B600F090B512FEA5C601FCC7000301F0C8EA7E00017F6F177C856E
+6E17FC013F63856D6C037F4B5AA26F4A6C14036D634D7F6F18076D634D806F02EF150F6D
+636F01076E131F6D04C793C7FC050F806F02835D6D1A3E051F806F0201157E027F197C6F
+013F6E13FC023FDA3E005D057E806F017C017F13016E6105FC14FE7048013F13036E6104
+C1EDFF076E4A6D5C04C31687DCE3E06D138F6E6104E716CFDCF7C06D13DF6E96C8FC04FF
+16FF6E4A6D5BA294C77E6F5FA24C80033F5FA26F486F5AA24C153F030F5FA24C151F0307
+5FA26F486F5A673F7EBD6C>87 D<B600FE020FB512C0A5C66C90C9381F80006D6D4BC7FC
+6D6D157EA26D6D5D6D6D4A5A816D4C5A6D6D4A5A816D4C5A6E6C4A5A6E7F4EC8FC6E6D13
+7E6E7F606E6D485A6E13F84D5A6E6D485A6E13FE70485A6F495A6F139F05FFC9FC6F5B81
+5F6F5B816F5B5FB3A20207B612F8A54A3E7EBD4F>89 D<B912E0A43304809A34>123
+D E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fg cmti10 10.95 30
+/Fg 30 121 df<933807FF80043F13E09338FE00F8DB01F0133EDB07E0130E4B48131F4C
+137F031F14FF4BC7FCA218FE157E1878180015FE5DA31401A25DA414030103B712F0A218
+E0903A0003F000070207140F4B14C0A3171F020F15805DA2173F1800141F5D5F177EA214
+3F92C712FE5FA34A1301027EECF81CA3160302FEECF03C4A1538A21878187013014A0101
+13F018E0933800F1C0EF7F804948EC1F0094C7FCA35C1307A2001E5B127F130F00FF5BA2
+49CAFC12FEEAF81EEA703CEA7878EA1FF0EA07C0385383BF33>12
+D<120FEA3FC0127FA212FFA31380EA7F00123C0A0A77891C>46 D<131EEB3F80137FEBFF
+C05AA214806C13005B133C90C7FCB3120FEA3FC0127FA212FFA35B6CC7FC123C122777A6
+1C>58 D<171C173C177CA217FCA216011603A21607A24C7EA2161DA216391679167116E1
+A2ED01C1A2ED038115071601150EA2031C7FA24B7EA25D15F05D4A5AA24A5AA24AC7FC5C
+140E5C021FB6FC4A81A20270C7127FA25C13015C495AA249C8FCA2130E131E131C133C5B
+01F882487ED807FEEC01FFB500E0017FEBFF80A25C39417BC044>65
+D<49B712C018F818FE903B0003FC0001FF9438007F804BEC3FC0A2F01FE014074B15F018
+0FA2140F5D181FA2021F16E05D183F19C0023FED7F804B14FF19004D5A027F4A5A92C7EA
+07F0EF1FE0EF7F804AD903FEC7FC92B512F017FE4AC7EA3F800101ED1FE04A6E7E170784
+01036F7E5CA30107825CA3010F5E4A1407A260011F150F5C4D5A60013F153F4A4A5A4D5A
+017F4A90C7FC4C5A91C7EA0FF849EC3FF0B812C094C8FC16F83C3E7BBD40>I<4AB61280
+A2180091C713C0167F5FA216FF94C7FCA35D5EA315035EA315075EA3150F5EA3151F5EA3
+153F5EA3157FA25EA215FFA293C8FCA25CA25DA2380F8003EA3FC0D87FE05BA21407D8FF
+C05B140F01805B49485A12FC0070495A4A5A6C01FEC9FC383C01FC380F07F03807FFC0C6
+48CAFC314079BD30>74 D<49B5933807FFFC496062D90003F0FC00505ADBBF805E1A771A
+EF1407033F923801CFE0A2F1039F020FEE071F020E606F6C140E1A3F021E161C021C0438
+5BA2F1707F143C023804E090C7FCF001C0629126780FE0495A02705FF00700F00E0114F0
+02E0031C5BA2F03803010116704A6C6C5D18E019070103ED01C00280DA03805BA2943807
+000F13070200020E5C5FDB03F8141F495D010E4B5CA24D133F131E011CDAF9C05CEEFB80
+197F013C6DB4C7FC013895C8FC5E01784A5C13F8486C4A5CD807FE4C7EB500F04948B512
+FE16E01500563E7BBD52>77 D<902601FFFE020FB5FC496D5CA2D900016D010013C04AEE
+3F00193E70141C193CEC07BFDB3FE01438151F1978020F7FDA0E0F15708219F0EC1E0702
+1C6D5CA203031401023C7FDA38015DA2701303EC7800027002805BA2047F130702F014C0
+4A013F91C7FCA2715A0101141F4AECF00EA2040F131E010315F84A151C1607EFFC3C0107
+140391C7143817FE040113784915FF010E16708218F0131E011C6F5AA2173F133C01385E
+171F137813F8486C6F5AEA07FEB500F01407A295C8FC483E7BBD44>I<49B612FCEFFF80
+18F0903B0003FE000FF8EF03FE4BEB00FF8419800207ED3FC05DA219E0140F5DA3021FED
+7FC05DA2F0FF80143F4B15004D5A60027F4A5A4B495A4D5AEF3F8002FF02FEC7FC923800
+07F892B512E01780499038000FE04A6D7E707E707E0103814A130083A213075CA25E130F
+5C5F1603131F5CA3013F020714404A16E05F017F160119C04A01031303496C1680B6D880
+0113079438FE0F009338007E1ECAEA3FFCEF07F03B407BBD42>82
+D<147E49B47E903907C1C38090391F80EFC090383F00FF017E137F4914804848133F485A
+A248481400120F5B001F5C157E485AA215FE007F5C90C7FCA21401485C5AA21403EDF038
+5AA21407EDE078020F1370127C021F13F0007E013F13E0003E137FECF3E1261F01E313C0
+3A0F8781E3803A03FF00FF00D800FC133E252977A72E>97 D<EB1FC0EA0FFF5CA2EA003F
+A291C7FCA25BA2137EA213FEA25BA21201A25BA21203A25B147E3907F1FF809038F783E0
+9038EF01F013FE390FF800F8A24913FC49137C485A157E5B15FE123FA290C7FCA2481301
+15FC127EA2140300FE14F85AA2EC07F0A215E048130F15C0141F15800078EB3F00127C14
+7E003C5B383E01F8381E03E06C485A6CB4C7FCEA01F81F4076BE2A>I<EC1FC0ECFFF090
+3803F03C903807C01E90381F800E90383F000F017E133F4913FF485A485A000714FE5B00
+0F14FC48481300A2485AA3127F90C8FCA35A5AA6481403007E1407150F151E003E143C15
+786C14F0EC03E0390F800F803903E07E003801FFF838003FC0202977A72A>I<EE3F80ED
+1FFF1700A2ED007FA2167EA216FEA25EA21501A25EA21503A25EA21507A25E147E903801
+FF8F903807C1CF90391F80EFC090383F00FF017E137F5B48486D5A485AA2485A000F92C7
+FC5B001F5CA24848137EA215FE127F90C75AA214015A485CA2140316384814F0A2140716
+7891380FE070127C021F13F0007E013F5B003E137FECF3E1261F01E35B3A0F8781E38027
+03FF00FFC7FCD800FC133E294077BE2E>I<EC3F80903801FFE0903807E0F890381F803C
+EB3E0001FC131E485A485A12074848133E49133C121F4848137C15F8EC03F0397F000FE0
+ECFF809038FFFC00B512C048C8FCA45AA61506150E151E007C143C15786C14F0EC01E06C
+EB07C0390F801F003807C0FC3801FFF038007F801F2976A72A>I<167C4BB4FC923807C7
+8092380F83C0ED1F87161FED3F3FA2157EA21780EE0E004BC7FCA414015DA414035DA301
+03B512F8A390260007E0C7FCA3140F5DA5141F5DA4143F92C8FCA45C147EA414FE5CA413
+015CA4495AA4495AA4495A121E127F5C12FF49C9FCA2EAFE1EEAF83C1270EA7878EA3FE0
+EA0F802A5383BF1C>I<EC03F0EC0FFC91383E0E1C9138FC077E903901F003FE13039038
+07E001D90FC013FCEB1F80A2EB3F004914F8137E01FE1303A2484814F0A2150712034914
+E0A2150F12074914C0A2151FA216805B153F1203ED7F006D5BA200015B0000495A9038F8
+0F7E90387C1EFEEB1FF8903807E0FC90C7FC1401A25DA21403A25D001C1307007F5C4813
+0F5D4A5A4AC7FC48137E00F85B387C03F0381FFFC0D803FEC8FC273B7CA72A>I<EB01FC
+13FF5CA21303A25CA21307A25CA2130FA25CA2131FA25CA2133FA291C8FCEC03F890387F
+0FFE91383E0F80D97E7813C0ECE007D9FFC013E014801400A2485A5BA25B0003140F16C0
+5BA20007141F16805BA2000F143F16005B5D001F147EEDFE074913FCA2003F0101130FED
+F80E1300161E48ECF01CA2007E1538A200FE1570020013E048EC7FC00038EC1F0028407A
+BE2E>I<1478EB01FCA21303A314F8EB00E01400AD137C48B4FC38038F80EA0707000E13
+C0121E121CEA3C0F1238A2EA781F00701380A2EAF03F140012005B137E13FE5BA212015B
+A212035B1438120713E0000F1378EBC070A214F0EB80E0A2EB81C01383148038078700EA
+03FEEA00F8163E79BC1C>I<1507ED1FC0A2153FA31680ED0E0092C7FCADEC07C0EC3FF0
+EC78F8ECE07CEB01C01303EC807EEB0700A2010E13FE5D131E131CEB3C01A201005BA214
+03A25DA21407A25DA2140FA25DA2141FA25DA2143FA292C7FCA25CA2147EA214FEA25CA2
+13015CA2121C387F03F012FF495A5C495A4848C8FCEAF83EEA707CEA3FF0EA0FC0225083
+BC1C>I<EB07F0EA03FF14E0A2EA000FA214C0A2131FA21480A2133FA21400A25BA2137E
+A213FEA25BA21201A25BA21203A25BA21207A25BA2120FA25BA2121FA25BA2123FA290C7
+FCA25A1307127EA2EAFE0F130E12FCA2131E131CA2EA7C381378EA3C70EA1FE0EA078014
+4079BE17>108 D<D801F0D93F80137F3D07FC01FFE003FFC03D0F3E07C1F80F83F03D0E
+1F0F00FC1E01F8001E011C90387C3800001C49D97E707F003C01F05C0038157F4A5C2678
+3FC05C12704A91C7FC91C7127E00F003FE1301494A5CEA007EA20301140301FE5F495CA2
+03031407000160495C180F03075D0003051F13E0494A1480A2030FEC3F810007F001C049
+5CA2031F91383E0380120F494AEC0700A2033F150E001FEF1E1C4991C7EA0FF80007C700
+0EEC03E0432979A74A>I<D801F0EB3F803A07FC01FFE03A0F3E07C1F83A0E1F0F00FC00
+1E011C137C001C49137E003C13F012385C38783FC012705C91C7FC00F015FE495CEA007E
+A2150101FE5C5BA2150300015D5B15075E0003020F13704914C0A2031F13F00007ED80E0
+5B1681EE01C0120F49EC0380A2EE0700001FEC0F0E49EB07FC0007C7EA01F02C2979A733
+>I<EC1FC0ECFFF8903803F07C90380FC01FEB1F8090393F000F80017E14C04913074848
+14E0485A12075B000F15F0485AA2485AA2ED0FE0127F90C7FCA2151F4815C05AA2ED3F80
+A2ED7F00A248147E007C5C007E13015D4A5A003E495A6C495A4A5A260F803EC7FC3807C0
+FC3801FFF038003F80242977A72E>I<903903E001F890390FF807FE903A1E7C1E0F8090
+3A1C3E3C07C0013C137801389038E003E0EB783F017001C013F0ED80019038F07F0001E0
+15F8147E1603000113FEA2C75AA20101140717F05CA20103140F17E05CA20107EC1FC0A2
+4A1480163F010F15005E167E5E131F4B5A6E485A4B5A90393FB80F80DA9C1FC7FCEC0FFC
+EC03E049C9FCA2137EA213FEA25BA21201A25BA21203A2387FFFE0B5FCA22D3A80A72E>
+I<027E1360903901FF81E0903807C1C390391F80E7C090383F00F7017E137F5B4848EB3F
+80485AA2485A000F15005B121F5D4848137EA3007F14FE90C75AA3481301485CA3140348
+5CA314074A5A127C141F007E133F003E495A14FF381F01EF380F879F3903FF1F80EA00FC
+1300143F92C7FCA35C147EA314FE5CA21301130390B512F05AA2233A77A72A>I<D801F0
+13FC3A07FC07FF803A0F3E0F03C0260E1F1C13E0001EEB380F001C1370003CEBE01F1238
+14C0D8783F14C00070903880070092C7FC91C8FC12F05BEA007EA313FE5BA312015BA312
+035BA312075BA3120F5BA3121F5B0007C9FC232979A726>I<EC7F80903801FFE0903807
+C0F890381F003C013E131C013C131E017C133E49137E15FEA2000114FCA215706D13007F
+EBFFC014FC6C13FF15806D13C06D13E0010F13F01300140F14071403120C123F387F8001
+1403D8FF0013E0A300FCEB07C000F0EB0F8012700078EB1F006C133C381F01F83807FFE0
+C690C7FC1F297AA725>I<EB01C0EB03F01307A25CA2130FA25CA2131FA25CA2133FA291
+C7FCA2007FB51280B6FC1500D8007EC7FC13FEA25BA21201A25BA21203A25BA21207A25B
+A2120FA25BA2121F141C1380A2003F133C1438EB0078147014F05C495AEA1F03495A6C48
+C7FCEA07FCEA01F0193A78B81E>I<137C48B4141C26038F80137EEA0707000E7F001E15
+FE121CD83C0F5C12381501EA781F007001805BA2D8F03F1303140000005D5B017E1307A2
+01FE5C5B150F1201495CA2151F0003EDC1C0491481A2153F1683EE0380A2ED7F07000102
+FF13005C01F8EBDF0F00009038079F0E90397C0F0F1C90391FFC07F8903907F001F02A29
+79A731>I<903903F001F890390FFC07FE90393C1E0E0F9026780F1C138001F0EBB83FD8
+01E013F89039C007F07FEA0380000714E0D9000F140048151C000E4AC7FCA2001E131FA2
+C75BA2143F92C8FCA35C147EA314FE4A131CA30101143C001E1538003F491378D87F8114
+70018314F000FF5D9039077801C039FE0F7C033A7C0E3C078027783C1E1EC7FC391FF80F
+FC3907E003F029297CA72A>120 D E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fh cmsy10 10.95 4
+/Fh 4 42 df<EB0FFCEB3FFF90B512C0000314F04880488048804880A2481580A3B712C0
+AA6C1580A36C1500A26C5C6C5C6C5C6C5CC614C0013F90C7FCEB0FFC22227BA72D>15
+D<126012F812FEEA7F80EA3FE0EA0FF8EA03FEC66C7EEB3FE0EB0FF8EB03FE903800FF80
+EC3FE0EC0FF8EC03FE913800FF80ED3FE0ED0FF8ED03FE923800FF80EE3FE0EE0FF8EE03
+FE933800FF80EF3FE0EF0FF8EF03FC1701EF07F8EF1FF0EF7FC0933801FF00EE07FCEE1F
+F0EE7FC04B48C7FCED07FCED1FF0ED7FC04A48C8FCEC07FCEC1FF0EC7FC04948C9FCEB07
+FCEB1FF0EB7FC04848CAFCEA07FCEA1FF0EA7FC048CBFC12FC1270CCFCAE007FB812F8B9
+12FCA26C17F8364878B947>21 D<19301978A2197C193CA2193E191EA2191F737EA2737E
+737EA2737E737E1A7C1A7EF21F80F20FC0F207F0007FBB12FCBDFCA26C1AFCCDEA07F0F2
+0FC0F21F80F27E001A7C624F5A4F5AA24F5A4F5AA24FC7FC191EA2193E193CA2197C1978
+A2193050307BAE5B>33 D<EF01E0841700841878187C84A284727E727E851803727E007F
+B912FCBA7E856C85CCEA07E0737EF101FCF1007FF21FC0F20FF8F203FFA2F20FF8F21FC0
+F27F00F101FCF103F04F5A007FBA1280BBC7FC616C60CBEA01F04E5A1807614E5A4EC8FC
+183EA260187818F86017016050327BAF5B>41 D E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fi cmbx12 12 49
+/Fi 49 122 df<DB0FFFEB03FF4AB5D8C03F13C0020F02F1B512E0027F91B612F0902701
+FFF8039038FE1FF849018002F813FC010F4948EBF03F49484913E0495A4A15C0495AF11F
+F801FF16804A6DEC07E070EC018096C7FCABBA12F0A5C69026E000030180C7FCB3B0007F
+D9FFC1B67EA546467EC541>11 D<ED0FFF4AB512C0020F14F0027F80903A01FFF803FC49
+9038C000FE010FEB00034948497E49485B5C495A4C138001FF6E13005CA3705AEE01F893
+C8FCA74BB51280B9FCA5C69038E00003B3B0007FD9FFC1B6FCA538467EC53E>I<157F91
+3803FFC0020F7F4A7F91383FE1F891387F80789138FF007C49143C495A163E4948131EA3
+130FA3163E163C167C16786E13F84B5A4B5A15075E6D6C485A4BC70003B512E0153E15FC
+6D5B5D4B91390007C0004B5E6D6D150F4FC7FC6D6D151E49173E496D5D491778496D15F8
+90261FBFFE4A5AD93F3F5E9026FE1FFF1403D801FC6E495A00036D5E48486C6D130F000F
+6F49C8FC001F6D6D133E48486C6D133C187C007F6D6D5B6F6C485A00FF6E6C485A6FEB87
+C06F13CFEFFF806F91C9FC6D6D5B6F49EC01E06F7F6C6CEC3FFF706D13036C6C4A6DEB07
+C06C6C91B500F0130FDA800702FCEB1F806C9026E03FF89039FF80FF00000390B5D8F03F
+EBFFFE6CDBC00F5C6C6CDA00035C011F01F8D9007F13E001030180020790C7FC4B477BC5
+57>38 D<B612F8A91D097F9A25>45 D<EA07C0EA1FF0EA3FF8EA7FFCEAFFFEA7EA7FFCEA
+3FF8EA1FF0EA07C00F0F788E1F>I<EE01C0EE03E01607A2160F17C0161F1780A2163F17
+005E167EA216FE5E15015EA215035EA215075E150F5EA2151F5E153F93C7FCA25D157E15
+FE5DA214015D14035DA214075D140F5DA2141F5D143F92C8FCA25C147EA214FE5C13015C
+A213035C13075CA2130F5C131F5CA2133F91C9FC5B137EA213FE5B12015BA212035BA212
+075B120F5BA2121F5B123F90CAFCA25A127E12FE5AA25A12782B647ACA38>I<EC03C014
+07141F147FEB03FF133FB6FCA413C3EA0003B3B3ADB712FCA5264177C038>49
+D<ECFFE0010F13FE013F6D7E90B612E0000315F82607FC0313FE3A0FE0007FFFD81F806D
+138048C7000F13C0488001C015E001F07F00FF6E13F07F17F881A46C5A6C5A6C5AC9FC17
+F05DA217E05D17C04B13804B1300A2ED1FFC4B5A5E4B5A4B5A4A90C7FC4A5A4A5AEC0FF0
+4A5AEC3F804AC7127814FE495A494814F8D907E014F0495A495A49C8FC017C1401491403
+48B7FC4816E05A5A5A5A5AB8FC17C0A42D417BC038>I<ECFFF0010713FF011F14C0017F
+14F049C66C7ED803F8EB3FFED807E06D7E81D80FF86D138013FE001F16C07FA66C5A6C48
+15806C485BC814005D5E4B5A4B5A4B5A4A5B020F1380902607FFFEC7FC15F815FF16C090
+C713F0ED3FFCED0FFEEEFF80816F13C017E0A26F13F0A217F8A3EA0FC0EA3FF0487EA248
+7EA217F0A25D17E06C5A494913C05BD83F80491380D81FF0491300D80FFEEBFFFE6CB612
+F800015D6C6C14C0011F49C7FC010113E02D427BC038>I<163FA25E5E5D5DA25D5D5D5D
+A25D92B5FCEC01F7EC03E7140715C7EC0F87EC1F07143E147E147C14F8EB01F0EB03E013
+0714C0EB0F80EB1F00133E5BA25B485A485A485A120F5B48C7FC123E5A12FCB91280A5C8
+000F90C7FCAC027FB61280A531417DC038>I<0007150301E0143F01FFEB07FF91B6FC5E
+5E5E5E5E16804BC7FC5D15E092C8FC01C0C9FCAAEC3FF001C1B5FC01C714C001DF14F090
+39FFE03FFC9138000FFE01FC6D7E01F06D13804915C0497F6C4815E0C8FC6F13F0A317F8
+A4EA0F80EA3FE0487E12FF7FA317F05B5D6C4815E05B007EC74813C0123E003F4A1380D8
+1FC0491300D80FF0495AD807FEEBFFFC6CB612F0C65D013F1480010F01FCC7FC010113C0
+2D427BC038>I<903807FFC0013F13FC48B612804815E0260FF80013F0D81FC0EB3FF848
+C7EA1FFC4815FE01C0130F486C14FF7FA66C485B6C4814FE000FC7FCC8EA3FFCED7FF8ED
+FFF04A13E04A13801600EC07FC4A5A5D4A5A5D4A5A92C7FCA2147E147CA31478AA91C8FC
+A814F8EB03FE497E497FA2497FA56D5BA26D90C7FC6D5AEB00F828467AC535>63
+D<EE1F80A24C7EA24C7EA34C7EA24B7FA34B7FA24B7FA34B7F169F031F80161F82033F80
+ED3E07037E80157C8203FC804B7E02018115F0820203814B137F0207815D173F020F814B
+7F021F8292C77EA24A82023E80027E82027FB7FCA291B87EA2498302F0C8FCA20103834A
+157F0107834A153FA249488284011F8491C97E4984133E017E82B6020FB612F0A54C457C
+C455>65 D<B9FC18F018FE727E19E026003FFCC700077F05017F716C7E727E727EA27213
+80A37213C0A74E1380A24E1300A24E5A4E5A4E5A4D5B05075B94B5128091B700FCC7FC18
+F018FF19E002FCC7000113F8716C7EF01FFE727E7213801AC07213E0A27213F0A31AF8A7
+1AF0A2601AE0604E13C0604E138095B5120005075BBA12F86119C04EC7FC18E045447CC3
+50>I<DCFFF01470031F01FF14F04AB6EAE0010207EDF803023FEDFE0791B539E001FF0F
+4949C7EA3F9F010701F0EC0FFF4901C0804990C87E4948814948814948167F4849163F48
+49161F5A4A160F485B19074890CAFC19035A5BA2007F1801A34994C7FC12FFAE127F7F1A
+F0A2123FA27F6C18011AE06C7F19036C6D17C06E16077E6C6DEE0F806C6DEE1F006D6C5E
+6D6C167E6D6C6C5D6D6D4A5A6D01F0EC07F0010101FEEC1FE06D903AFFF001FF80023F90
+B6C7FC020715FC020115F0DA001F1480030001F8C8FC44467AC451>I<B9FC18F018FE72
+7E19E026003FFEC7001F13F805017F9438003FFF060F7F727F727F727F84737E737EA273
+7EA2737EA21B80A2851BC0A51BE0AD1BC0A51B8061A21B006162193F624F5A19FF624E5B
+06075B4E5B063F90C7FC4DB45A050F13F8BA5A19C04EC8FC18F095C9FC4B447CC356>I<
+BA12F8A485D8001F90C71201EF003F180F180318011800A2197E193EA3191EA21778A285
+A405F890C7FCA316011603161F92B5FCA5ED001F160316011600A2F101E01778A2F103C0
+A494C7FC1907A21A80A2190FA2191FA2193FF17F0061601807181F4DB5FCBBFC61A44344
+7DC34A>I<BA1280A419C026003FFEC7121F1701EF007F183F181F180F180719E01803A3
+1801A3EE01E0F000F0A419001603A31607160F167F91B6FCA59138FE007F160F16071603
+A31601A693C9FCAFB712F0A53C447CC346>I<DCFFF01470031F01FF14F04AB6EAE00102
+07EDF803023FEDFE0791B539E001FF0F4949C7EA3F9F010701F0EC0FFF4901C0804990C8
+7E4948814948814948167F4849163F4849161F5A4A160F485B19074890CAFC19035A5BA2
+007F1801A34994C8FC12FFAD057FB612F0127F7FA3003FDC0001EBF000A27F7EA26C7FA2
+6C7F807E6C7F6C7F6D7E6D6C5D6D6C7E6D6D5C6D01F05C010101FE143F6D903AFFF001FF
+9F023F90B6120F0207EDFC030201EDF000DA001F02C01330030001FCC9FC4C467AC458>
+I<B712E0A5D8001F90C7FCB3B3B3A4B712E0A523447DC32A>73 D<B500FE067FB512806E
+95B6FCA26F5EA2D8003F50C7FC013D6DEE03DFA2013C6DEE079FA26E6CEE0F1FA26E6C16
+1EA26E6C163CA36E6C1678A26E6C16F0A26E6DEC01E0A26E6DEC03C0A36E6DEC0780A26F
+6CEC0F00A26F6C141EA26F6C5CA36F6C5CA26F6C5CA26F6D485AA26F6D485AA26F6D485A
+A3706C48C7FCA293383FF81EA2706C5AA2706C5AA3706C5AA2705BA2705BA2705BA2B605
+7FB6128071C7FCA2173E171C61447CC36A>77 D<B64BB512FE8181A281D8003F6D91C7EA
+780081013D7F81133C6E7E6E7F6E7F6E7F6E7F82806E7F6E7F6F7E6F7F83816F7F6F7F6F
+7F6F7F6F7F8382707F707F707F707F8482707F707F717E7113807113C019E0837113F071
+13F87113FC7113FE19FF847213F884848484A28484197F193F191FA2190F1907B6160319
+0119001A78A24F447CC358>I<923807FFC092B512FE0207ECFFC0021F15F091267FFE00
+13FC902601FFF0EB1FFF01070180010313C04990C76C7FD91FFC6E6C7E49486F7E49486F
+7E01FF8348496F7E48496F1380A248496F13C0A24890C96C13E0A24819F04982003F19F8
+A3007F19FC49177FA400FF19FEAD007F19FC6D17FFA3003F19F8A26D5E6C19F0A26E5D6C
+19E0A26C6D4B13C06C19806E5D6C6D4B13006C6D4B5A6D6C4B5A6D6C4B5A6D6C4A5B6D01
+C001075B6D01F0011F5B010101FE90B5C7FC6D90B65A023F15F8020715C002004AC8FC03
+0713C047467AC454>I<B812F8EFFFC018F818FE727ED8001F90C7003F13E005037F0500
+7F727E727E727EA28684A286A762A24E90C7FCA24E5A61187F943801FFF005075B053F13
+8092B7C8FC18F818E018F892C77FEF3FFF050F7F717F717FA2717FA2717FA785A61B0F85
+A2187F73131F72141EB700E06DEB803E72EBE0FC72EBFFF8060114F0726C13E0CC000713
+8050457DC354>82 D<DAFFE0131C010701FE133C013F9038FF807C90B6EAE0FC4815F948
+9038801FFF3907FC00014848EB007F4848143F4848140F491407007F15035B1601160012
+FF177CA27FA26D153C7F7F6D92C7FC6C7EEBFFE014FE6CEBFFF015FF6C15E016FC6C816C
+6F7E6C826C826C6C81011F810107811300020F80140003077FED007F82040F1380828212
+F082A282A27EA218007EA26C5D6C5E6D14036D5D6D140701F84A5A01FFEC3FF002F8EBFF
+E0486CB65AD8FC1F92C7FCD8F80714FC48C614F0480107138031467AC43E>I<003FBA12
+E0A59026FE000FEB8003D87FE09338003FF049171F90C71607A2007E1803007C1801A300
+781800A400F819F8481978A5C81700B3B3A20107B8FCA545437CC24E>I<B76C010FB512
+F8A526003FFEC93803E000B3B3A9011F17076280190F6D606F151F6D95C7FC6D6D5D197E
+6D6D5D6D6D1403DA7FFC4A5A6EB4EC3FF0020F9039F003FFE06E90B61280020193C8FC6E
+6C14FC030F14E09226007FFEC9FC4D457CC356>I<B600FE017FB691B512FEA526007FFC
+C8D83FFEC9EA7C006E82013F701778807415F86D705F6F7014016D705FA26F7014036D64
+814E6D14076D646F70140F6D041E94C7FCA26F023E6D5C6DDC3C7F151E81027F037C6D5C
+F0783F6F70147C023F4B6C1578A26F01016F13F86E4B6C5D16806E02036F485A4E7E04C0
+EEE0036E4A486C5DA2DCE00FEDF0076E4B6C5D16F06E4A6F48C8FC051E7F04F8705A6E4A
+027F131EA2DCFC7CEDFE3E037F0178023F133C04FE16FF033F01F85E4D8004FF17F86F49
+6E5BA36F496E5BA26F604D80A26F90C86C5BA36F486F90C9FCA26F48167EA30478163C6F
+457EC374>87 D<903801FFE0011F13FE017F6D7E48B612E03A03FE007FF84848EB1FFC6D
+6D7E486C6D7EA26F7FA36F7F6C5A6C5AEA00F090C7FCA40203B5FC91B6FC1307013F13F1
+9038FFFC01000313E0000F1380381FFE00485A5B127F5B12FF5BA35DA26D5B6C6C5B4B13
+F0D83FFE013EEBFFC03A1FFF80FC7F0007EBFFF86CECE01FC66CEB8007D90FFCC9FC322F
+7DAD36>97 D<EB7FC0B5FCA512037EB1ED0FF892B57E02C314E002CF14F89139DFC03FFC
+9139FF000FFE02FCEB03FF4A6D13804A15C04A6D13E05CEF7FF0A218F8173FA318FCAC18
+F8A2177F18F0A3EFFFE06E15C06E5B6E491380027C491300496C495A903AFC1FC07FFC49
+6CB512F0D9F00314C049C691C7FCC8EA1FF036467DC43E>I<EC3FFC49B512C0010F14F0
+013F14FC90397FF003FE9039FFC001FF0003495A48494813805B120F485AA2485A6F1300
+007F6E5AED00784991C7FCA212FFAC6C7EA3123F6DEC03C0A26C6C1407000F16806D140F
+6C6DEB1F006C6D133E6C01F05B3A007FFC03F86DB55A010F14C0010391C7FC9038003FF8
+2A2F7CAD32>I<EE03FEED07FFA5ED001F160FB1EC3FE0903803FFFC010FEBFF8F013F14
+CF9039FFF807FF48EBC00148903880007F4890C7123F4848141F49140F121F485AA3127F
+5BA212FFAC127FA37F123FA26C6C141FA26C6C143F0007157F6C6C91B5FC6CD9C00314FC
+6C9038F01FEF6DB5128F011FEBFE0F010713F89026007FC0EBF80036467CC43E>I<EC3F
+F80103B57E010F14E0013F8090397FF83FF89039FFC007FC48496C7E48496C7E48486D13
+80485A001FED7FC05B003FED3FE0A2127F5B17F0161F12FFA290B7FCA401F0C9FCA5127F
+A27FA2123F17F06C7E16016C6C15E06C6C14036C6DEB07C06C6DEB0F806C01F0EB3F0090
+397FFE01FE011FB55A010714F0010114C09026001FFEC7FC2C2F7DAD33>I<EDFF80020F
+13E0027F13F049B512F849EB8FFC90390FFE0FFE90381FFC1F14F8133FEB7FF0A2ED0FFC
+EBFFE0ED03F0ED00C01600ABB612F8A5C601E0C7FCB3B0007FEBFFE0A527467DC522>I<
+DAFFE0137E010F9039FE03FF80013FEBFF8F90B812C048D9C07F133F489038001FF84848
+EB0FFC4848903907FE1F80001F9238FF0F00496D90C7FCA2003F82A8001F93C7FCA26D5B
+000F5D6C6C495A6C6C495A6C9038C07FF04890B55A1680D8078F49C8FC018013E0000F90
+CAFCA47F7F7F90B612C016FC6CEDFF8017E06C826C16FC7E000382000F82D81FF0C77ED8
+3FC014074848020113808248C9FC177FA46D15FF007F17006D5C6C6C4A5A6C6C4A5AD80F
+FEEC3FF83B07FFC001FFF0000190B612C06C6C92C7FC010F14F8D9007F90C8FC32427DAC
+38>I<EB7FC0B5FCA512037EB1ED07FE92383FFF8092B512E002C114F89139C7F03FFC91
+38CF801F9139DF000FFE14DE14FC4A6D7E5CA25CA35CB3A7B60083B512FEA537457CC43E
+>I<137C48B4FC4813804813C0A24813E0A56C13C0A26C13806C1300EA007C90C7FCAAEB
+7FC0EA7FFFA512037EB3AFB6FCA518467CC520>I<EB7FC0B5FCA512037EB293387FFFE0
+A593380FE0004C5A4CC7FC167E5EED03F8ED07E04B5A4B5A037FC8FC15FEECC1FCECC3FE
+14C7ECDFFF91B57E82A202F97F02E17F02C07FEC807F6F7E826F7E816F7F836F7F816F7F
+83707E163FB60003B512F8A535457DC43B>107 D<EB7FC0B5FCA512037EB3B3B3A3B612
+80A519457CC420>I<90277F8007FEEC0FFCB590263FFFC090387FFF8092B5D8F001B512
+E002816E4880913D87F01FFC0FE03FF8913D8FC00FFE1F801FFC0003D99F009026FF3E00
+7F6C019E6D013C130F02BC5D02F86D496D7EA24A5D4A5DA34A5DB3A7B60081B60003B512
+FEA5572D7CAC5E>I<90397F8007FEB590383FFF8092B512E0028114F8913987F03FFC91
+388F801F000390399F000FFE6C139E14BC02F86D7E5CA25CA35CB3A7B60083B512FEA537
+2D7CAC3E>I<EC1FFC49B512C0010714F0011F14FC90397FF80FFF9026FFC0017F48496C
+7F4848C7EA3FE000078248486E7E49140F001F82A2003F82491407007F82A400FF1780AA
+007F1700A46C6C4A5AA2001F5E6D141F000F5E6C6C4A5AA26C6C6CEBFFE06C6D485B2700
+7FF80F90C7FC6DB55A010F14F8010114C09026001FFCC8FC312F7DAD38>I<90397FC00F
+F8B590B57E02C314E002CF14F89139DFC03FFC9139FF001FFE000301FCEB07FF6C496D13
+804A15C04A6D13E05C7013F0A2EF7FF8A4EF3FFCACEF7FF8A318F017FFA24C13E06E15C0
+6E5B6E4913806E4913006E495A9139DFC07FFC02CFB512F002C314C002C091C7FCED1FF0
+92C9FCADB67EA536407DAC3E>I<90387F807FB53881FFE0028313F0028F13F8ED8FFC91
+389F1FFE000313BE6C13BC14F8A214F0ED0FFC9138E007F8ED01E092C7FCA35CB3A5B612
+E0A5272D7DAC2E>114 D<90391FFC038090B51287000314FF120F381FF003383FC00049
+133F48C7121F127E00FE140FA215077EA27F01E090C7FC13FE387FFFF014FF6C14C015F0
+6C14FC6C800003806C15806C7E010F14C0EB003F020313E0140000F0143FA26C141F150F
+A27EA26C15C06C141FA26DEB3F8001E0EB7F009038F803FE90B55A00FC5CD8F03F13E026
+E007FEC7FC232F7CAD2C>I<EB01E0A51303A41307A2130FA2131FA2133F137F13FF1203
+000F90B51280B7FCA4C601E0C7FCB3A3ED01E0A9150302F013C0137F150790393FF80F80
+90391FFC1F006DB5FC6D13FC01015B9038003FE023407EBE2C>I<D97FC049B4FCB50103
+B5FCA50003EC000F6C81B3A85EA25EA25E7E6E491380017FD901F713FE9138F807E76DB5
+12C7010F1407010313FE9026007FF0EBFC00372E7CAC3E>I<B6903803FFFCA5000101E0
+9038003E006C163C80017F5D8017F8013F5D6E1301011F5D6E1303010F5D6E13076D5DED
+800F6D92C7FC15C05E6DEBE01E163E6D143CEDF07C027F1378EDF8F8023F5B15FD021F5B
+15FF6E5BA36E5BA26E90C8FCA26E5AA26E5AA21578362C7EAB3B>I<B6903803FFFCA500
+0101E09038003E006C163C80017F5D8017F8013F5D6E1301011F5D6E1303010F5D6E1307
+6D5DED800F6D92C7FC15C05E6DEBE01E163E6D143CEDF07C027F1378EDF8F8023F5B15FD
+021F5B15FF6E5BA36E5BA26E90C8FCA26E5AA26E5AA21578A215F85D14015D001F1303D8
+3F805B387FC007D8FFE05B140F92C9FC5C143E495A387FC1F8EB07F06CB45A6C5B000790
+CAFCEA01FC36407EAB3B>121 D E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fj cmr10 10.95 91
+/Fj 91 125 df<4AB4EB0FE0021F9038E03FFC913A7F00F8FC1ED901FC90383FF03FD907
+F090397FE07F80494801FF13FF4948485BD93F805C137F0200ED7F00EF003E01FE6D91C7
+FC82ADB97EA3C648C76CC8FCB3AE486C4A7E007FD9FC3FEBFF80A339407FBF35>11
+D<EC03FE91383FFF809138FE03E0903903F800F0D90FE013384948137C90393F8001FE90
+387F00035B5BA2485A6F5AED007093C7FCAA16FEB7FCA33901FC000315011500B3AC486C
+497EB5D8F87F13FCA32E407EBF33>I<EC03FF023F13EE9138FE01FEEB03F090380FE003
+EB1FC0EB3F80EB7F005B5B150148481300AEB7FCA3D801FCC7FCB3AE486C497EB5D8F87F
+13FCA32E407EBF33>I<DA03FE49B4FC91273FFF801F13C0913BFE03E07F01F0903C03F0
+00F1FC0078D90FE0D97FF0131C49484948133E4948484913FF494848495A5B491500A248
+485C03016E5A0300153896C7FCAA197FBBFCA3D801FCC738FE00018485B3AC486C496CEC
+FF80B5D8F87FD9FC3F13FEA347407EBF4C>I<001E130F397F803FC000FF137F01C013E0
+A201E013F0A3007F133F391E600F3000001300A401E01370491360A3000114E04913C000
+03130101001380481303000EEB070048130E0018130C0038131C003013181C1C7DBE2D>
+34 D<4B6C130C4B6C131EA20307143EA24C133CA2030F147CA293C71278A24B14F8A203
+1E5CA2033E1301A2033C5CA3037C1303A203785CA203F81307A24B5CA20201140F007FBA
+FCBB1280A26C1900C72707C0003EC8FC4B133CA3020F147CA292C71278A24A14F8A2021E
+5CA3023E1301007FBAFCBB1280A26C1900C727F80007C0C8FC4A5CA20101140FA24A91C9
+FCA301035CA24A131EA20107143EA24A133CA2010F147CA291C71278A34914F8A2011E5C
+A2013E1301A2013C5CA201186D5A41517BBE4C>I<14E0A4EB07FC90383FFF8090B512E0
+3901F8E3F03903E0E0FCD807C0133CD80F807FD81F007F003E80003C1580007C140316C0
+0078141F00F8143F157FA47EED3F806CEC0E0092C7FC127F138013C0EA3FF013FEEA1FFF
+6C13FC6C13FF6C14C06C806C6C13F8011F7F130301007FECE7FF14E102E01380157F153F
+ED1FC0A2003E140F127FD8FF801307A5130000FC158000F0140F1270007815005D6C141E
+153E6C5C6C5C3907C0E1F03903F8EFE0C6B51280D93FFEC7FCEB0FF8EB00E0A422497BC3
+2D>I<013F1603D9FFC04B7E2601E0E0150F2607C070151F48486C4BC7FC023E157E4848
+6C15FE48D90FC0EB03FC003ED90EF0EB0FF8DA0F3F13FD007E903A070FFFF1F0007C0200
+EB03E0160000FC6D6C495A170F604DC8FC5F173E5F17FC5F4C5A1603007CD907005B4C5A
+007E150F003E495C020E49C9FC003F5D6C49133E260F803C5B023813FC6C6C485B3A01E0
+E001F03800FFC090273F0003E0133F90C70007ECFFC09339C001E0E0923A0F8007C07003
+1F49487E0400143C033E90381F001C037E497F037C133E4B150F0201027E7F4B137C4A5A
+020702FCEB03805D4A5A141F92C7FC143E147E147C5CA2495A0103037CEB07005C494814
+7E010F033E5B4A160E49C8123F496F5B013E92380F803C49173801FC6F6C5A49923801E0
+E0496FB45A0160043FC7FC41497BC34C>I<EC0F80EC7FE0ECF870903803E0380107133C
+ECC01CEB0F80011F131E150EA2EB3F00A55D1480A25D157815705D6D6C5A14C1ECC38002
+C7CAFC02EE91387FFFFCEB0FEC14FC4A020713C06D48913801FE006E5DEF00F06D7E0107
+4B5A496C5D011D1503D939FF4A5A017093C7FC496D5B0001017F140E496C6C131E00036E
+131C2607801F143C000F6E5B001F6D6C1370263F000714F0486E485ADA03FE5B913801FF
+03486D495A0487C8FCED7FCFED3FFE6F4814386D5C150F007F6E6C14786D6D6C1470003F
+4A6C14F06D496C6C13E0001F91393E3FC0016C6C903AFC1FF003C03D07FC07F007FC1F80
+0001B5D8C001B512006C6C90C7EA7FFCD90FF8EC0FF03E437CC047>I<121EEA7F8012FF
+13C0A213E0A3127FEA1E601200A413E013C0A312011380120313005A120E5A1218123812
+300B1C79BE19>I<1430147014E0EB01C0EB03801307EB0F00131E133E133C5B13F85B12
+015B1203A2485AA2120F5BA2121F90C7FCA25AA3123E127EA6127C12FCB2127C127EA612
+3E123FA37EA27F120FA27F1207A26C7EA212017F12007F13787F133E131E7FEB07801303
+EB01C0EB00E014701430145A77C323>I<12C07E12707E7E121E7E6C7E7F12036C7E7F12
+007F1378137CA27FA2133F7FA21480130FA214C0A3130714E0A6130314F0B214E01307A6
+14C0130FA31480A2131F1400A25B133EA25BA2137813F85B12015B485A12075B48C7FC12
+1E121C5A5A5A5A145A7BC323>I<EB03C0A2805CA600F0140F00FC143F00FE147F00FF14
+FF393FC3C3FC390FE187F03903F18FC03900FDBF00EB3FFCEB0FF0EB03C0EB0FF0EB3FFC
+EBFDBF3903F18FC0390FE187F0393FC3C3FC39FF03C0FF00FE147F00FC143F00F0140F00
+001400A6805CA220277AC32D>I<1506150FB3A9007FB912E0BA12F0A26C18E0C8000FC9
+FCB3A915063C3C7BB447>I<121EEA7F8012FF13C0A213E0A3127FEA1E601200A413E013
+C0A312011380120313005A120E5A1218123812300B1C798919>I<B512FEA617067F961E>
+I<121EEA7F80A2EAFFC0A4EA7F80A2EA1E000A0A798919>I<ED0180ED03C01507A21680
+150FA216005DA2151E153EA2153C157CA2157815F8A25D1401A25D1403A25D1407A25D14
+0FA24AC7FCA2141E143EA2143C147CA2147814F8A25C1301A25C1303A25C1307A25C130F
+A291C8FC5BA2131E133EA25BA2137813F8A25B1201A25B1203A25B1207A25B120FA290C9
+FC5AA2121E123EA2123C127CA2127812F8A25A1260225B7BC32D>I<EB01FE90380FFFC0
+90383F03F090387C00F849137C48487F48487F4848EB0F80A2000F15C04848EB07E0A300
+3F15F0A290C712034815F8A64815FCB3A26C15F8A56C6CEB07F0A3001F15E0A36C6CEB0F
+C0A26C6CEB1F80000315006C6C133E6C6C5B017C5B90383F03F090380FFFC0D901FEC7FC
+263F7DBC2D>I<EB01C013031307131F137FEA07FFB5FC139FEAF81F1200B3B3ACEB7FF0
+B612F8A31D3D78BC2D>I<EB07FC90383FFF8090B512E03903F01FF83907C007FC390F00
+01FE001E6D7E001C1580003CEC7FC05AED3FE01270B4FC6DEB1FF07FA56C5A6CC7FC120C
+C813E0153FA216C0157F168015FF16004A5A5D4A5A4A5A5D4A5A4A5A4AC7FC147E147C5C
+495A495A495A495A49C71270133E133C5B4914E0485A485A485A48C7120148B6FCA25A48
+15C0B7FCA3243D7CBC2D>I<EB07FC90383FFF809038F80FE03901E003F839078001FCD8
+0F007F000E6D7E001E1580D81F80137F486C14C07FA27F5BA2121F6C5AC8138015FF1600
+A24A5AA24A5A5DEC07E04A5A023FC7FCEB1FFCECFF809038000FE0EC07F86E7E6E7E6E7E
+1680ED7FC0A216E0153FA216F0A2120C123F487E487EA316E0A249137F6CC713C01278ED
+FF807E6C4913006C495A3907C007FC3903F80FF0C6B55A013F1380D907F8C7FC243F7CBC
+2D>I<150E151E153EA2157EA215FE1401A21403EC077E1406140E141CA214381470A214
+E0EB01C0A2EB0380EB0700A2130E5BA25B5BA25B5B1201485A90C7FC5A120E120C121C5A
+A25A5AB8FCA3C8EAFE00AC4A7E49B6FCA3283E7EBD2D>I<00061403D80780131F01F813
+FE90B5FC5D5D5D15C092C7FC14FCEB3FE090C9FCACEB01FE90380FFF8090383E03E09038
+7001F8496C7E49137E497F90C713800006141FC813C0A216E0150FA316F0A3120C127F7F
+12FFA416E090C7121F12FC007015C012780038EC3F80123C6CEC7F00001F14FE6C6C485A
+6C6C485A3903F80FE0C6B55A013F90C7FCEB07F8243F7CBC2D>I<EC1FE0ECFFF8903803
+F03E90380FC00F90391F000780133E017EEB1FC049133F4848137F12035B12074848EB3F
+80ED1F00001F91C7FC5BA2123FA3485AA214FE903887FF8039FF8F07E090389C01F09038
+B800FC01B0137E13F0497F16804914C0A2ED1FE0A34914F0A5127FA6123F6D14E0A2121F
+ED3FC0A26C6C1480A20007EC7F006C6C137E6C6C5B6C6C485A90387E07F06DB45A010F13
+80D903FCC7FC243F7CBC2D>I<1238123C123F90B612FCA316F85A16F016E00078C71201
+0070EC03C0ED078016005D48141E151C153C5DC8127015F04A5A5D14034A5A92C7FC5C14
+1EA25CA2147C147814F8A213015C1303A31307A3130F5CA2131FA6133FAA6D5A0107C8FC
+26407BBD2D>I<EB03FC90381FFF8090387C07E09038F001F83901E0007C48487F48487F
+48C7FCED0F80121E16C0003E1407A4123FA26DEB0F807F6C6C131F6D140001FC133E6C6C
+5B9038FF80786C6D5A6CEBF3E06CEBFF806C91C7FC133F6D13C06D7F013F13F801787F48
+486C7E3903E01FFF48486C1380260F800313C048487E489038007FE0003E143F007E141F
+007CEC0FF01507481403A31501A46C15E0007C1403A2007E15C06C14076CEC0F806DEB1F
+006C6C133ED807F05B3901FC03F86CB512E0011F1380D903FCC7FC243F7CBC2D>I<EB03
+FCEB1FFF90387E07C09038FC03F048486C7E48486C7E4848137C000F147E4848137F8100
+3F15805B007F15C0A2151F12FF16E0A516F0A5127F153FA36C7EA2001F147F120F6C6C13
+FF6D13DF000313013900F8039F90387E0F1FD91FFE13E0EB07F090C7FCA2ED3FC0A41680
+157FD80F801400487E486C13FEA24A5A5D49485AEB8007391E000FE0001F495A260FC07F
+C7FC3803FFFE6C13F838003FC0243F7CBC2D>I<121EEA7F80A2EAFFC0A4EA7F80A2EA1E
+00C7FCB3121EEA7F80A2EAFFC0A4EA7F80A2EA1E000A2779A619>I<121EEA7F80A2EAFF
+C0A4EA7F80A2EA1E00C7FCB3121E127FEAFF80A213C0A4127F121E1200A412011380A312
+0313005A1206120E120C121C5A1230A20A3979A619>I<121EEA7F80A2EAFFC0A4EA7F80
+A2EA1E00C7FCA8120C121EAB123FACEA7F80ACEAFFC0A9EA7F80EA1E000A4179AC19>I<
+007FB912E0BA12F0A26C18E0CDFCAE007FB912E0BA12F0A26C18E03C167BA147>I<EB07
+80EB1FE0A2497EA46D5AA2EB078090C8FCA8130380A4130791C7FCA65BA3131EA2133E13
+3C137CA25B1201485A485A120F485A485A127FA248C7127C15FEEC01FFA480157F6C141E
+A26C6C133C1578390FC001E03907F00FC03901FFFE0038003FF020407BAC2B>I<EB1FF8
+90B5FC3903E01FC0390F0007F0001EEB03F848EB01FC4814FE140000FE14FF7E7FA46CC7
+FC123EC7EA01FEA2EC03FCEC07F815F0EC0FC0EC1F80EC3F00143E5C147814F85C13015C
+A2495AA25CAB91C7FC90C8FCA8EB0780EB1FE0A2497EA46D5AA2EB078020407BBF2B>I<
+ED7FE0913807FFFE91391F801F809139780001E0D901E0EB0078D90780141E49C87E011E
+6F7E0138ED01C0496F7E4916700001177848488249D93F80131C28070001FFF07F489026
+07E07C130F000E90260FC01E7F001E90263F00071480001C499038038003003C01FED901
+C013C0003849ECFE010101EC00FF267803F8027F13E000701700495AA200F018F000E018
+70495AA96D7E12F01270A26D7E007818E0263801FC5C01005C003C7F001C017F49EB01C0
+001E6DEB077F000E903B0FC01E3F8380000F903B07E07C1F87006C903A01FFF007FE3C03
+80003F8001F86D90CAFC6C7E120013707F011EEE03F06D160F6D6CED3FC0D901E0913801
+FE00D90078EC1FF0913A1F8003FF800207B500F8C7FC9126007FFEC8FC3C417BBF47>I<
+15074B7EA34B7EA34B7EA34B7EA34B7E15E7A2913801C7FC15C3A291380381FEA34AC67E
+A3020E6D7EA34A6D7EA34A6D7EA34A6D7EA34A6D7EA349486D7E91B6FCA2498191388000
+01A249C87EA24982010E157FA2011E82011C153FA2013C820138151FA2017882170F13FC
+00034C7ED80FFF4B7EB500F0010FB512F8A33D417DC044>I<B712FCEEFF8017F0000190
+3980000FF86C6CC7EA03FE707E701380EF7FC0EF3FE0A2EF1FF0A218F8A3170F171FA318
+F0A2EF3FE0177F18C0EFFF804C1300EE03FCEE0FF8EE7FE091B6C7FC17E091C7EA07FCEE
+01FE933800FF80EF7FC0EF3FE0EF1FF018F8170F18FC1707A218FEA718FC170FA2EF1FF8
+18F0173FEF7FE0EFFFC00403138048486C90380FFE00B85A17E094C7FC373E7DBD40>I<
+DB3FF01306912603FFFE130E020F9038FF801E913A3FF007E03E9139FF8000F8D903FEC7
+EA7C7ED907F8EC1EFE4948140FD93FE0140749481403495A91C812014848150012034848
+167E5B000F173EA24848161EA2123F5B180E127FA349160012FFAC127F7F180EA2123FA2
+7F001F171E181C6C7EA20007173C6D16386C6C1678000117706C6C16F06EEC01E06D6C15
+C06D6C1403D90FF0EC07806D6CEC1F00D903FE143E902600FF8013F891393FF007F0020F
+B512C0020391C7FC9138003FF037427BBF42>I<B712FCEEFF8017E000019039C0001FF8
+6C6C48EB03FEEE00FF717E717EEF0FE084717E717E170184717EA21980187F19C0A3F03F
+E0A519F0AB19E0A5F07FC0A21980A218FF19004D5AA24D5A6017074D5A4D5AEF7FC04DC7
+FCEE03FE48486CEB1FF8B85A178004FCC8FC3C3E7DBD45>I<B912E0A300019038C00001
+6C6C48EB001FEF0FF01703A217011700A31870A418381638A41800A21678A216F8150115
+0791B5FCA3EC8007150115001678A21638A2180EA3181C93C7FCA4183C1838A21878A318
+F8EF01F0A21707170F173F48486CEB03FFB912E0A3373E7DBD3E>I<B91280A300019038
+C000036C6C48EB007FEF1FC0170F1707A21703A31701A4EF00E0A21638A31800A31678A2
+16F81501150791B5FCA3EC8007150115001678A21638A693C8FCAF3801FFE0B612F0A333
+3E7DBD3B>I<DB3FE0130C912603FFFE131C021F9038FF803C913A7FF00FC07C9139FF00
+01F0D903FC90380078FC4948143DD91FE0141F4948140F4948140701FF15034890C8FC49
+1501485A000716005B000F177C5B001F173CA2485AA2181C127FA25B95C7FC12FFAB041F
+B512F0127FA26D9139000FFE00EF03FC123FA27F121FA26C7EA212077F12036C7E7F6C7F
+6D6C14076D7E6D6C140FD907F8141ED903FEEC3C7C902600FF80EBF83C913A7FF007F01C
+021FB5EAC00C020391C8FC9138003FF03C427BBF47>I<B6D8C01FB512F8A3000101E0C7
+383FFC0026007F80EC0FF0B3A691B7FCA30280C7120FB3A92601FFE0EC3FFCB6D8C01FB5
+12F8A33D3E7DBD44>I<B612F0A3C6EBF000EB3FC0B3B3B2EBFFF0B612F0A31C3E7EBD21>
+I<011FB512FCA3D9000713006E5A1401B3B3A6123FEA7F80EAFFC0A44A5A1380D87F005B
+007C130700385C003C495A6C495A6C495A2603E07EC7FC3800FFF8EB3FC026407CBD2F>
+I<B600C090387FFFFCA3000101E0C7000F138026007F80913807FE0018F818E0604D5A4D
+C7FC173E5F5F4C5A4C5A4C5A4C5A4CC8FC163E5E5E4B5A4B5AED07804B7E151F4B7E4B7E
+15FF913881EFF8913883C7FCEC878791388F03FE91389E01FF14BCDAF8007F4A6D7E5C4A
+6D7E4A6D7EA2707E707EA2707E707EA2707F717E84173F717E717EA2717E848419802601
+FFE04A13C0B600C090B6FCA3403E7DBD47>I<B612F8A3000101E0C9FC38007F80B3B0EF
+0380A517071800A45FA35FA25F5F5F4C5A160748486C133FB8FCA3313E7DBD39>I<B500
+C093B512C0A300016D4BEBE000D8007F1880D977F0ED03BFA3D973F8ED073FA3D971FC15
+0EA2D970FE151CA3027F1538A36E6C1470A36E6C14E0A26E6CEB01C0A36E6CEB0380A36E
+6CEB0700A26E6C130EA36E6C5BA3037F5BA26F6C5AA36F6C5AA392380FE1C0A3923807F3
+80A26FB4C7FCA36F5AA213F8486C6D5AD807FFEFFFE0B500F80178017FEBFFC0A34A3E7C
+BD53>I<B56C91B512F88080D8007F030713006EEC01FC6E6E5A1870EB77FCEB73FEA2EB
+71FF01707FA26E7E6E7EA26E7E6E7EA26E7E6E7EA26E7E6E7FA26F7E6F7EA26F7E6F7EA2
+6F7E6F7EA26F7E6F1380A2EE7FC0EE3FE0A2EE1FF0EE0FF8A2EE07FCEE03FEA2EE01FF70
+13F0A2177F173FA2171F170FA2170701F81503487ED807FF1501B500F81400A218703D3E
+7DBD44>I<ED7FE0913807FFFE91391FC03F8091397E0007E04948EB03F8D907F0EB00FE
+4948147F49486E7E49486E7E49C86C7E01FE6F7E00018349150300038348486F7EA24848
+6F7EA2001F188049167F003F18C0A3007F18E049163FA300FF18F0AC007F18E06D167FA4
+003F18C0A26C6CEEFF80A36C6C4B1300A26C6C4B5A00035F6D150700015F6C6C4B5A6D5E
+6D6C4A5A6D6C4A5A6D6C4AC7FC6D6C14FED901FCEB03F8D9007FEB0FE091391FC03F8091
+2607FFFEC8FC9138007FE03C427BBF47>I<B712F8EEFF8017E000019039C0003FF86C6C
+48EB07FCEE01FE707EEF7F80EF3FC018E0A2EF1FF0A218F8A818F0A2EF3FE0A218C0EF7F
+80EFFF004C5AEE07FCEE3FF091B612C04CC7FC0280C9FCB3A73801FFE0B612C0A3353E7D
+BD3E>I<ED7FE0913807FFFE91391FC03F8091397F000FE0D901FCEB03F8D907F0EB00FE
+4948147F49486E7E49486E7E49C86C7E498248486F7E49150300038348486F7EA2000F83
+4981001F1880A24848EE7FC0A3007F18E0A249163FA200FF18F0AC007F18E0A26D167FA3
+003F18C0A26C6CEEFF80A3000F18006D5D0007DA0F805B6C6C90393FE003FCED70706C6C
+496C485A6C6C48486C485A017FD9800E5BD93F819038061FC0D91FC19038073F80D90FE1
+4AC7FCD907F1EB03FE902601FDC013F8903A007EE007E091271FF03FC013180207B5FC91
+39007FE1E0DB0001143883711378A2706C13F0EFFF0318FFA27113E0A37113C071138071
+1300715AEF01F83D527BBF47>I<B712C016FCEEFF800001D9C00013E06C6C48EB1FF0EE
+07FCEE01FE707E84717EA2717EA284A760177F606017FF95C7FCEE01FCEE07F8EE1FE0EE
+FF8091B500FCC8FC16F091388001FCED003FEE1FC0707E707E83160383160183A383A484
+A4F0C004190EA28218E0057F131E2601FFE0161CB600C0EB3FF094381FF83805071370CA
+3801FFE09438003F803F407DBD43>I<D907FC131890391FFF8038017FEBE0783901FC03
+F83A03F0007CF8D807C0133F4848130F001F140748C7FC003E1403007E1401A2007C1400
+12FC1678A46C1538A27EA26C6C14007F7FEA3FF8EBFF806C13F86CEBFF806C14F06C14FC
+6C14FF6C15C0013F14E0010714F0EB007F020713F89138007FFC150FED07FE15031501ED
+00FFA200E0157FA3163FA27EA3163E7E167E6C157C6C15FC6C15F86D13016DEB03F06DEB
+07E0D8F9FCEB0FC03AF07F803F8090391FFFFE00D8E00713F839C0007FC028427BBF33>
+I<003FB91280A3903AF0007FE001018090393FC0003F48C7ED1FC0007E1707127C007817
+03A300701701A548EF00E0A5C81600B3B14B7E4B7E0107B612FEA33B3D7DBC42>I<B600
+C090B512F8A3000101E0C70007130026007F80EC01FC715A1870B3B3A4013F16F06E5DA2
+1701011F5E80010F15036E4A5A010793C7FC6D6C5C6D6C141E6D6C5C027F14F86E6C485A
+91390FF00FE00203B51280020049C8FCED1FF03D407DBD44>I<B691380FFFFEA3000301
+E0020113E06C01809138007F806CEF3F00017F163E181C6E153C013F1638A26E1578011F
+1670A26D6C5DA26E140101075EA26E140301035EA26D6C4AC7FCA2806D150EA26F131E02
+7F141CA26F133C023F1438A26E6C5BA26F13F0020F5CA2EDF80102075CA26E6C485AA2ED
+FE07020191C8FCA26F5A6E130EA2ED7F9CA216DCED3FF8A36F5AA36F5AA26F5AA36F5A3F
+407EBD44>I<B500FE017FB5D88007B5FCA3000301C0010101E0C713F86C90C849EC3FE0
+7148EC0F807E7215006E143F017F190E84A26D6C60A24D7E6D6C60A2EFE7F86D6C60A293
+3801C3FC6E18F001076104037F6E0281140101036104077F17006D6C4D5AA2040EEB7F80
+6D6C4DC7FCA24CEB3FC0DA7F80160EA24CEB1FE003C0161E023F171C047814F0DBE07001
+0F133C021F173804F014F84C1307DA0FF05EA2DBF1C0EB03FCDA07F95EA2DBFB80EB01FE
+DA03FF6F5AA293C8FCA26E5FA24B157F020094C8FCA24B81037C153EA20378151E033815
+1C58407EBD5D>I<007FB5D8C003B512E0A3C649C7EBFC00D93FF8EC3FE06D48EC1F806D
+6C92C7FC171E6D6C141C6D6C143C5F6D6C14706D6D13F04C5ADA7FC05B023F13036F485A
+DA1FF090C8FC020F5BEDF81E913807FC1C163C6E6C5A913801FF7016F06E5B6F5AA26F7E
+6F7EA28282153FED3BFEED71FF15F103E07F913801C07F0203804B6C7EEC07004A6D7E02
+0E6D7E5C023C6D7E02386D7E14784A6D7E4A6D7F130149486E7E4A6E7E130749C86C7E49
+6F7E497ED9FFC04A7E00076DEC7FFFB500FC0103B512FEA33F3E7EBD44>I<B66C0103B5
+1280A3000101F0C8EBF8006C6C48ED3FC0725A013F041EC7FC6D7E606D6C15386D6C1578
+606D6C5D6E14016D5E6D6D1303606E6C49C8FC6E6C5B170E6E6C131E171C6E6C5B6E6C13
+7817706E6C13F06F5B6E13016EEB83C05FED7FC7DB3FE7C9FC16EFED1FFE5E150F6F5AB3
+A4ED1FFC020FB512FCA3413E7FBD44>I<003FB712F8A391C7EA1FF013F801E0EC3FE001
+80EC7FC090C8FC003EEDFF80A2003C4A1300007C4A5A12784B5A4B5AA200704A5AA24B5A
+4B5AA2C8485A4A90C7FCA24A5A4A5AA24A5AA24A5A4A5AA24A5A4A5AA24990C8FCA2495A
+4948141CA2495A495AA2495A495A173C495AA24890C8FC485A1778485A484815F8A24848
+140116034848140F4848143FED01FFB8FCA32E3E7BBD38>I<486C13C000031301010013
+80481303000EEB070048130E0018130C0038131C003013180070133800601330A300E013
+70481360A400CFEB678039FFC07FE001E013F0A3007F133FA2003F131F01C013E0390F00
+07801C1C73BE2D>92 D<EA0180120313005A120E5A12181238123012701260A312E05AA4
+12CFEAFFC013E0A3127FA2123F13C0EA0F000B1C7ABE19>96 D<EB0FF8EBFFFE3903F01F
+8039078007E0000F6D7E9038E001F8D81FF07F6E7EA3157F6C5AEA0380C8FCA4EC1FFF01
+03B5FC90381FF87FEB7F803801FC00EA07F8EA0FE0485A485AA248C7FCEE038012FEA315
+FFA3007F5BEC03BF3B3F80071F8700261FC00E13CF3A07F03C0FFE3A01FFF807FC3A003F
+C001F0292A7DA82D>I<EA01FC12FFA3120712031201B1EC03FC91381FFF8091387C07E0
+9039FDE001F09039FFC000FC4A137E91C77E49158049141F17C0EE0FE0A217F0A2160717
+F8AA17F0A2160FA217E0161F17C06D1580EE3F006D5C6E13FE9039F3C001F89039F1E003
+F09039E0780FC09026C03FFFC7FCC7EA07F82D407EBE33>I<49B4FC010F13E090383F00
+F8017C131E4848131F4848137F0007ECFF80485A5B121FA24848EB7F00151C007F91C7FC
+A290C9FC5AAB6C7EA3003FEC01C07F001F140316806C6C13076C6C14000003140E6C6C13
+1E6C6C137890383F01F090380FFFC0D901FEC7FC222A7DA828>I<ED01FC15FFA3150715
+031501B114FF010713E190381F80F990387E003D49131FD803F81307485A491303484813
+01121F123F5B127FA290C7FCA25AAA7E7FA2123FA26C7E000F14037F000714076C6C497E
+6C6C497ED8007C017913F890383F01F190380FFFC1903A01FE01FC002D407DBE33>I<EB
+01FE90380FFFC090383F03F09038FC01F848486C7E4848137E48487F000F158049131F00
+1F15C04848130FA2127F16E090C7FCA25AA290B6FCA290C9FCA67EA27F123F16E06C7E15
+01000F15C06C6C13036DEB07806C6C1400C66C131E017E5B90381F80F8903807FFE00100
+90C7FC232A7EA828>I<EC1FC0EC7FF8903801F83C903807E07E90380FC0FFEB1FC1EB3F
+811401137FEC00FE01FE137C1500AEB6FCA3C648C7FCB3AE487E007F13FFA320407EBF1C
+>I<167C903903F801FF903A1FFF078F8090397E0FDE1F9038F803F83803F001A23B07E0
+00FC0600000F6EC7FC49137E001F147FA8000F147E6D13FE00075C6C6C485AA23901F803
+E03903FE0FC026071FFFC8FCEB03F80006CAFC120EA3120FA27F7F6CB512E015FE6C6E7E
+6C15E06C810003813A0FC0001FFC48C7EA01FE003E140048157E825A82A46C5D007C153E
+007E157E6C5D6C6C495A6C6C495AD803F0EB0FC0D800FE017FC7FC90383FFFFC010313C0
+293D7EA82D>I<EA01FC12FFA3120712031201B1EC01FE913807FFC091381E07E0913878
+03F09138E001F8D9FDC07F148001FF6D7E91C7FCA25BA25BB3A6486C497EB5D8F87F13FC
+A32E3F7DBE33>I<EA01E0EA07F8A2487EA46C5AA2EA01E0C8FCACEA01FC127FA3120712
+031201B3AC487EB512F0A3143E7DBD1A>I<1478EB01FEA2EB03FFA4EB01FEA2EB007814
+00AC147FEB7FFFA313017F147FB3B3A5123E127F38FF807E14FEA214FCEB81F8EA7F0138
+7C03F0381E07C0380FFF803801FC00185185BD1C>I<EA01FC12FFA3120712031201B292
+B51280A392383FFC0016E0168093C7FC153C5D5D4A5AEC07C04A5A4AC8FC143E147F4A7E
+13FD9038FFDFC0EC9FE0140F496C7E01FC7F496C7E1401816E7E81826F7E151F826F7EA2
+82486C14FEB539F07FFFE0A32B3F7EBE30>I<EA01FC12FFA3120712031201B3B3B1487E
+B512F8A3153F7DBE1A>I<2701F801FE14FF00FF902707FFC00313E0913B1E07E00F03F0
+913B7803F03C01F80007903BE001F87000FC2603F9C06D487F000101805C01FBD900FF14
+7F91C75B13FF4992C7FCA2495CB3A6486C496CECFF80B5D8F87FD9FC3F13FEA347287DA7
+4C>I<3901F801FE00FF903807FFC091381E07E091387803F000079038E001F82603F9C0
+7F0001138001FB6D7E91C7FC13FF5BA25BB3A6486C497EB5D8F87F13FCA32E287DA733>
+I<14FF010713E090381F81F890387E007E01F8131F4848EB0F804848EB07C04848EB03E0
+000F15F04848EB01F8A2003F15FCA248C812FEA44815FFA96C15FEA36C6CEB01FCA3001F
+15F86C6CEB03F0A26C6CEB07E06C6CEB0FC06C6CEB1F80D8007EEB7E0090383F81FC9038
+0FFFF0010090C7FC282A7EA82D>I<3901FC03FC00FF90381FFF8091387C0FE09039FDE0
+03F03A07FFC001FC6C496C7E6C90C7127F49EC3F805BEE1FC017E0A2EE0FF0A3EE07F8AA
+EE0FF0A4EE1FE0A2EE3FC06D1580EE7F007F6E13FE9138C001F89039FDE007F09039FC78
+0FC0DA3FFFC7FCEC07F891C9FCAD487EB512F8A32D3A7EA733>I<02FF131C0107EBC03C
+90381F80F090397F00387C01FC131CD803F8130E4848EB0FFC150748481303121F485A15
+01485AA448C7FCAA6C7EA36C7EA2001F14036C7E15076C6C130F6C7E6C6C133DD8007E13
+7990383F81F190380FFFC1903801FE0190C7FCAD4B7E92B512F8A32D3A7DA730>I<3901
+F807E000FFEB1FF8EC787CECE1FE3807F9C100031381EA01FB1401EC00FC01FF13304913
+00A35BB3A5487EB512FEA31F287EA724>I<90383FC0603901FFF8E03807C03F381F000F
+003E1307003C1303127C0078130112F81400A27E7E7E6D1300EA7FF8EBFFC06C13F86C13
+FE6C7F6C1480000114C0D8003F13E0010313F0EB001FEC0FF800E01303A214017E1400A2
+7E15F07E14016C14E06CEB03C0903880078039F3E01F0038E0FFFC38C01FE01D2A7DA824
+>I<131CA6133CA4137CA213FCA2120112031207001FB512C0B6FCA2D801FCC7FCB3A215
+E0A912009038FE01C0A2EB7F03013F138090381F8700EB07FEEB01F81B397EB723>I<D8
+01FC14FE00FF147FA3000714030003140100011400B3A51501A31503120015076DEB06FF
+017E010E13806D4913FC90381FC078903807FFE00100903880FE002E297DA733>I<B539
+E00FFFE0A32707FE000313006C48EB00FC5E00015D7F00005DA26D13016D5CA26D6C485A
+A2ECC007011F91C7FCA290380FE00EA2ECF01E0107131CA26D6C5AA2ECFC7801011370A2
+ECFEF001005BA2EC7FC0A36E5AA26EC8FCA3140E2B287EA630>I<B53BC3FFFE03FFF8A3
+290FFE003FE00013C06C486D48EB3F806C4817006D010F141E00016F131C15076D163C00
+004A6C1338A2017F5E4B7E151DD93F805DED3DFC1538D91FC04A5AED78FE9238707E03D9
+0FE0017F5BEDE03F02F0140701070387C7FC9138F1C01F02F9148F010315CE9138FB800F
+02FF14DE6D15FCED00076D5DA24A1303027E5CA2027C1301023C5C023813003D287EA642
+>I<B539F01FFFE0A30003D9C00F1300C690388007F8D97F0013E002805BD93FC05B011F
+49C7FC90380FE00EECF01E6D6C5A01035B6D6C5A6E5AEB00FF6E5A6E5A81141F814A7E81
+147BECF1FC903801E1FEECC0FF01037F49486C7ED90F007F011E6D7E013E130F496D7E01
+FC80486C80000F4A7EB539803FFFF8A32D277FA630>I<B539E00FFFE0A32707FE000313
+006C48EB01FC6F5A00015D7F00005DA2017F495AA2EC8003013F5CA26D6C48C7FCA26E5A
+010F130EA26D6C5AA2ECF83C01031338A26D6C5AA2ECFEF001005BA2EC7FC0A36E5AA36E
+C8FCA2140EA2141E141C143C1438A2147800181370127EB45BA2495AA248485AD87E07C9
+FCEA780EEA3C3CEA1FF8EA07E02B3A7EA630>I<001FB61280A2EBE0000180140049485A
+001E495A121C4A5A003C495A141F00385C4A5A147F5D4AC7FCC6485AA2495A495A130F5C
+495A90393FC00380A2EB7F80EBFF005A5B484813071207491400485A48485BA248485B48
+48137F00FF495A90B6FCA221277EA628>I<B812F0A22C0280982D>I<BE12C0A25A028098
+5B>I E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fk cmbxti10 10.95 5
+/Fk 5 117 df<EB0F80EB3FE0EB7FF013FF5AA25AA314E0A26C13C06C1380EB7E0090C7
+FCACEA07E0EA1FF0487E487EA212FFA35BA25B5B6C5A001FC7FC142875A720>58
+D<49B500F8021FB512E0496E4A14F0A27017E06D83D900016D9139003FE000F21F804A6E
+143F98C7FC83A2DA07F76D5C1A7E03E37FA2DA0FE16D14FE6203C07FA2021F6D6C130162
+4B6C7EA2023F6DEB8003624B6C13C0A24A6DEBE00762027E6D13F0A202FE6DEBF80F624A
+6D13FCA2010192387FFE1F624AEC3FFFA201036F13BF97C8FC4A6E13FFA2010781614A80
+A2010F81614A80A2011F167F614A153FA2013F161F017F5F007FB56C140FB6FC18076192
+C81203543E7ABD51>78 D<EC07FE91387FFF8049B512E0010714F049EB07F890383FF801
+D97FE013FC9038FFC000485B4890C7FC4814014914F8120F491303001FEC07F0ED1FE048
+48EBFFC001F9B5128090B612004814FC15C091C8FC13F0A25B12FFA2127FA31630167816
+FC003F1401ED03F86C6CEB0FF06C6CEB7FE03A07FE03FFC06CB612006C14FC6C6C13F001
+0F90C7FC262A77A830>101 D<913803FF80023F13F091B512FC010380010FEB03FF9026
+1FF80013804948EB7FC0D97FC0EB3FE0495A4816F04890C7FC4848141F000F16F849143F
+121FA2485AA2167F007F16F05BA216FF00FF16E05BA24B13C0A21780495B007F16006D49
+5A4B5A003F5D4B5A6C6CEB7FE06C6C495A2607FE075B6CB548C7FC6C14F86C6C13E0D90F
+FEC8FC2D2A77A836>111 D<147C14FE1301497E5BA25CA2130FA25CA2131FA25CA2133F
+A25C007FB512F0B612F815F0A27EC6EBE000A25CA25AA25CA25AA291C7FCA25AA25BA212
+0FA25BA2001F14F0140113F8140315E0003F130701F013C0140FEC1F80001FEB3F00147E
+EBF1FC6CB45A6C5B00015B6C6CC7FC1D3C78BA23>116 D E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fl cmbx12 14.4 44
+/Fl 44 122 df<B712F0AB240B7F9F2D>45 D<EF01E01703EF07F0A2170FA2EF1FE0A218
+C0173FA2EF7F80A218005FA24C5AA25F1603A24C5AA25F160FA24C5AA25F163FA24C5AA2
+94C7FC5EA24B5AA25E1503A24B5AA25E150FA24B5AA25E153FA24B5AA293C8FC5DA24A5A
+A25D1403A25D1407A24A5AA25D141FA24A5AA25D147FA24AC9FCA25C1301A2495AA25C13
+07A2495AA25C131FA2495AA25C137FA249CAFCA25B1201A2485AA25B1207A2485AA25B12
+1FA2485AA25B127FA248CBFCA25AA2127CA2347879D943>47 D<157815FC14031407141F
+14FF130F0007B5FCB6FCA2147F13F0EAF800C7FCB3B3B3A6007FB712FEA52F4E76CD43>
+49 D<EC3FFE0103B512E0010F14FC013F14FF90B712C048D9C07F7F2703FE000F13F8D8
+07F801037FD80FE06D7F48486D7F48488001F01680486C6E13C07F486C6E13E07FA27013
+F0A56C5AA26C5AEA0FF0EA03C0C914E05EA218C05E1880A24C13005F4C5A4B5B5F4B5B5F
+4B5B4B90C7FC4B5A5E4B5AED7FE04B5A4A5B4A48C8FC4A5A5D4A48EB01F04A5AEC3F804A
+C7FC02FEEC03E0495A495A495A495AD91F80140749C8FC013E150F017FB7FC90B812C05A
+5A5A5A5A5A5AB9FC1880A4344E79CD43>I<91380FFFC091B512FC0107ECFF80011F15E0
+90263FF8077F9026FF800113FC4848C76C7ED803F86E7E491680D807FC8048B416C08048
+6D15E0A4805CA36C17C06C5B6C90C75AD801FC1680C9FC4C13005FA24C5A4B5B4B5B4B13
+C04B5BDBFFFEC7FC91B512F816E016FCEEFF80DA000713E0030113F89238007FFE707E70
+13807013C018E07013F0A218F8A27013FCA218FEA2EA03E0EA0FF8487E487E487EB57EA3
+18FCA25E18F891C7FC6C17F0495C6C4816E001F04A13C06C484A1380D80FF84A13006CB4
+4A5A6CD9F0075BC690B612F06D5D011F1580010302FCC7FCD9001F1380374F7ACD43>I<
+177C17FEA2160116031607160FA2161F163F167FA216FF5D5DA25D5DED1FBFED3F3F153E
+157C15FCEC01F815F0EC03E01407EC0FC01580EC1F005C147E147C5C1301495A495A5C49
+5A131F49C7FC133E5B13FC485A5B485A1207485A485A90C8FC123E127E5ABA12C0A5C96C
+48C7FCAF020FB712C0A53A4F7CCE43>I<D80380150ED807E0157E01FEEC03FED9FFF013
+7F91B65A5F5F5F5F5F94C7FC5E5E16F016C093C8FC15F801E190C9FC01E0CAFCABEC0FFF
+027F13F001E3B512FE01E76E7E9026FFF8077FDAC0017F49C713F8496E7E49143F498149
+6E7E6C481680C9FC18C08218E0A418F0A3EA0FE0487E487E487E487EA418E0A35B6C484A
+13C05B491680003EC85A003F17006C6C4A5A6D5D6C6C4A5AD807F8495BD803FE01075B27
+01FFC03F5B6C90B65A013F4AC7FC6D14F8010314C09026007FF8C8FC344F79CD43>I<ED
+0FFF92B512E0020780021F14FC91397FFE03FE903A01FFF0007F4901C0EB3F804990C712
+1F4948EC7FC0494814FF49484913E049485B01FF5C485BA2485B5AA2486F13C04A6D1380
+486F1300177E94C7FC5AA291CAFC5AA21508913801FFF8020713FFB54814C04A14F04AC6
+6C7E023C6D7E4A6D7E4A6D7E7013804A15C0A24A15E07013F05C18F8A491C714FCA37EA6
+7EA46C17F880A27E18F06C5D18E06C6D15C07E6E4913806C6D15006D6C495A6D6CEB7FFC
+6DB448485A6D90B55A010315C0010092C7FC023F13FC020713C0364F7ACD43>I<121F7F
+7FEBFF8091B81280A45A1900606060A2606060485F0180C86CC7FC007EC95A4C5A007C4B
+5A5F4C5A160F4C5A484B5A4C5A94C8FC16FEC812014B5A5E4B5A150F4B5AA24B5AA24B5A
+15FFA24A90C9FCA25C5D1407A2140FA25D141FA2143FA4147F5DA314FFA55BAC6D5BA2EC
+3FC06E5A395279D043>I<913807FFC0027F13FC0103B67E010F15E090261FFC0113F890
+3A3FE0003FFCD97F80EB0FFE49C76C7E48488048486E1380000717C04980120F18E0177F
+A2121F7FA27F7F6E14FF02E015C014F802FE4913806C7FDBC00313009238F007FE6C02F8
+5B9238FE1FF86C9138FFBFF06CEDFFE017806C4BC7FC6D806D81010F15E06D81010115FC
+010781011F81491680EBFFE748018115C048D9007F14E04848011F14F048487F48481303
+030014F8484880161F4848020713FC1601824848157F173FA2171FA2170FA218F8A27F00
+7F17F06D151FA26C6CED3FE0001F17C06D157F6C6CEDFF806C6C6C010313006C01E0EB0F
+FE6C01FCEBFFFC6C6CB612F06D5D010F1580010102FCC7FCD9000F13C0364F7ACD43>I<
+171F4D7E4D7EA24D7EA34C7FA24C7FA34C7FA34C7FA24C7FA34C8083047F80167E8304FE
+804C7E03018116F8830303814C7E03078116E083030F814C7E031F81168083033F8293C7
+7E4B82157E8403FE824B800201835D840203834B800207835D844AB87EA24A83A3DA3F80
+C88092C97E4A84A2027E8202FE844A82010185A24A820103854A82010785A24A82010F85
+5C011F717FEBFFFCB600F8020FB712E0A55B547BD366>65 D<BA12C019FEF1FFC01AF01A
+FCD8000701F0C7000313FFDE007F7F737F070F7F737F878587858785A287A84F5BA26361
+6361634F5B4F5B077F90C7FC4E485A060713F892B812E097C8FC861AF003F0C7000313FE
+9539003FFF80070F13E0737F07017F87737F747E1C807413C0A27413E0A31CF0A386A362
+A31CE0A2621CC0A250138097B5FC1C004F5B19074F5B073F13F04EB55ABC128098C7FC1A
+F81AC007F8C8FC54527CD160>I<932601FFFCEC01C0047FD9FFC013030307B600F81307
+033F03FE131F92B8EA803F0203DAE003EBC07F020F01FCC7383FF0FF023F01E0EC0FF94A
+01800203B5FC494848C9FC4901F8824949824949824949824949824990CA7E494883A248
+4983485B1B7F485B481A3FA24849181FA3485B1B0FA25AA298C7FC5CA2B5FCAE7EA280A2
+F307C07EA36C7FA21B0F6C6D1980A26C1A1F6C7F1C006C6D606C6D187EA26D6C606D6D4C
+5A6D6D16036D6D4C5A6D6D4C5A6D01FC4C5A6D6DEE7F806D6C6C6C4BC7FC6E01E0EC07FE
+020F01FEEC1FF80203903AFFE001FFF0020091B612C0033F93C8FC030715FCDB007F14E0
+040101FCC9FC525479D261>I<BA7E19FCF1FF801AF01AFCD8000701F0C7000F13FF0600
+14C0071F7F070713F807017F737F747E747F747F86747F747F8886888688A2757EA31D80
+87A21DC0A51DE0A387A963A31DC0A51D80A2631D00A3515AA2646264505B6264505B505B
+5090C7FCF2FFFE4F5B07075B071F5B96B512C0060F91C8FCBB5A1AF01AC007FCC9FC1980
+5B527CD167>I<BC1280A5D8000701F8C7000114C0F0001F19071901851A7F1A3F1A1FA2
+F20FE0A21A07A31A03A318F81BF01A01A497C7FC1701A317031707170F177F92B6FCA592
+38F8007F170F170717031701A317001B3EA31B7CA395C8FCA21BFCA21BF8A21A01A31A03
+1BF01A071A0FA21A1F1A3FF27FE0F101FF1907191F0603B5FCBCFCA21BC0A34F517CD058
+>I<BB12FEA5D8000701F8C700077FF0007F191F190785858586861B80A21A1FA31A0FA4
+1BC006F81307A497C7FCA31701A317031707170F177F92B6FCA59238F8007F170F170717
+031701A31700A795C9FCB3B812F8A54A517CD055>I<B812C0A5D8000701F8C7FCB3B3B3
+B2B812C0A52A527CD132>73 D<B600FC073FB512FE6F61A26F96B6FCA2D80007F5C00070
+EF01EFA202EF6DEF03CFA202E76DEF078FA202E36DEF0F0FA202E16D171EA302E06D173C
+A26F6C1778A26F6C17F0A26F6DED01E0A26F6DED03C0A36F6DED0780A26F6DED0F00A26F
+6D151EA26F6D5DA3706C5DA2706C5DA2706D495AA2706D495AA2706D495AA3706D49C7FC
+A2706D131EA2706D5BA2716C5BA3716C5BA271EB81E0A271EBC3C0A271EBE780A27101FF
+C8FCA3715BA2715BA2725AA2725AA2D93FFC6F5AB74DB712FEA2725AA2725A77527CD180
+>77 D<93380FFFC00303B6FC031F15E092B712FC0203D9FC0013FF020F01C0010F13C002
+3F90C7000313F0DA7FFC02007F494848ED7FFE4901E0ED1FFF49496F7F49496F7F4990C9
+6C7F49854948707F4948707FA24849717E48864A83481B804A83481BC0A2481BE04A83A2
+481BF0A348497113F8A5B51AFCAF6C1BF86E5FA46C1BF0A26E5F6C1BE0A36C6D4D13C0A2
+6C6D4D1380A26C1B006C6D4D5A6E5E6C626D6C4C5B6D6D4B5B6D6D4B5B6D6D4B5B6D6D4B
+5B6D6D4B90C7FC6D6D4B5A6D01FF02035B023F01E0011F13F0020F01FC90B512C0020390
+B7C8FC020016FC031F15E0030392C9FCDB001F13E0565479D265>79
+D<BAFC19F819FF1AE086D8000701F0C7001F13FC060113FF726C13807313C0070F13E01B
+F0857313F81BFCA27313FEA41BFFA81BFEA31BFC61A21BF84F13F04F13E0614F13C04F13
+004E485A061F5B92B812F01AC04FC7FC19E003F8CBFCB3AEB812C0A550527CD15C>I<B9
+12F0F0FF8019F819FF1AC0D8000701F0C714F0060F7F060113FE727F737F737F85737F87
+A2737FA387A863A2616363A24F5B4F5B4F90C8FC4F5A06035B060F13F095B512C092B8C9
+FC19F819E019F89226F0000313FE9439007FFF80727F727F727F727F727F8684A28684A7
+87A71D1C75133EA38575137E73157C7513FC731401B86C6D9038F803F807039038FE07F0
+7390B512E0736C14C0080F1400CEEA7FFC5F537CD164>82 D<91260FFF80130791B500F8
+5B010702FF5B011FEDC03F49EDF07F9026FFFC006D5A4801E0EB0FFD4801800101B5FC48
+48C87E48488149150F001F824981123F4981007F82A28412FF84A27FA26D82A27F7F6D93
+C7FC14C06C13F014FF15F86CECFF8016FC6CEDFFC017F06C16FC6C16FF6C17C06C836C83
+6D826D82010F821303010082021F16801400030F15C0ED007F040714E01600173F050F13
+F08383A200788200F882A3187FA27EA219E07EA26CEFFFC0A27F6D4B13806D17006D5D01
+FC4B5A01FF4B5A02C04A5A02F8EC7FF0903B1FFFC003FFE0486C90B65AD8FC0393C7FC48
+C66C14FC48010F14F048D9007F90C8FC3C5479D24B>I<003FBC1280A59126C0003F9038
+C0007F49C71607D87FF8060113C001E08449197F49193F90C8171FA2007E1A0FA3007C1A
+07A500FC1BE0481A03A6C994C7FCB3B3AC91B912F0A553517BD05E>I<EC7FFF0107B512
+F0013F14FE90B77E48D9E00F7F2703FE000113F0486C6D7F6EEB3FFC48826E131F83707F
+A36C496D7FA26C90C7FC6C5AC9FCA6037FB5FC020FB6FC91B7FC01071487013FEBF00749
+13803901FFFC004813F0485B485B485B4890C7FC5A5BA2485AA45EA26D5C007F151D163D
+6C6C02797F6C6D01F113F86C9026C003E1EBFFE06C9026F81FC014F06C90B5487EC6ED00
+1F011F01FC010713E0010101E090C8FC3C387CB641>97 D<EB3FF0B5FCA51203C6FCB3A4
+923801FFE0030F13FE033FEBFFC092B612F002F301017F913AF7F8003FFEDAFFE0EB0FFF
+03806D7F92C76C7F4A6E7F4A824A6E7FA2727EA285A28584A31A80AC1A00A44E5AA36118
+FF616E4A5BA26E4A5B6E4A5B6F495BDACFC04990C7FCDA87F0EB7FFC913A03FE03FFF849
+C6B612E0496D148049011F01FCC8FC90C7000313C041547BD24B>I<913801FFF8021FEB
+FF8091B612F0010315FC010F9038C00FFE903A1FFE0001FFD97FFC491380D9FFF05B4817
+C048495B5C5A485BA2486F138091C7FC486F1300705A4892C8FC5BA312FFAD127F7FA27E
+A2EF03E06C7F17076C6D15C07E6E140F6CEE1F806C6DEC3F006C6D147ED97FFE5C6D6CEB
+03F8010F9038E01FF0010390B55A01001580023F49C7FC020113E033387CB63C>I<4DB4
+7E0407B5FCA5EE001F1707B3A4913801FFE0021F13FC91B6FC010315C7010F9038E03FE7
+4990380007F7D97FFC0101B5FC49487F4849143F484980485B83485B5A91C8FC5AA3485A
+A412FFAC127FA36C7EA37EA26C7F5F6C6D5C7E6C6D5C6C6D49B5FC6D6C4914E0D93FFED9
+0FEFEBFF80903A0FFFC07FCF6D90B5128F0101ECFE0FD9003F13F8020301C049C7FC4154
+7CD24B>I<913803FFC0023F13FC49B6FC010715C04901817F903A3FFC007FF849486D7E
+49486D7E4849130F48496D7E48178048497F18C0488191C7FC4817E0A248815B18F0A212
+FFA490B8FCA318E049CAFCA6127FA27F7EA218E06CEE01F06E14037E6C6DEC07E0A26C6D
+EC0FC06C6D141F6C6DEC3F806D6CECFF00D91FFEEB03FE903A0FFFC03FF8010390B55A01
+0015C0021F49C7FC020113F034387CB63D>I<ED3FFC0203B5FC020F14C0023F14E09139
+FFF81FF0499038C03FF849EB807F49903800FFFC495A495AA2495AA2EE7FF8495AEE3FF0
+EE0FC093C7FCAEB712E0A526007FF8C8FCB3B3A7007FB512FEA52E547CD329>I<DA3FFF
+14FF0103B5D8F00713C0010FDAFC1F13E0013FECFF7F90267FFC0F9038FF9FF09026FFE0
+01EBF83F48496C13E0484990387FF01F4890C7D83FF813E0489338FC0FC0F0078048486E
+6CC7FCA2003F82A9001F5EA26C6C4A5AA26C5E6C6D495A6C6D495A6C6D485BDAFC0F5B48
+90B6C8FCD803EF14FC01C314F02607C03F90C9FC91CBFCA2120FA37FA213F813FE90B7FC
+6C16F817FF18C06C836C836C836D828448B9FC12074848C700031480D81FF8EC003F4848
+150748486F13C083485A83A56D5D007F18806D5D003F18006C6C4B5AD80FFEED1FFC6C6C
+6CEC7FF86C01E049485A6C01FE011F5B6C6CB71280010F03FCC7FC010115E0D9000F01FC
+C8FC3C4F7CB543>I<EB3FF0B5FCA51203C6FCB3A4EE1FFC93B512C0030314F0030F8092
+391FE07FFC92393F001FFE037C8003F07FDAF1E081ECF3C0DAF7807F8502FFC7FC5CA25C
+A45CB3ACB6D8F807B612C0A542537BD24B>I<137F497E000313E0487FA2487FA76C5BA2
+6C5BC613806DC7FC90C8FCADEB3FF0B5FCA512017EB3B3A6B612E0A51B547BD325>I<EB
+3FF0B5FCA512017EB3B3B3B1B612F0A51C537BD225>108 D<D93FF0D91FFCEDFFE0B591
+B500C0010713FE030302F0011F6D7E030F6E017F8092271FE07FFCD9FF037F922A3F001F
+FE01F8007F0003027C9126FF03E080C602F06DD90780137FDAF1E0038FC77FDAF3C0159E
+DAF7806D01BC143F07FC8102FFC75C4A5EA24A5EA44A5EB3ACB6D8F807B6D8C03FB512FE
+A567367BB570>I<D93FF0EB1FFCB591B512C0030314F0030F8092391FE07FFC92393F00
+1FFE0003027C80C602F07FDAF1E081ECF3C0DAF7807F8502FFC7FC5CA25CA45CB3ACB6D8
+F807B612C0A542367BB54B>I<913801FFE0021F13FE91B612C0010315F0010F9038807F
+FC903A1FFC000FFED97FF86D6C7E49486D7F48496D7F48496D7F4A147F48834890C86C7E
+A24883A248486F7EA3007F1880A400FF18C0AC007F1880A3003F18006D5DA26C5FA26C5F
+6E147F6C5F6C6D4A5A6C6D495B6C6D495B6D6C495BD93FFE011F90C7FC903A0FFF807FFC
+6D90B55A010015C0023F91C8FC020113E03A387CB643>I<903A3FF001FFE0B5010F13FE
+033FEBFFC092B612F002F301017F913AF7F8007FFE0003D9FFE0EB1FFFC602806D7F92C7
+6C7F4A824A6E7F4A6E7FA2717FA285187F85A4721380AC1A0060A36118FFA2615F616E4A
+5BA26E4A5B6E4A5B6F495B6F4990C7FC03F0EBFFFC9126FBFE075B02F8B612E06F148003
+1F01FCC8FC030313C092CBFCB1B612F8A5414D7BB54B>I<912601FFE0EB0780021F01F8
+130F91B500FE131F0103ECFF80010F9039F03FC03F499039800FE07F903A7FFE0003F049
+48903801F8FF4849EB00FD4849147F4A805A4849805A4A805AA291C87E5AA35B12FFAC6C
+7EA37EA2806C5EA26C6D5CA26C6D5C6C6D5C6C93B5FC6C6D5B6D6C5B6DB4EB0FEF010F90
+38C07FCF6D90B5120F010114FED9003F13F80203138091C8FCB1040FB61280A5414D7CB5
+47>I<90397FE003FEB590380FFF80033F13E04B13F09238FE1FF89139E1F83FFC0003D9
+E3E013FEC6ECC07FECE78014EF150014EE02FEEB3FFC5CEE1FF8EE0FF04A90C7FCA55CB3
+AAB612FCA52F367CB537>I<903903FFF00F013FEBFE1F90B7FC120348EB003FD80FF813
+07D81FE0130148487F4980127F90C87EA24881A27FA27F01F091C7FC13FCEBFFC06C13FF
+15F86C14FF16C06C15F06C816C816C81C681013F1580010F15C01300020714E0EC003F03
+0713F015010078EC007F00F8153F161F7E160FA27E17E07E6D141F17C07F6DEC3F8001F8
+EC7F0001FEEB01FE9039FFC00FFC6DB55AD8FC1F14E0D8F807148048C601F8C7FC2C387C
+B635>I<143EA6147EA414FEA21301A313031307A2130F131F133F13FF5A000F90B6FCB8
+FCA426003FFEC8FCB3A9EE07C0AB011FEC0F8080A26DEC1F0015806DEBC03E6DEBF0FC6D
+EBFFF86D6C5B021F5B020313802A4D7ECB34>I<D93FF8913801FFC0B50207B5FCA50003
+ED001FC61607B3AE5FA35FA2017F5D173B177B6D6C14F3DC01E313F06D6CD907C3EBFFC0
+903A0FFFC03F836D90B51203010114FE6D6C13F8020701E091C7FC42377BB54B>I<007F
+B500F090387FFFFEA5C66C48C7000F90C7FC6D6CEC07F86D6D5C6D6D495A6D4B5A6F495A
+6D6D91C8FC6D6D137E6D6D5B91387FFE014C5A6E6C485A6EEB8FE06EEBCFC06EEBFF806E
+91C9FCA26E5B6E5B6F7E6F7EA26F7F834B7F4B7F92B5FCDA01FD7F03F87F4A486C7E4A48
+6C7E020F7FDA1FC0804A486C7F4A486C7F02FE6D7F4A6D7F495A49486D7F01076F7E4948
+6E7E49486E7FEBFFF0B500FE49B612C0A542357EB447>120 D<B600F00107B5FCA5C601
+F8C8EA7FE06EED3F00A26D6C153E187E013F167C6E15FC6D5E6F13016D5E6F13036D5E81
+17076D6D5C170F6D6D5C171F6D93C7FC6F5B027F143E6F137E023F147C6F13FCA26E6D5A
+16816EEBC1F016C36E5C16E76E5C16FF6E5CA26E91C8FCA36F5AA26F5AA26F5AA26F5AA2
+6F5AA35E150F5E151F93C9FC5DD81FC0133E486C137E486C137C486C13FC5D14015D1403
+4A5A6C48485A49485A263FC07FCAFCEB81FE6CB45A6C13F000035BC690CBFC404D7DB447
+>I E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fm cmr12 12 34
+/Fm 34 123 df<121EEA7F8012FF13C0A213E0A3127FEA1E601200A413E013C0A3120113
+80120313005A1206120E5A5A5A12600B1D78891B>44 D<121EEA7F80A2EAFFC0A4EA7F80
+A2EA1E000A0A78891B>46 D<14FF010713E090381F81F890383E007C01FC133F4848EB1F
+8049130F4848EB07C04848EB03E0A2000F15F0491301001F15F8A2003F15FCA390C8FC48
+15FEA54815FFB3A46C15FEA56D1301003F15FCA3001F15F8A26C6CEB03F0A36C6CEB07E0
+000315C06D130F6C6CEB1F806C6CEB3F00013E137C90381F81F8903807FFE0010090C7FC
+28447CC131>48 D<143014F013011303131F13FFB5FC13E713071200B3B3B0497E497E00
+7FB6FCA3204278C131>I<EB03FE90381FFFC0017F13F03901F80FFC3903C001FE48486C
+7E000EC7EA7F8048EC3FC0ED1FE04815F00030140F007015F800601407126CB415FC7F7F
+1503A46C4813076CC7FCC8FC16F8A2150F16F0151F16E0A2ED3FC0ED7F8016005D5D4A5A
+4A5A4A5A5D4A5A4A5A4AC7FC147C5C5C495A495A495A49C7120C131E5B013814185B5B48
+5A4848143848C81230000E1570001FB612F0A25A5AB712E0A326427BC131>I<ED1FFC4A
+B512C0913907E003F0021EC7123C0278140FD901E0EC03C0D90380EC00E0010FC9127801
+1C161C4982498249707E4916010001844848D90FF06D7E90C7D83FFC146048DAFC0F1470
+000E902703F003C07F000C902707C000E01318001CD91F800170131C0018013F6E130C00
+3891C76C130E0030017E91380FF00614FE00704902071307D8600183A2495AA200E01980
+4848481601AB6C6C7E1260A26D7E1903D87000180000306D140F147E00386D141F00186E
+013F5B001C011F02771306000CD907C09038E3F80E000E902703F003C35B6C903B00FC0F
+00FC386CDA3FFCEB7FF06DD90FF0EB0FC06C6C90CBFC12007F13707F7F010FEF1F80D903
+80167FD901E0923803FE00D90078ED1FF0021E913801FF80DA07E0D97FF8C7FC0201B6C8
+FCDA001F13C041477BC54C>64 D<16C04B7EA34B7EA34B7EA34B7EA3ED19FEA3ED30FFA2
+03707FED607FA203E07FEDC03FA2020180ED801FA2DA03007F160FA20206801607A24A6D
+7EA34A6D7EA34A6D7EA20270810260147FA202E08191B7FCA249820280C7121FA249C87F
+170FA20106821707A2496F7EA3496F7EA3496F7EA201788313F8486C83D80FFF03037FB5
+00E0027FEBFFC0A342477DC649>I<DB0FFE146092B500C013E0020314F0913A0FFC01FC
+0191393FC0003E02FFC7EA0F83D903FCEC03C74948EC01E74948EC00FF4948157F494815
+3F4948151F49C9120F485A491607120348481603A248481601A248481600A2123FA24917
+60127FA31900485AAE6C7EA21960A2123F7FA2001F18E07F000F18C0A26C6C160119806C
+6C160312016DEE07006C6C16066D6C150E6D6C5D6D6C5D6D6C15786D6C5D6D6C4A5AD900
+FFEC0780DA3FC0011FC7FCDA0FFC13FC0203B512F0020014C0DB0FFEC8FC3B487BC546>
+67 D<B912F8A3000101C0C7127F6C6C48EC07FC17011700187C183C181CA284A31806A4
+180704067FA395C7FCA4160EA2161E163E16FE91B5FCA3EC8000163E161E160EA21606A3
+19C0A3F0018093C7FCA41803A21900A260A260A2181EA2183E187EEF01FE170748486C14
+7FB95AA33A447CC342>69 D<B612F8A3000101E0C9FC6C6C5A5CB3B31830A418701860A5
+18E0A3EF01C0A217031707A2170F173F177FEE01FF48486C011F1380B9FCA334447CC33D
+>76 D<ED1FFC4AB512C0913907F007F091391F8000FC027EC7123FD901F8EC0FC049486E
+7E49486E7E49486E7E49486E7E49C9127E017E8201FE834848707E4848707EA24848707E
+A2000F84491603001F84A24848707EA3007F84A24982A300FF1980AD6C6C4C1300A4003F
+606D1603A2001F60A26C6C4C5AA26C6C4C5AA20003606D161F6C6C4C5A000060017F4CC7
+FC6E5D013F5E6D6C4A5AD907E0EC03F06D6C4A5AD901FCEC1FC0D9007E4AC8FCDA1F8013
+FC913907F007F00201B512C09126001FFCC9FC41487BC54C>79 D<49B41303010FEBE007
+013F13F89039FE00FE0FD801F8131FD807E0EB079F49EB03DF48486DB4FC48C8FC488100
+3E81127E82127C00FC81A282A37E82A27EA26C6C91C7FC7F7FEA3FF813FE381FFFE06C13
+FE6CEBFFE06C14FC6C14FF6C15C0013F14F0010F80010180D9001F7F14019138001FFF03
+031380816F13C0167F163F161F17E000C0150FA31607A37EA36C16C0160F7E17806C151F
+6C16006C5D6D147ED8FBC05CD8F9F0495AD8F07C495A90393FC00FE0D8E00FB512800101
+49C7FC39C0003FF02B487BC536>83 D<003FB912F8A3903BF0001FF8001F01806D481303
+003EC7150048187C0078183CA20070181CA30060180CA5481806A5C81600B3B3A54B7EED
+7FFE49B77EA33F447DC346>I<B600C0010FB5FCA3000101E0C813F026007F80ED1F80F0
+0F00A21806B3B3A7180E6D6C150CA2181C131F6E1518010F163818306D6C1570606D6C14
+016D6C5D6D6CEC0780027F4AC7FC6E6C131EDA1FE0137C913907FC03F00201B55A6E6C13
+80DB07FCC8FC40467CC349>I<EB07FC90383FFF809038F80FE03903C003F048C66C7E00
+0E6D7ED80FC0137E486C137F6D6D7EA36F7EA26C5AEA0380C8FCA4EC0FFF49B5FC90380F
+FE1FEB3FC0EBFF00EA03FC485A485A485A485A127F5B176048C7FCA3153FA36D137F007F
+14EF6D9038C7E0C0003F13013A1FE00783F13B07F81E03FF802701FFFC0113003A001FE0
+007C2B2E7CAC31>97 D<EA01FC12FFA3120712031201B3EC03FC91380FFF8091383C07E0
+91387001F89039FDE0007E02807F01FFEC1F8091C713C049EC0FE049140717F0A2EE03F8
+A217FCA2160117FEAB17FC1603A217F8A2EE07F0A26DEC0FE017C06D141F01FBEC3F80D9
+F380EB7E00D9E1C05B9039E0F001F89039C03C07E09039801FFF80C7D803FCC7FC2F467D
+C436>I<EC7F80903803FFF090380FC07C90383F000F01FCEB03804848EB01C00003140F
+4848EB1FE049133F120F485AA2485AED1FC0007FEC070092C7FCA290C9FC5AAB7E7FA212
+3F16307F001F15706C6C146016E06C6C14C06C6C13010001EC03806C6CEB0700013F131E
+90381FC078903807FFF001001380242E7DAC2B>I<167FED3FFFA315018182B3EC7F8090
+3803FFF090380FC07C90383F000E017E1307496D5AD803F87F48487F5B000F81485AA248
+5AA2127FA290C8FC5AAB7E7FA2123FA26C7EA2000F5D7F6C6C5B00035C6C6C9038077F80
+6C6C010E13C0013F011C13FE90380FC0F8903803FFE09026007F0013002F467DC436>I<
+EB01FE903807FFC090381F03F090387E00FC49137E48487F485A4848EB1F80000F15C049
+130F121F484814E01507A2007F15F090C7FCA25AA390B6FCA290C9FCA67EA27FA2123F16
+306C7E1670000F15606D14E06C6C14C0000314016C6CEB03806C6CEB0700013E131E9038
+1F80F8903803FFE0010090C7FC242E7DAC2B>I<EC0FE0EC7FF8903801F81E903803F03F
+90390FE07F8090381FC0FF5C133F495AA2ED7F0001FE131C92C7FCAFB67EA3C648C8FCB3
+B2486C7E007F13FFA321467EC51E>I<EE0F80D901FCEB7FE0903A0FFF81F0F090393F07
+E3819039FC01FF033A01F800FE014848017E13E00007027FC7FC497F000F8149131F001F
+81A9000F5D6D133F000792C7FC6D5B0003147E6C6C5B6D485A3903BF07E090380FFF8026
+0701FCC8FC90CAFCA25AA37F6C7E7F90B512F86C14FF16E06C15F86C6C8048B67E3A07C0
+000FFF48481300003FC8EA3F80003E151F48ED0FC0A2481507A56C150F007C1680007E15
+1F003E16006C153E6C6C5CD807E0495AD801F8EB07E0D8007FEB3F8090261FFFFEC7FC01
+0113E02C427DAC31>I<EA01FC12FFA3120712031201B3EC01FE913807FFC091381E07F0
+91383801F802707FECE000D9FDC07F5C01FF147F91C7FCA25BA35BB3A8486CECFF80B5D8
+F83F13FEA32F457DC436>I<EA01E0EA07F8A2487EA46C5AA2EA01E0C8FCADEA01FC12FF
+A3120712031201B3B0487EB512F8A315437DC21C>I<EA01FC12FFA3120712031201B3B3
+B3A5487EB512F8A315457DC41C>108 D<3901FC01FE00FF903807FFC091381E07F09138
+3801F8000701707F0003EBE0002601FDC07F5C01FF147F91C7FCA25BA35BB3A8486CECFF
+80B5D8F83F13FEA32F2C7DAB36>110 D<EC7F80903803FFF090380FC0FC90383E001F49
+6D7E496D7E48486D7E48486D7E48486D7E000F81A24848147E003F157FA290C87E481680
+A44816C0AA6C1680A26D147F003F1600A2001F157E6D14FE000F5D6D130100075D6C6C49
+5A6C6C495A6C6C495A013E49C7FC90381FC0FE903807FFF89038007F802A2E7DAC31>I<
+3903F803F000FFEB1FFCEC3C3EEC707F0007EBE0FF3803F9C000015B13FBEC007E153C01
+FF13005BA45BB3A748B4FCB512FEA3202C7DAB26>114 D<90383FE0183901FFFC383907
+E01F78390F0003F8001E1301481300007C1478127800F81438A21518A27EA27E6C6C1300
+6C7E13FC383FFFE06C13FC6C13FF6C14C06C14E0C614F0011F13F81300EC0FFC140300C0
+EB01FE1400157E7E153EA27EA36C143C6C147C15786C14F86CEB01F039F38003E039F1F0
+0F8039E07FFE0038C00FF01F2E7DAC26>I<1306A5130EA4131EA3133E137EA213FE1201
+1207001FB512F0B6FCA2C648C7FCB3A4150CAA017E131C017F1318A26D133890381F8030
+ECC070903807E0E0903801FFC09038007F001E3E7EBC26>I<D801FC147F00FFEC3FFFA3
+00071401000380000181B3A85EA35DA212006D5B017E9038077F80017F010E13C06D011C
+13FE90380FC078903803FFF09026007F8013002F2D7DAB36>I<B539F001FFFCA3000790
+C7EA7FE06C48EC1F8000011600160E1200160C017F5CA280013F5CA26E1370011F146080
+010F5CA2ECF00101075CA26D6C48C7FCA26E5A01011306A26D6C5AA214FF6E5AA215B8EC
+3FB015F06E5AA36E5AA26E5AA36EC8FC2E2C7EAA33>I<B500E0B539E03FFF80A3000790
+3C000FFE000FFC00D803FCD903F8EB03F8F001E0120103015D6D80000060A26D6E13036D
+D9037E91C7FCA20280017F5B013FD9063F1306A2D91FC06E5AED0C1FA2D90FE06E5AED18
+0FA2D907F06E5AED3007A2D903F86E5AED6003A2902601FCE06D5AEDC00117FCD900FFEC
+FD80ED800017FF027F92C8FC92C77EA26E147E023E143EA2021E143C021C141CA2412C7E
+AA46>I<B539F001FFFCA3000790C7EA7FE06C48EC1F8000011600160E0000150C6D141C
+6D1418A26E1338013F1430A26D6C5BA26E13E0010F5CA26D6C485AA2ECF803010391C7FC
+A2903801FC06A2ECFE0E0100130CA2EC7F18A215B8EC3FB0A2EC1FE0A36E5AA26E5AA36E
+C8FCA21406A35CA25CA2123C007E5BB4FC5CA25CEAFE01387C0380D87007C9FCEA3C1EEA
+0FFCEA03F02E3F7EAA33>121 D<003FB612E0A29038C0003F90C713C0003CEC7F800038
+ECFF00A20030495A0070495AA24A5A0060495AA24A5A4A5AA2C7485A4AC7FC5B5C495A13
+075C495A131F4A1360495A495AA249C712C0485AA2485A485A1501485A48481303A24848
+EB07804848131F00FF14FF90B6FCA2232B7DAA2B>I E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fn cmr17 17.28 28
+/Fn 28 119 df<150E151E153C157815F0EC01E0EC03C01407EC0F80EC1F00143EA25C5C
+13015C495A13075C130F5C131F91C7FC5B133E137E137C13FCA2485AA3485AA3485AA312
+0F5BA3121F5BA3123FA390C8FCA25AA5127EA312FEB3A7127EA3127FA57EA27FA3121FA3
+7F120FA37F1207A36C7EA36C7EA36C7EA2137C137E133E133F7F80130F8013078013036D
+7E801300147C80A280EC0F80EC07C01403EC01E0EC00F01578153C151E150E1F8F73EA33
+>40 D<12E07E12787E7E7E6C7E7F6C7E6C7E6C7EA2137C7F133F7F6D7E80130780130380
+130180130080147C147EA280A3EC1F80A3EC0FC0A315E01407A315F01403A315F8A31401
+A215FCA51400A315FEB3A715FCA31401A515F8A21403A315F0A3140715E0A3140F15C0A3
+EC1F80A3EC3F00A3147EA2147C14FC5C13015C13035C13075C130F5C49C7FC5B133E5B5B
+A2485A485A485A5B48C8FC121E5A5A5A5A1F8F7AEA33>I<120FEA3FC0EA7FE0EAFFF0A6
+EA7FE0EA3FC0EA0F000C0C748B24>46 D<EC01C014031407140F143F147FEB03FF130F90
+B5FCB6FCEBFC7F13F01300C7FCB3B3B3B3A24A7EA2010713FCB812E0A42B5E74DD42>49
+D<EC0FFE91387FFFE00103B512F8010F14FE903A1FE00FFF8090263E000113E001FC6D6C
+7ED801F06E7E4848EC0FFC496E7E48486E7E48C81480000E81001E6F13C0121C003CEE7F
+E012380078EE3FF01270A3B46CED1FF813E0A27FA66C5A6C5A0006C913F0CA123FA318E0
+177FA2EFFFC0A218805E18004C5A16075F4C5A5F161F4C5A4C5A5F4CC7FC4B5A4B5A5E4B
+5A4B5A4B5A4B5A4BC8FC157E5D4A5A4A5A4A5A4A5A4A5A4AC9FC143E4A15385C495A495A
+49481570495A49C9FC131E5B4916F05B484816E0484815014848150348B8FCA25A5A5AB9
+12C0A4355E7ADD42>I<913803FF80023F13F849B512FE01076E7E90261FFC0013E0D93F
+C0EB3FF8017EC7EA0FFC01F86E7E48486E7E48486E13804848804916C048C9EA7FE013E0
+13F8486CED3FF07FA66C5A6C5AEA01E0CAEA7FE0A318C017FF18805E18005E5F4C5A4C5A
+4C5A4C5AEE7F804CC7FCED03FC913801FFF091B512C05E16F891380001FE9238003F80EE
+1FE0EE07F8707E707E83701380EF7FC018E0173F18F018F8171FA218FCA2170F18FEA212
+07EA1FC0EA7FF0A2487EA5EF1FFC5B5B6C4816F80078C9123F18F07EEF7FE07E001FEEFF
+C06C6C4A13806C7E6C6C4A1300D801F84A5AD800FEEC1FF8D93FC0495A903A1FFC01FFE0
+0107B6128001014AC7FCD9003F13F00203138037607BDD42>I<120FEA3FC0EA7FE0EAFF
+F0A6EA7FE0EA3FC0EA0F00C7FCB3B3A2120FEA3FC0EA7FE0EAFFF0A6EA7FE0EA3FC0EA0F
+000C3E74BD24>58 D<170FA34D7EA24D7EA34D7EA34D7EA34C7F17DFA29338039FFC178F
+A29338070FFE1707040F7FEE0E03A2041E80EE1C01A2043C80EE3800A24C80187FA24C80
+183FA24B4880181F0303814C130FA203078193C71207A24B81030E80A24B8284A24B8284
+A24B82197F03F0824B153FA20201834B151FA202038392B8FCA24A83A292C91207020E83
+85A24A8485023C84023882A20278840270177FA202F0844A173FA24948841A1FA2494884
+1A0FA249CB7F1A074985865B496C85497E48486C4D7F000F01F8051F13F0B60407B612F0
+A45C657DE463>65 D<B500FC041FB512F0A280A226003FFF0400EBFE006D6DEE3FF8F20F
+E0011D7F745A011C7F6E6C705AA26E7E81141F6E7EA26E7E82806E7FA26E7F6F7EA26F7E
+82151F6F7EA26F7E83816F7FA26F7F707EA2707E83161F707EA2707E8482707FA2707F84
+177F717E84171F717EA2717E1980837113C0A27113E019F0187FF03FF819FC181FF00FFE
+A2F007FF1A83847213C3A27213E31AF3197FF13FFB1AFF8585A285A28585A285133E1A7F
+017F183FA22601FFC0171F000701F0170FB67E1A07A21A03546279E163>78
+D<B812FCEFFFE018FCF0FF80C601FCC7000F13E0D93FF89138007FF8011FEE1FFCF007FF
+06017F727FF13FE0737E86737E737EA2868587A28587A96361A298C8FC6162624F5A191F
+4F5A4F5AF1FF804E90C9FCF007FEF01FF8F0FFE0050F138091B700FCCAFC18E08402F8C7
+EA1FFE943801FF80716C7EF03FF0727EF007FC727E85727F8486737EA3737EAA86AA1DE0
+86191FA3070F14017414C007071403496C8390B570EC0780B76F9038800F00736D5A9738
+3FF03E97380FFFFCCD000313F09738003FC05B6479E162>82 D<EC3FF0903803FFFE010F
+6D7E90393FC03FE090397E0007F801F86D7ED801E06D7E48486D7E48486E7E48C86C7E7F
+01F06E7E487E6D6E7EA3707EA36C5AEA03E0C9FCA6167FED7FFF020FB5FC91387FF80790
+3801FF80903807FC00EB1FF0EB7FC0495AD803FEC7FC485A120F5B485A485AA2484817E0
+A312FF5BA2160FA3161F6D141B007F153B16736D913971FC01C06C6C14E1001FEC01C1D8
+0FFC903A0780FE03806C6C903A0F00FF07002701FF807E6DB4FC27007FFFF86D5A011F01
+E0EB1FF8010190C7EA07E03B417ABF42>97 D<4AB47E020F13F8023F13FE9139FF007F80
+D903FCEB07E0D907F0EB01F0D91FE0EB007849488049488049C87E48485D4915FF00034B
+138048485CA2485AA2485AA2003F6F130049EC007C94C7FC127FA35B12FFAD127F7FA412
+3F7FA2001FEE01C07F000F16036D168012076C6C15076D160000015E6C6C151E6D6C5C6D
+6C5C6D6C5CD90FF8495AD903FCEB07C0903A00FF803F8091263FFFFEC7FC020F13F80201
+138032417CBF3A>99 D<181EEF3FFEEE07FFA4EE000F1703A21701B3AAEDFF80020F13F8
+023F13FE9139FF803F81903A03FC0007C14948EB01E1D91FE0EB00F94948147D4948143D
+49C8121F4848150F491507120348481503491501120F121F5BA2123F5B127FA45B12FFAD
+127F7FA3123FA27F121FA26C6C1503A26C6C150712036D150F6C6C151F0000163D137F6D
+6CECF9FF6D6CEB01F1D90FF0D903C113C06D6CD90F81EBFF80D901FFEB7F019039007FFF
+FC021F13E00201010091C7FC41657CE349>I<EC03FE91381FFFE091B512F8903901FE03
+FE903A07F0007F8049486D7ED93FC06D7E49C76C7E496E7E491403484881484814010007
+82491400000F8283485A1880123F49153FA2007F17C0A35BA212FF90B8FCA30180CAFCA9
+127F7FA3123FA27F121FEF01C06C7E17036C6C1680A26C6C15070001EE0F006D150E6C6C
+151E6D6C5C6D6C5C6D6C5CD907F0EB03E0D903FC495A902700FF803FC7FC91383FFFFC02
+0F13F00201138032417CBF3A>I<ED0FF0ED7FFC4AB5FC913907F81F8091390FE00FC091
+381FC03F91393F807FE0EC7F005C495A5C0103EC3FC0A24948EB0F0093C7FCA2495AB3A5
+B712F0A426000FF0C8FCB3B3B0497EEB3FFE003FB6FCA42B657EE428>I<F03F80DA03FC
+903801FFE091273FFFC00713F091B539F01FC1F8903B03FC03FC3E03903A07F000FE7849
+48EB7FE04948EB3FC04948011FEB01F049C76C6CC7FC01FE6E7EA248486E7EA2000382A2
+491401000782AA00035E6D1403A200015EA26C6C4A5AA2017F4A5A6D6C495A6D6C495A49
+6C49C8FCD937F013FE903973FC03FC0160B512F0D9E03F13C0DA03FCC9FC4848CBFCA57F
+A27FA27F6C7E13FF91B512FE6DECFFF06D15FE6D6F7E6D16E084013F16FC01FEC700017F
+D803F8EC001FD807E0ED03FF4848030013804848167F003FEF3FC090CA121F127EF00FE0
+12FE481707A66C170F007E18C0A2007F171F6C6CEE3F806C6CEE7F00000F177ED807F04B
+5A6C6C4B5A6C6C4B5AD8007FED1FC0D93FE0ECFF80D90FFED90FFEC7FC0101B612F0D900
+3F1480020101F0C8FC3D5E7DBF42>I<133C13FF487F487FA66C5B6C90C7FC133C90C8FC
+B3A2EB03C0EA07FF127FA41201EA007FA2133FB3B3AC497E497EB612E0A41B5F7DDE23>
+105 D<EB03C0EA07FFB5FCA41201EA007FA2133FB3B3B3B3AD497E497EB612F0A41C647D
+E323>108 D<D903C0D9FFC0EC07FED807FF010301F891381FFFC0B5010F01FE027F13F0
+923D3F00FF8001F807FC0378903B3FC003C001FEDAC1E090261FE00FC77E0001D9C3C090
+260FF01E6E7ED8007F49902607F81C6E7E02C7C75CD93FCE6E6C486E7E02CC166002DC16
+E002D85E02F8DA01FF6F7E4A5EA24A93C8FCA44A5DB3B3496C4A6C4B7E496C4A6D4A7EB6
+D8F007B6D8803FB512FCA4663F7CBE6F>I<D903C0EB7FE0D807FF903803FFFCB5010F13
+FFDB3F0013C00378EB1FE04B6D7E0001D9C1C06D7E27007FC3808002C7C71203D93FCE81
+170114DC14D802F86E7E5CA35CA35CB3B3496C4A7F496C4A7FB6D8F003B612C0A4423F7D
+BE49>I<EDFF80020F13F8023F13FE9139FF007F80D903FCEB1FE0D907F0EB07F0D90FC0
+EB01F8D93F80EB00FE49C8127F017E81496F7E48486F7E00038349150700078348486F7E
+A2001F83491501A2003F83A348486F7EA400FF1880AC007F1800A26D5DA2003F5FA36C6C
+4B5AA36C6C4B5A00075FA26C6C4B5A6C6C4B5AA26C6C4B5A017F4BC7FC6D6C14FE6D6C49
+5AD90FF0EB07F8D903FCEB1FE0D900FFEB7F806EB5C8FC020F13F8020113C039417CBF42
+>I<D903C0EB7FC0D807FF903807FFFCB5011F13FFDB7F0013C003F8EB1FF0DAC3E0EB07
+F80001D9C7806D7E26007FCFC76C7E02DE6E7ED93FFC6F7E4A6F7E4A82181F4A82727E5C
+727EA2727EA3727EA41A8084AC4E1300A54E5AA2611807A24E5A6E5E181F6E4B5A6E5E18
+7F6E4B5A02DE4A90C7FC02CF4A5ADAC780495ADAC3C0EB0FF0DAC1F0EB3FE0913AC07E01
+FF806FB448C8FC030F13F80300138093CAFCB3A3497E497EB612F0A4415B7DBE49>I<DB
+FF80131C020F13F0023F01FC133C9138FF807E903A03FE000F80D907F8903807C07CD91F
+F0EB01E0494813004948EC70FC494814784890C8123C4848151D49151F0007160F485A17
+07485AA2491503123FA2485AA5485AAC7F127FA46C7EA36C7E1707120F6D150F12076D15
+1F6C7E0001163B6C6C157B6D6C14F36D6CEB01E36D6CEB03C36D6CEB0783D907FCEB1F03
+D901FF13FC9039007FFFF8021F13E0913803FE0091C8FCB3A34D7E4D7E040FB6FCA4405B
+7BBE46>I<9039078003F8D807FFEB0FFFB5013F13C092387C0FE0913881F01F9238E03F
+F00001EB838039007F8700148FEB3F8E029CEB1FE0EE0FC00298EB030002B890C7FCA214
+B014F0A25CA55CB3B0497EEBFFF8B612FCA42C3F7CBE33>I<9139FFE00180010FEBFC03
+017FEBFF073A01FF001FCFD803F8EB03EFD807E0EB01FF48487F4848147F48C8123F003E
+151F007E150F127CA200FC1507A316037EA27E7F6C7E6D91C7FC13F8EA3FFE381FFFF06C
+EBFF806C14F86C14FF6C15C06C6C14F0011F80010714FED9007F7F02031480DA003F13C0
+1503030013E0167F00E0ED1FF0160F17F86C15071603A36C1501A37EA26C16F016037E17
+E06D14076DEC0FC06D1580D8FDF0141FD8F8F8EC7F00013E14FC3AF01FC00FF80107B512
+E0D8E001148027C0003FF8C7FC2D417DBF34>I<1438A71478A414F8A31301A31303A213
+07130F131FA2137F13FF1203000F90B6FCB8FCA3260007F8C8FCB3AE17E0AE6D6CEB01C0
+A316036D6C148016076D6C14006E6C5A91383FC01E91381FF07C6EB45A020313E0913800
+7F802B597FD733>I<D903C0150FD807FFED1FFFB50203B5FCA40001ED0007D8007F1501
+A2013F81B3B25FA35FA35F011F15066E140E5F130F6E4A7F01075D6D6C494813E0D901FE
+4948EBFFC0903A00FFC01F8091393FFFFE00020F13F8020001C0EC800042407DBE49>I<
+B66C49B512E0A4000101F8C8387FFE0026007FE0ED1FF819E0013F705A61131F6E93C7FC
+130F180E6E151E0107161C8001035EA26E157801011670806D5EA26F1301027F5DA26E6C
+495AA26F1307021F92C8FCA26E6C130EA26F131E0207141CA26F133C020314388102015C
+A26F13F06E5C168092387F81C0A216C3033F5B16E3DB1FE7C9FCA216FF6F5AA26F5AA36F
+5AA26F5AA36F5A433F7FBD46>I E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fo cmti12 17.28 12
+/Fo 12 117 df<003FB612E05AA3B7FCA216C06C1580230874A232>45
+D<143E14FF010313804913C0A25BA31580A215005C6D5AEB01F090C8FCB3B0EA03E0EA0F
+F0EA3FF8487EA212FFA35BA25B5B6C5A001FC8FC1A3E6FBD2B>58
+D<1A1E1A1F6262A262A261A26161A2618761A26161197B19FB19F3F001E3A2F003C31807
+1983180F1903061E80A2183C85187818F818F0EF01E0A2EF03C0A2EF0780170F1800171E
+875FA24D7F17F85F4C5AA24C5AA24C5A160F94C8FC5E161E4C82A25E04F8157F5E15015E
+4BB8FCA25DA24BC9127F5D151E4B83A25D1A3F5D14015D4A5AA24A5AA24ACAFC5C141E5C
+875C14F81A1F495A13031307010F183F131FD97FF84D7E2603FFFE0403B57E007FD9FFE0
+92B7FC4E1680B61A006C5C596678E568>65 D<92BB12FEA25C80DB007F90C812077048ED
+007F7048EE1FFC043F17071C035F1C01167F1C004D17F8A216FFA25FA25D1DF05FA25DA2
+5F1C014B19E01A3894C81278A24B04F814C05090C7FC5EA2031F1501624C1403A2033F15
+07624C140F191F037F157F953803FF8093B7FCA292B8FC97C9FC9338E0000718004A8219
+3E5EA25C193C5EA24A167C197893C815381C3C4A04F8147C4F14784B037014F896C85A14
+1F1B014B601B03023F61A24B170764027F180FA24B4DC7FCA202FF183E1B7E5D63491801
+634B16031A07494E5A1A1F4BEE7FE0F101FF49170749053F5B013F0407B5FC007FBB5ABC
+FCA298C8FC5F6276E15F>69 D<92B500FE93B612F01FF84A6E4B15F06E84DB007F0507EB
+FC00041F6D030013E0775A4C96C7FC84043D183E1D3C047D6D167C167C0478187884DCF8
+7F17F8725E16F0173F03016E150165EEE01F8403031803050F5F04C07FA203076D160773
+5D168083030F6F140F9AC8FC4C7E854B6071161E031E81187F033E183E73143C033C143F
+A2037C6F147C061F157815788503F8020F15F8644B81840201180108805B4B80A20203EF
+C003725D5D1AE002076F1407644B16F0197F020F180F08F890C9FC92C9123FA24A715A07
+1F131E021E17FEA2023E040F133EF2FF3C143C85027C18FC63027882A214F8735B5CA201
+0183635C1A7F1303630107183F130F496C171FD97FF8603803FFFE007FD9FFF8160FB6FC
+98CAFC4B826D6276E168>78 D<92B812FCF2FFC04A18F86E18FEDB007F90C7383FFF8070
+4802037F7048020013F0043FEE3FF8757E4D6F7E1B07047F837513805F1DC016FFA25F1D
+E05DA25FA25D5113C05FA25D51138094C9FC1D004B5F644C4C5AA2031F4D5A644C4C5A50
+5B033F4C5B5048C7FC4C4B5AF23FF0037F4C5A963801FF804CDA0FFEC8FCF1FFF892B812
+C04FC9FC619339E00003FF4A9238007FC0737E4C6E7E737E4A1607864C8119034A83A293
+C8FCA24A84A25DA2021F5EA24B94C8FCA2023F5EA25DA2027F5EA25DA202FF5E625DA249
+1BE01C015DA2491A031DC04B18071D80491A0F49051F1500013F01E060007FB600F0020F
+143EB76F6C5B735C4C6EEB83F0CD6CB45A081F1380E003FEC7FC5B6576E166>82
+D<DD03FF140E051F13F094B500FC131E040302FF133C93260FFC00EB807CDC1FE090381F
+C0FCDC7F80EB07E04CC73803F1F8DB01FCEC01F34B48EC00FF4B5A4B48ED7FF04B5A4B48
+153F157F93C9EA1FE015FE14015D020318C05D0207170FA2020F18805DA3021F180062A3
+1A1EA38197C7FC81A28181826E13E016FCEEFFC06E14F8EFFF806E15F06E15FE6E816F15
+C06F81030F81030381030081040F801601DC003F7F1703EF007F061F7F848484A2727FA2
+84A301786013F8A25BA2120197C7FCA348485E61A261486C160361180761000F170F6D5F
+181F4E5A486C5F4EC8FC6D16FE6D4B5A263FDF804A5AD9CFC04A5AD987E0EC1FE0D903F8
+4A5A267E01FE02FFC9FC3B7C00FFE007FE023FB512F80078010F14E04801031480489026
+003FF8CAFC4F6876E44F>I<ED07F0ED3FFE92B513F0913A03FC0F81FC91390FF007C391
+391FC003E791397F8001F74AC7FC494814FF49486E5A495A010F153F495A49485DA24948
+141F01FF153F4A5D5A5A91C8127F485FA2485A17FF60485AA25E003F94C7FC5BA25E007F
+5E5BA216075F5B12FF160F4D137019F05B161F007FEEF00119E0A2043F1303047F14C017
+E0003F15FF4BEC07805D6C6CD907DF130FDB0F9F1400000FDA1F1F5B6C6C013E141E6C6C
+D97C0F133E6D48486C6C5A2800FE07E0035B903B7FFFC001FFF0011F90C75BD903F8EC1F
+803C4071BE48>97 D<4BB4FC031F13E0037F13F8913901FF01FE913907F8003FDA1FE0EB
+1F804A48130FDAFF80EB07C04948C712034948140F0107153F4948147F494814FF49485B
+137F495A5C4817804890C81300177C4893C7FC5B120F5B121FA2485AA3127F5BA312FF5B
+A45BA75B170318806DED07C0007FEE0F80EF1F005F003F167E6D5D001F4B5A000FED07E0
+6D4A5A6C6CEC3F806C6C02FEC7FC6C6CEB07F83A007F807FE06DB51280010F01FCC8FC01
+0013C0324070BE41>99 D<D90FC0EC3FE0D93FF0903801FFFCD9FFFC010F13FF2601F0FE
+90393FC07F802603E07F90397E003FC001C0D980F86D7E000790263F83F06D7E0180EB87
+C0000FECCF80010091C77F4802DE1407001E14FE4A5A003E5C003C5C180F5D007C13FF00
+785CA200F84A141F48485F007091C8FC1200183F495F5CA2187F01075F5C18FF61130F4A
+5C96C7FCA2011F5D4A5DA21707013F4C131C4A173C170F4E137C017F18784A141F601AF0
+01FF153F4AEDE0011AE0A2489438C003C091C8FCF10780F10F0048161F49171E050F137C
+716C5A496FB45A496F13C0C6486F6CC7FC464074BE4F>110 D<ED0FF8ED7FFF0203B512
+C0913907F807F091391FC001F891393F8000FC027EC7127C02FE143E4948141E495A173E
+494814FE1601010F14035CA2131F17FCEE00F06E1400A2808080ECFFE06D13FF16C016F0
+6D14FC6D806D806D1580143F020F14C01400030713E0150181167F163FA2161FEA07C0EA
+1FE0487E007F16C0A3163F48481580A20180EC7F006CC8FC007815FE5E007C4A5A6C4A5A
+003F4A5A6C6CEB1FC06C6C495A2703F803FEC7FC6CB512F86C6C13E0D907FEC8FC2F4075
+BE39>115 D<15F0EC01FC14031407A3140FA25DA2141FA25DA2143FA25DA2147FA25DA2
+14FFA25DA25B007FB612FEB7FCA216FCD8000390C7FC5CA21307A25CA2130FA25CA2131F
+A25CA2133FA25CA2137FA25CA213FFA25CA25AA291C8FCA25AA25BA2120716704914F0A2
+000F140116E049130316C01507001F158049130F16005D153E000F143C5D15F84A5A0007
+495A6C6C485AEC1F802600FFFEC7FCEB7FF8EB0FE0275A72D82F>I
+E
+%EndDVIPSBitmapFont
+%DVIPSBitmapFont: Fp cmbx12 17.28 9
+/Fp 9 118 df<B700C0083FB612F070627097B7FCA37061D800010DF8C7FC70F103EFA2
+02FD6DF107CFA202FC6DF10F8FA36F6DF01F0FA26F6D183EA26F6D187CA26F6D18F8A36F
+6DEF01F0A26F6DEF03E0A26F6DEF07C0A26F6DEF0F80A3706DEE1F00A2706D163EA2706D
+5EA2706D5EA3706D4B5AA2706D4B5AA2706D4B5AA2706D4B5AA3716D4AC7FCA2716D143E
+A2716D5CA2716D5CA3716D495AA2716D495AA2716D495AA2716D495AA3726D48C8FCA272
+EBC03EA2726D5AA2726D5AA372EBF9F0A272EBFFE0A2725CA2725CA37390C9FCA2735AA2
+735A90381FFFC0B700F86E480207B812F0A3735AA2735A8C627AE199>77
+D<B96C023FB612FEA6D8000102C0CA0007EBF000E2007FC7FCB3B3B3AA656D63A2821C01
+806570170380525A6E7F6E4F5A70171F6E626E6D4D5A6E6D177F525A6E6E030390C8FC03
+3F01E04B5A6F6DED1FFC6F01FCED7FF80303D9FF80903803FFE06F02F8017F5B6F6C90B7
+C9FC041F5E040716F8040016C0050F4ACAFCDD003F13C06F647AE17C>85
+D<913803FFFE027FEBFFF00103B612FE010F6F7E4916E090273FFE001F7FD97FE001077F
+D9FFF801017F486D6D7F717E486D6E7F85717FA2717FA36C496E7FA26C5B6D5AEB1FC090
+C9FCA74BB6FC157F0207B7FC147F49B61207010F14C0013FEBFE004913F048B512C04891
+C7FC485B4813F85A5C485B5A5CA2B55AA45FA25F806C5E806C047D7F6EEB01F96C6DD903
+F1EBFF806C01FED90FE114FF6C9027FFC07FC01580000191B5487E6C6C4B7E011F02FC13
+0F010302F001011400D9001F90CBFC49437CC14E>97 D<92380FFFC04AB512FC020FECFF
+80023F15E091B712F80103D9FE037F499039F0007FFF011F01C0011F7F49496D7F4990C7
+6C7F49486E7F48498048844A804884485B727E5A5C48717EA35A5C721380A2B5FCA391B9
+FCA41A0002C0CBFCA67EA380A27EA27E6E160FF11F806C183F6C7FF17F006C7F6C6D16FE
+6C17016D6C4B5A6D6D4A5A6D01E04A5A6D6DEC3FE0010301FC49B45A6D9026FFC01F90C7
+FC6D6C90B55A021F15F8020715E0020092C8FC030713F041437CC14A>101
+D<903807FF80B6FCA6C6FC7F7FB3B3B3B3ADB712E0A623647BE32C>108
+D<902607FF80EB1FFFB691B512F0040714FC041F14FF4C8193267FE07F7F922781FE001F
+7FC6DA83F86D7F6DD987F07F6DD98FC0814C7F039FC78015BE03BC8003FC825DA25DA25D
+A45DB3B2B7D8F007B71280A651417BC05A>110 D<D90FFFEB0FFCB690383FFF8093B512
+E04B14F04B14F8923907FC7FFC92390FE0FFFEC6EC1F806DD93F0113FF6D133E157E157C
+15F8A215F07013FEA24BEB7FFCEF3FF8EF0FE04B90C7FCA55DB3B0B712F8A638417BC042
+>114 D<913A3FFF8007800107B5EAF81F011FECFE7F017F91B5FC48B8FC48EBE0014890
+C7121FD80FFC1407D81FF0801600485A007F167F49153FA212FF171FA27F7F7F6D92C7FC
+13FF14E014FF6C14F8EDFFC06C15FC16FF6C16C06C16F06C826C826C826C82013F168001
+0F16C01303D9007F15E0020315F0EC001F1500041F13F81607007C150100FC81177F6C16
+3FA2171F7EA26D16F0A27F173F6D16E06D157F6D16C001FEEDFF806D0203130002C0EB0F
+FE02FCEB7FFC01DFB65A010F5DD8FE0315C026F8007F49C7FC48010F13E035437BC140>
+I<902607FFC0ED3FFEB60207B5FCA6C6EE00076D826D82B3B3A260A360A2607F60183E6D
+6D147E4E7F6D6D4948806D6DD907F0ECFF806D01FFEB3FE06D91B55A6E1500021F5C0203
+14F8DA003F018002F0C7FC51427BC05A>117 D E
+%EndDVIPSBitmapFont
end
-
-%%EndProcSet
-%%BeginFont: CMTT9
-%!PS-AdobeFont-1.1: CMTT9 1.0
-%%CreationDate: 1991 Aug 20 16:46:24
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.0) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMTT9) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Medium) readonly def
-/ItalicAngle 0 def
-/isFixedPitch true def
-end readonly def
-/FontName /CMTT9 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-6 -233 542 698}readonly def
-/UniqueID 5000831 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA052A014267B7904EB3C0D3BD0B83D891
-016CA6CA4B712ADEB258FAAB9A130EE605E61F77FC1B738ABC7C51CD46EF8171
-9098D5FEE67660E69A7AB91B58F29A4D79E57022F783EB0FBBB6D4F4EC35014F
-D2DECBA99459A4C59DF0C6EBA150284454E707DC2100C15B76B4C19B84363758
-469A6C558785B226332152109871A9883487DD7710949204DDCF837E6A8708B8
-2BDBF16FBC7512FAA308A093FE5F00F963068B8232429ED8B7CF6A3D879A2D1E
-2931CE5F5D18C658602059F07BE66E6EFC9239D7AB2FB8A4CBD41675B8ECF279
-650C29E53B14AC0E392A664848C1844B1CECBB2D5CFB72D0916B675C9A9A1E35
-F12696A6F628473C604A95376468E06E295AD6F76CEB939D94113532050B9D5A
-D2F41A9EFB9424D986612313B89EFE9C8A71313340B248F6853B1EDBF02B7F9E
-F447220FE131D7D54CFB8AA1281DBAEA73E665BACB1F164552CC0CEDB63BD4B1
-4A9AE8AC6FA02242DBE8DA46B64B6BFC11762F0784F216FC8B9120D688D1705A
-438B14F5E5DEAF2A98408B3B64620DE3732A4DAE6D08D5D97E34C75DAE19EABD
-BA0796165C1151BCBFB1DF8D29A63A8300DBDB9E3323CB82D0337598B83F4F2B
-A97CF5196D4D1CEC1EDB8966E548C0D9C194C932319610FB43EA1B86322FE641
-AB48770FF13BD475A7267E142388563D1A400419C585B22A9886074687BEDF74
-D905BE8EE440BA2ABF28EAB673399B7F129B9729DD5564C681954621903B84BB
-CAF89AC5ADB2932472DF29ADA2BDBDB4D05F65F28F5F4C529613D61858E0074A
-082A852710A62A147C966F2B85B51B0BE85F11D2057C66FDD61F6C5755367980
-9F4DE680601D4DA41B46F8D2148450000413C27AA39B586B74B977B25F0FD3C0
-4BA1EBFAFDBEC531EA13DFBD6700E53818CE04D23886B8AE75DCC36BCD3189B1
-0D55FAE27D0D126E82AEF31D7B5DF27E58C30BB0867D6D7AC1DA9EFB8A2DF095
-B5B934A68EE122DA0A83B36C952431586B957990206194E89339048AA6EE4C53
-703763505ED57C494DD907D0EEA04F6B1D4C8F3BA778F4E7AA832AAB4D75F024
-61E91C6D25FD6823CB24FC863C039F7DC5A62670829DB662947294E97098AAC1
-483CC960DB755F27C7155CC30B233EDABBA47BF46BBDAEAFA6F4A61E3A1FB57F
-4661A8C065115937B09FDCE4414FDD634F82CC287151AF817BAFB5C7F5491E2D
-5D3C700CA1121B84A1D3A9576D75A5D8B0CE7A49DEC1F55EB3F7153B09B55879
-4E2B2F7628CDE91761DC6CD2AABE37CD82A99EFF4BD8FDE30B7E034B9C7D7250
-B8686E6DB76D6D7EAE7593048D9CD43093AFB99B97DAC930A6BBAB14CE24A66A
-458199BFFAF9202CFCF5C752D977C093A50981D73D321F7970F4BF024A6BFEED
-0A888D952A43EAADC5710FC9C1BEFD7FB07660446B6BAA9B718C4D2A9EDEC3A2
-DBD2E2C29C15BC3E9A9512CEACC56C1753BB0A46A73E7CBB64A07D9AD02094BB
-15B9D4931DC5C3636768B5E0EF01C52F7E62D4616DBB91F1EB05F08F47E14DC9
-CFC8EB2495C5C21B51F190D05C0A0A2C0A00089D95AA105B7934FB9FA598957E
-8D0FC740265B27FC1C23DD2A5C48A3AB891FC46871F971FC5E0DBCB56760107A
-60649EE49A2BD2F385E984107FDA824FF8E6757951E6000C9A4CD246EDEAB49E
-4C77F79809E4A9D1D539B3EED8520A5BA7BA23D74DF56B38DB3E8F9F38726EE8
-BF802BFB0F77C2CAA94CBD76E93D7AC7790ACD4AC16A59EA5A5A449B344AB047
-B60A174375EB13E126BE5A3A65D31642BBE52D7E8E206CFC77085BD01A8AD73F
-470726AB30434BFAF255F88985A4E9D3DE005C9990074A0FAEE9C1663410E939
-F67E21A97FB44C6109C0BE1C10DEDC355CA5921580C8D2262F205B4EA14D20B0
-D6FC7C31D634FBA5977FCAF694FB44756D4A1930A1D4D938D294FFE358DD1597
-5F772371E5867006FF0001652513B3D189398A0280D14698F2274E2A6BEB1577
-8ECAF5F36A6A5C9F9FBC134DD73ECBB04C53D046D0C8CF2DE4D6EC51AECF4241
-54D1D40906118DF3B630377D659458B0878D6F3EFBD94C6CCCC97552BCD6EA0C
-D5916F4E27866ED2803BCF3884FF327B9AF9BF491F4125931E4E548C2949BFA3
-D655084472A42BCB5EAC7502DC1B6F7EDB279729E460039317BC5960036A0711
-FD504679436F7C7CE36E5373C6752668B8040C3F5F996769D6462569974AB101
-2A044BEC3EBB1E254CAE3B36D1E47789A71833C6EFF0B7EDFED0E7C388FDAF67
-DCFD292A4D337FE92CC4D3D5082DC375BF0BCFF526AD96C0858D47FD00B4EB82
-C96036C53145557553ED5BD6117324DA268B94780B6DFFC31BC6C97231F6CDE4
-ED6ABDC0C3E9B49131B87E73C9AAAAADCFE4448F053C05739185453E573E2879
-D8F6D5D8AA42A591964C6B5CBC9619EFCC52F1B6495E3C121EF66400A840F7E6
-4DD91EEF83D258135335884163918740E08B600DA078A8981073ED27CB7717EF
-C15B326E12436384F353FA30227F8746B1535F54A05C46667B931EDD440A8F54
-B856A7B93C358BF70278311519838A68AD42AFA802CC0BD3F6D9440434BF2082
-7FDE0271B93CE4C10FC8CFBC2C9C22D7114569FE3340B5EA21F1459F899B3FB1
-5397481F17D70D05A57728E07BFE0D5F25CE24F005BB737C034D9AF047CF9BEB
-1B82819CA133C08D6BBF9FF967F88ADFBDFDDCDD5BBD6E8F11D8CFCC97EBB2E8
-8D02A9A149A38A59C53C26DC1CA97E000D0C7068E2E87B69138AB201503B8015
-E072144776ADBB163A70EF97675D825123F0478FFF0929797CF06FE9AA8C0F82
-C36D97284E3A4272ACA452AFE7D3AEA3F47E1B501FB515869331BCB04CD09CD6
-4C4111C07C3A54ED60E041876C4443B37AC44E36140EB6F623B27654DFC7F43F
-CB20A207B99AE9707E0DE13D670BA7D8B0A548FAF6D4F74C2008F02503036886
-06B6571279D007CD367D338513B5DED8E2BA1502DF6A42D20C6D63EF7CBE6D0A
-25EE7DADF27D80C71C48C579B72084478B4C07F8091F958F36CA5DBD27683CC4
-5319BF25FD5B161D272D005006AA14F6D1F1BD1B1E41FB2F6F3A8FE1B365A5C4
-7F4C8CCF41C877E6CFFF610E550C63E03246C8A9A94FE576CD0D5B26DA102568
-C73A99FB541493B7F22E82A814981D658397C31004FA871DC91AE63FAE6EB98F
-57B998DC8D33E2792FC8D0594A583D2954DE21B924FE294F7E3AD8C1A0F25F35
-A8BB9ED2631878EBD9FB62722B52326B1A0AA6AB65FA3EC6C94429068055AE77
-C3474E52FB2FBFB814585EBC555971D784CB5BFCCEF9F6E1411D603225BEDB51
-C8A4D0A13E511DF2A1CF5CB4F48235EA96758D0A7FC90326FCDA091A5BBF9915
-D1ED79B6E13CAD45959915E63511233A1417BBC83B03DA048A13F17A575AC95B
-03DF21D106384DF0481EC12CDF988A2CEAAC231D7DAFD4881348626057F0E38F
-A5E6F9E33C89E9E0A46204D474B8EF255F643F709F379E0C26DC7710FC610174
-EB64AC996BAAFD81BDA50FA2847F939D94C7E090C19E23C685257C4B939833C2
-F61CCBD382F1F1C70BB9F341CEDBA19F38443863E6EFA51CF73727FF79DDB005
-2A13E79266A56B129E6CD09DCF7389DCE56422412F178755C0560ECF74564F0A
-A34FCFA2DCA510B3D1A8FFACF68DAC623CF5DDE25E1DD7340BF98D6A3E42F2A9
-F813D6FFE6E9CD2CA9678444D993E41FD9A5158EC6A3D22140D441B3B1BA9A12
-B764129FEF5B4B169889E5FD4891F55ADD03733C93D8B89BA18A2D2F844A9D18
-ECEA2EAFCA593D7D49A63127A5CB4932E0F2CB71BADE73E6EC413D628B22D7D6
-325CC18B444FD37AB48BD3F86DD3090C757C22072A501A7AC46D1A0EF7D8E479
-0E3E1659FCE16868719C9FED05A3F7FA604358C80742700B68D8E5B794CADAD2
-37F48DD232E7C75B18AA985BF5DB6E2FDA40517A7CEBC28A8006A767134A3F31
-904E15B13FA58A00DAB98F05EDF5D9C3856980BF4D7884C8033908A764D7E35B
-25E4E5F62A62C3B75665299A170E3A61618CDFC2E5D3F4A5EC18F04111969024
-3D4014D931B146CB9081CB920BA4021973C48123465321F44BCDB0C736F8772C
-AFEDB6C4BC99A8E1D2A2CEA5966D73401A6E8994B30EF41D6922DD9141FD2789
-F8EFC8DA403A428A0D3AC4991DBDBD29E4EFAACF5F6DB1CDAD08953192089C4D
-DD4C78B0E907E3E595C5275F7CC578190360AEB4756BD2DFD26B19CFE90CEC6E
-25B073A6A5B616C7FD98C682C95956C745807B7F78849E79D8BC35987EA43F1E
-6E68FBD6165D3982A2642CF6BFD03C2AFF5E636A8E4C8871DAFF98AD53CE4936
-45B8FAB9AA24452698C2918B1B0D2AFA7894B2A7AC2867EF33A65E69E5198D1C
-9C65C1AFB336C61BCCF074B3E27904FB95997A6F277F65AFF6D8D911EEF4F756
-B9396449105343F921582F82723A5B653B6A1F944FCC44EE2BA3A7EED4D8E764
-C29C5A9356F7E06D9021CE25E28F62FF29FA7E52CA1D26A51BA3698F7C4548B5
-D26BC79F5D009D7383A98FB186C45483272E1379356ED81CDEC5FE8BDD4B665F
-CEC8F01ACB5486E7262C54C3B65AD23C752413B600661D7DB0F4FF5BB10C1B23
-253BE60EF6A1DC0A8C324FBD5B3BC853839DC0FEBA2291C00EFCC123452B896D
-44673FA12BBD8883D73733A283EBD84E3162F05686BBF1FE936F52E5E35C915E
-37406A30ED8BF0EA3CED016D99D4AD1214BA4D0A17020474CFC7C73CCDA44758
-C69CBF92E46EFE87D9DB58F05E7E9E85426002A67BBDABB746DDCBF4FF7C563F
-1E1F3E69D116CB9E5B38E32CB28628565D63BD34F16CA44CDA21EBF51160EFE4
-25D787E7296DEE3AEAA8A2F4144CBB72A9E93441C202D593976314860A3E79F4
-9EE1D8EAAB801B2B2CF5A06679D83A7FEA5087FDD7E0977EDF80246A7B115A94
-149CCA7D92F82152C6D08464230AB9B3C848CD52979C96F7852C0FA43A23930E
-92DE00D16902458DA02168CAE807C677F120E9D7953BC776A54347ABC8404385
-4FB1DAA613CC7832726D77E67F52DD15DA6574EDC50321EE452D677DACC4012D
-19D646F7B0D5B68584ED5882C8A886E7327861A1621E483F32836D39847AE74A
-132CF29E89AF947E9DF6F4F3D7BDD4AFABF5624B401DBE47F5697D57FC40DA05
-87056876B7E0E1C8EE41E44DDC521F1030453384226BB3A634DB3A3C9AE40A2A
-0AF700279BB3C140F3215633FB7A1EE76FCCF0B1D510DA908EB3763C1C9557D3
-2FCA6938681E9A4D5610796FEA5760062DD186B1718C87598880C4F90C8282C4
-64EEECA246623483D262A7ABE048B1142E824E4F62674288E5ECACD2D67F6B0E
-A2723D3C44D99493B57072F26931AA3E640830127009567F1EFFAFAF1D70EEBA
-62F194DB60379DF93F15E1AD2A4E12BE6AC221B83DE5E36EDB858887912D6B3D
-DB3397FE21E678C7986F969B153F023000C59273BE6580580E8A35A82357299C
-5F2727AAEAF9D0BDAAF29CAA3929C174CCA4A2B4371BC4E7A67DB82481BBFAC5
-B1BB5DE9A9BAC68925E049C42E63EDC788EEB7C3365DBA87724103B8F44B8F6D
-C7166D5487F9ED5E1B797F00E7E8CE66BABCC467C62CD20B31EA1CA4EF832E0F
-9F7E4A01DD318CB5654E8F266C3FD0D7DFF42B5543E55033F068D1663518C5F5
-B669D0DC43C39BDAF9540C0EA905265E3CFFDD5A5321CA2A62D0C5BB0CC3ECD1
-FF7E4C108DD33B86922E318589B9CC26CFAE55A5A034C10E70848302402CF994
-A4984924DB4C800659ED6AC7D3D6B3C1CAAE2C5D009F55759C95F4B96600296F
-4DD653BB24589F96F003CAC86694D90C135064783875978605F7FCDEC9B04319
-84349C51D97E46630B8151DADCA6EAC7859B84466AE1F4F166745262FEEBD571
-4F958629EFE8F64FECEA192A9EBDD54C41FBA1EA6D33F11097B9E1B983279C86
-19BD077E0D63B88C9DA0CC7295F81F9970F930D1957C9C1A6082CE8D22E93452
-76B5E317734A98B06181D58E4B96D5FFFFF3B339AC9826A1A719D50F3CB74BDD
-478B5A25B5F095F4BBB9183630FA4EEDC49D6D2F7D25073BD52CA5CC6F596C0E
-FDB9C66BD2885045C0031AF25CCD5636B5B39E4CCFD22DEAE0163DE8F2C978AC
-4FB12AF067C628539BC44ECAA8324BCD0D85B2328E47E9AF6C357242E31B99B7
-6A4C6A75AF74035AF1014C8387D50BF64F9B9B19C91EDFEF57EF2E0258110654
-CCC994F365E64EDC8BC19988563A9904743A8FA5F62C8D41697CAD848C69AE7B
-CCB0C737447CA3CC1D29618B02E1810772B4CA77461D7627F62022620C26C1B0
-BC1DA7796AFDAB6ED3B7681F0540B63D2745EC1FAAB0BA9C28B4AAD21800E3E2
-D3DCA8AB9B17C88DC88FDDB3194AEDF70D0C62891752A4735138D7D814DDE950
-AFFAD2D06146E7F8CF39412DD3FCBA016B2735F601B32D699A57EE0C4DDE7145
-EE7092C3F9BE645D3B46B35DA7BDBAB3DC91C27279FC57CB6C7A5444D66CB7C3
-8A9B7EC4F93006ADC8DE36C08B925D24BD3F90D7921734458E1DD1422C65DAED
-D3E660241002CC3246FC6E60C61BE5E7E306BA5A94B1632B5372166C21CBC493
-8D37FFAD3D70207F056F34F74A46AAA35176C38CD5339C2AB914E9945BF27D0F
-652E268BD4119DEA4C5D766CA57187A651A968F93A87C41E775D133DCC8E8591
-0E4BD579B38FAF2C9C51C551DD5C376A94F020AABDCF91F4C07D856CEF5DEC16
-3178432F89B82EC2491B7BCEE4152FA549F4E92E86ECBE480B333AD76CBDBD89
-C09D8661A65AB21834803B9955CCCAD580D546F7FC2AA18602053F7AB8E68F6C
-DC9615EC87E090EF4429869BD98DC29CA831CBA3C6E0903F5ABACBEEDDC638B6
-0D0F60ADB674EA00FB3AAEC9BFE3D8AA501F89029F84F53D21F6ADD613BFFD79
-35A9226B88B752A21A3858C838292EAABD5980206173544B5E8FF3EB8819E2B5
-B2FA6C86BBF6C6E549B9002193E7A95165C19D8CDEDF4B5C4F660A71D63567F7
-60AFD8466ADF9D99AB5092FAEDE14656A96750E4888DDC6206314B40220A22F4
-B4823CC51C597C278EBB052FBC0C08B750C42C5F5470B54E5550456CB6314881
-BDF02E049F14A2500A1D8304D3E55F62EDF7B866F483ABDCF5C85845CA1F491C
-F3F9498788ECC173926BC88D1E2392AA9E85D783A36C39CBB0C568134A243DCC
-D73A29C03A583829FCD58D33123369A8B8D4B72AFC1E8A7F00352C155B9397E4
-64FADF4D5BBF5A6A9A00910C901959C2A14086CB0CE072D775E2305950C3A84A
-44576761CF163D1DAA070D3DC9DD462F116D41CCBA817CE55583493853708C1F
-959E4E15DC33BCA710F9C4F2F4427B211D7A6E1BADCF527AF6218E94FE850A44
-27A05828F50146083E91145703AEE94911041254718D23F7D6CC42AC6CB42BCC
-B9C22959F1E4C042B6A77AD6BF229A14108B9BC96EDABD6BB08C86945F9E26FF
-BC509097EDF467A439C64EF52F2134827798EB3E279C64B1DB5EDB90FFE8ED23
-7009EDFA84E1805BBC71C7783DD1AC400AF2199AF0F13B15DBF87447E2043F76
-156D4AD3D2EABC9A73BC063847705FFCDE7B36C1308EC2E29AEE08399A34A9B4
-993417F6B8886631162D947AEF5386504DB5C6F68F54AEEF0A1CE61A21A91884
-398406C2CBDE680974D17C5445CFC8D3080F976FDDCFCFEBF0AD4BE61C716E8C
-F03ADC1EE9C73EA259B1F84452702FE29CF7920EA1CD7DA034612EB11ACE023F
-C5267137752833AB289BFF66D2CDA38CA261CEEFFA699B89B1624282FE061E8C
-6B27F5BC6F3EA7213BF9752C3B9707E59EDAF3D3EBE34B85A8EB4E080ABF9808
-1F9467088C3AD167FBB846DB6998790B428AE089C468EDEB223DDF8DD8AEDF80
-DDFE490766776A12D187EA4AA300AC74F5A3272915BAEF56C8CAF2A0ABA66FFF
-43ACB0E6BCED57DC9D5C77F98B8DAD3032A78085D7659A24CB0B54EFC202F15A
-9ED2195FD944D26B7CF8A2B71368113B0F60CF896A6914A5E06EBFA87DD203A9
-1C849B0AC7A60FD1B390AFAA00281361C0927817F328181B18CD68DB227EF1EE
-C26A6DD9BE9E7F3FF7F903C86B119E5132996114DFAEDE551C8FD994268D3C83
-6EADDAF6CAB15326CE5A0B9F3F13C13F2AE7C19B71788792FB53A4A5C78E3C50
-0259C8460EB1E808D0B443FB323A15E8CB9B07A0D66358124136C4ACCBD72685
-85D1D5BED989CDCEBFDCB5775259D583E03124F315966F07FA7D1CEC82FEF682
-6A698527328C5BDB8C225992970D3F30B80B28B28399C0B022D1E9C78D9C5512
-F9CACD66ED0C512C9FCD44F96A29C0063B9EF718EC3996630A6B6177FEE8EB19
-F20491C99F7058D9EF0A9006CC357089C56AF92AC2A1A4ED42A76F15A16222B9
-F4AA7B7DF8968B9F162C275D447686560B099F2C6C36F9AEB4608077C12566A5
-753D8A2A4D19EDD204927A1651A1688505113A1C1F48A19C33AF3B9B768F4E2C
-66BF069FB460E88A25AA2664C5BE24ADA4DF67D11B3A816269C2EAA9193AD7FC
-823D85FF1FC7833308206B2CCF8AABC8CECA4831940B3C79E72BA1D58DC2EF1A
-6CF7143503C9BB467295067B097F1FC2CA017B7F0406C4273FBEFF794E1F20CE
-7451C581962B61DD8E33CAA5FBD3E9AB369C78259181905B75717C748E9F7417
-D806992B212B63062B8B19F61E0B563EDA295A94E7B73DE33E42E53CB1CF553C
-923648780DD640E4586C89FA4979DE94C66B4AAA87EE28DE81F5762ABBA70D52
-AB8981E321C37BE4235C983E9E474003B98853580CE23E64ED571C00636F1E6A
-36F1F950D917E0F495D1419D4E1C2B7434670ED5E24A6F289538D17CD0E90306
-E98F0C750D32F506B230C151A3B52A173F624B549C38E62266342936E3F11C73
-A0B2B56D3DE157DCC1E9F43EA5B6557C189E1F9ED5EF3255BC4E6908D24EB474
-6A38D787B335CAEC3F87ED9CD1AB839493CEABC2632B2CE252C00173659CED31
-C70D70FFE39AE1D489C0D7B62F2FC8420104C57E402D2E3AD82344C6BB6BF1FA
-5015C201461F876EAAB1440CC8AA329EBE547A31DDA7F3D57DC5080A612FF234
-69F7374B87B18A79066842FEDC3D2D812759D600B5DC6F79B9924290F3B7E998
-40CA68192F291B207711A9F129477670BFBEFF128A81C99E4022C845F5B0FE64
-AFED26F3F91E722FB690E9DE89B2F96DD14F02C89F206C48D3901AB1FC1C328F
-EAEFF8689F1979DD5DEE7A226784D305AF9A1A8102CFCC6B0BDE9FE34DDD6A90
-E2146D2EA39B11DB8DB5B002C5831553657F42019871967910B7975437A7FDA3
-3A18DE381D06FFB8DC93899328405F8C9F774AC5ED3DBFE3DAF8413CB5A16D06
-64EE9FCCA735F031BEA435CF2DE78B0AF32A5F674EBB0315B68009076808CDF3
-84B3FE1FC1318559E1A32E40BF995A5ECBE4BC41EA8DD784F568BDF40386AC04
-DD6D775695B279994C3DDA50C6F676F0F8E96AEB7B4AD88D632B65F62982B5A4
-A6A2EF9FE4C89A89328B09C15D40CBFD8C5E64B5A1910B42AA8000823E06290B
-D792E22132AAA3B2430B69FC179EA33474F9F4A1A178A6A2C2FCE1B4C3F28F7F
-96601DE78E1EAF4267FA2DF480F9FCD1BF5AB9966231178634211714B0CC78C2
-4E788E1F973B247FD346A81F01CA985D91D19EE407B94CE26A48FA3197CF3D5F
-2631BDD24640BF8DD1F80093779464965AB0C54EF1DCE22B2177AC02E53533FE
-447CEA3F42129EFA69248B202A5D9AF9B1FD752EEF246D29383CC0937F0A15E6
-9625A037FD08AE17BA63DB1014B01786D3E077B245D3A7D5E763BC6515321B53
-79176CBA5E720B264C5E4FE2E42CB8682B9E7F969F5561BD04872066DD12CF02
-88D2B50D051AC4ED33FC890E4B9ACD4C525D815E4497F27BA5D95EE92102E27F
-FC65DF98CAB43491365D30E79BEBA9708E1DBE3F63E4AA6A4E7208D21BA6B7FD
-2E11C573FE9E2468AC4273D392B0EDD6CD5976A35CF57510F19F340C6031ABAE
-23030F7B6D7F96637F6F4B8244C30807955696D10A3F193F48B80260EBC50753
-9423E54154F544C8085D5F0DC501A1FA7C48862F7A198FDF69C77A9AD1A5884F
-A7105AD5A933F912A27BA2DB56751572755AD6C52C795335F2298B6C0692B36B
-F13DAFAE2C6812247247F84F885994E13ABAE33665EB8A69551C66408E130D52
-7F9395803F2A13DA857F5A0181EE7BA18542D15298242529B2EC891DA68E3E79
-193B3C9FA31EA74C9ACC0DEC7D5952229F46C2B560DE7F7EE7C692B9EBF4DB46
-2766154DC1B5F3A1282C141E795CF08B553ECF269ED9DF1E13712D888A339D54
-951FC2D7D36FF661A3C9D7BBFD098FB0D1FBF02F2F90722EF6C4037C4E696D0D
-9AF7998B3B4EB16683C44B1AEA3E937C34F00A92BF71942040B8EEBD22EB402E
-C86E99CBC801445E4B8990DBA09770C2FE256A827D1F6BC35B268AE06ECDDBA8
-114009651EE59D97246B11BF4DCEDB2CE6265E4B298407C45D63E73CA6C0B60E
-D968F81229A56D1B3AD883BB17734583F4A7F5A68B0947B02738DFB49DF3B7ED
-6CFDA0CFE5AA3871C0CB1EF8E683F393A4907E4B18F7C769557BA81256C00B30
-1B1C5C5954DE71A9D3FA4FB0BAA05D630E2488D6370760243D139D4D040E3E70
-D14EE3C9B2A35E5AC33C688F1E8F93A4D6EB44D16780E3DB613A5CBBAA2A0A8D
-054D4551C5794D3564CE27D9EDB90C5EDD71F87DD15D0575AFDE2CF9621FB97A
-A21BD03D95686D4C0A8B888DB3A33DF4A7A488DDEAFA868BCC66B99CF49B9EEA
-2EB296F7B56BD0BB3C683E5A10DA2773308082CCD96877C5ED568542E21DB787
-439F8FB6B50C712B2E741EB995C78C9AC955108AC172A09FC65B497BE2AFD57B
-71C310B53B0D2C9D26D0837EE978B5F721C4A530B8EABEBC48A2C45CD8E14882
-A3F0C0051529201EF67BAFED36736C57C93058B9A6ADD02A5BF6CAA7FCE43BC0
-63E3FF07EED8305D7511FE1E3AE1F4EF1E68B610BBCFA6E08981A4387811A5E8
-379EA801761FDA168EA83F8F435AD8043233A40AC46170E145B408D9F22B472E
-F8038C8172382FEC67846E45A1AE1D927BD9FD5568CF62C088F43A8F85B89D61
-13298E
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMITT10
-%!PS-AdobeFont-1.1: CMITT10 1.0
-%%CreationDate: 1991 Aug 18 17:48:50
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.0) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMITT10) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Medium) readonly def
-/ItalicAngle -14.04 def
-/isFixedPitch true def
-end readonly def
-/FontName /CMITT10 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{11 -233 669 696}readonly def
-/UniqueID 5000779 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA0529731C99A784CCBE85B4993B2EEBDE
-3B12D472B7CF54651EF21185116A69AB1096ED4BAD2F646635E019B6417CC77B
-532F85D811C70D1429A19A5307EF63EB5C5E02C89FC6C20F6D9D89E7D91FE470
-B72BEFDA23F5DF76BE05AF4CE93137A219ED8A04A9D7D6FDF37E6B7FCDE0D90B
-986423E5960A5D9FBB4C956556E8DF90CBFAEC476FA36FD9A5C8175C9AF513FE
-D919C2DDD26BDC0D99398B9F4D004D606918A40B8D7BFA821B73E118040992A4
-E1BF99740F8FAA47E4349853C8149C0F8BE2F23C6F332BC0373C867D0715E8FA
-FF163A60AFD0FED665D5829739975C5DE12EB30895604D211F645D4E13330DB7
-64B6E35463C93B752F691FDDC44595B0A0E9E57C6F649809C4DBC7DB58102A60
-46349E9A5740893A1BD4536B99ECE72B147B713619037400669C07291022F84F
-4F3302F8244D2F0F1380466E81E0B5E00AF33E021A55620A7A93F3BD49C7040A
-67C096167F502EF2051B526405B9391B4340A3FFEC103E317E315A88D31661E1
-7E4104A2B925D1DDA9586861904FF6FFCE6A8E808385E4C4014F5A494874E2FB
-C3758D6989AB68C4CEF82F92B9439794FC404A29D086ED6B27997735BC3A24F0
-473FFD74BAECF5282E2EBFCB92D69B81C568D394055E2E30A7E3F448796E4EB8
-019AC2E075377F777183BD87FDD194E855ABFA35AFA73304DBB181C267431B16
-70456FD8470B525011891C1E140B8FF24A474B89F1CEAAB509F91FCAF512E16D
-8413BAC0C664FDCD31245C5996F4883305D3EDF1C8D1E6F0B1E79A06028BBDDF
-6AA5B515DF33BA8FFF2394262F3FE1DF95AD661322BFA5179E325BD1B1EECE49
-69F64789FF1BE8DE5CD7485571A07471BD6CAB4891BAB122BE4C4A1B7176F33E
-A1A434F745811B71EA8AF73407F32E9F4EAAE1C1FAA979523C18A24F754C307C
-CE056DCB71B20292D4FBCBF9AB9E9B81DADAB90E60BE926315049E5BF0F50315
-66D82E4963CB556F19461F43EF80302912AC1168884A1692AC59BFBC431B14AC
-A5FC06C4AB595F9DF66CE5EB69568038445A9EDDE20CF92BA308A2317B43BFEF
-D826D1B7E4176DFFBB96AC2B8F0D98487DCBC5AB8F9EACE83693A8C6780FCBDD
-226943C5471B6194AEDACEFFEC4A7269E77909EFCB6C2B79B410BA5B4BA2F2D6
-93E917286BCE703E098B567156A35798B47CFBDBFB3EEC5CE61B57F162A92779
-65C09101EBDDD0DB74B35630274526F0068A715A08CC57000F0CC1DF32249F0B
-52DC4402D66EAA5401E21CB257B64C57BC6BCCE42D9982E7BEB59BD4DF6D9DD9
-2F4BBF3E96B67D41BEFBCE268B23C3A93F24ADE536BB61BF49485101618626E3
-D7C0CE225F4D1C6C794F89F003D7F6538D35986E9B00321BF9CF945B9AC0DD41
-2B543C87613D62888A53C8275386FA42B7D71C5178785F7F4DE37C3B0EC04414
-D6E04518B1CFC2C9555A86D515BB209355E5D7BCD160185E7D9D580DC56A11AA
-6EB74A690B8ADF214BA44300F377599F832B86837A973114A08A60CA40B31351
-74533295817D98386516B2CBCE838B7177EC42B98ADDF47A0F3A8FF9F724E10E
-C0C9F63DB9913C070970DD845C523EC8C7A595E51F6B057A4A02FC7859AAA679
-61A61E58A740DC56056C3184AAA39D838AEF1549C80FD3680250BE1FC7B8F3AB
-1BCEFA3A44928E48BC5FECCEED5C730699F02C177E1F126565D22CF2D159974C
-5534B45A888C4E13D5A562E932B74582836CC66F4F707AF2076F561CE076138E
-C1C465B14DCD0B96DD956ED7F0D53F6627351A289B549E4E030EBF4F0A8DEFAD
-01220F233FAC4BD1DFAB7069C7DEEF0F600CD6BAE43214E6185E7C3A8262429D
-0757941F56CDC94E8B9BAD1135558A9DDD6BE6DA90FE041C2424AFE7D10BACC3
-0B0B0AA185E0E214E7D9485B34E2A4A0B012644080C1784FD316662C245F7AAE
-0173E80279D5D19FF310AC0664C6B7D1ABD3788243851604EF42962E6D5CF188
-FFF7DDB32F9FBDBEB56B7E021DA7DE0651B2A691D9DE75FDA43C6A246EAD4243
-488CDA25120F25D13D1B8D0D27ABC1576D57A82FAB11A22CF72705E6FF58E474
-742B76A65CB0DCAD5BE01AB7D680CD72607123D0E91504A56DA174F17CBDEABE
-C8EBC553E5CC0336C2FE4FF2592707480B82B2CF52E6B1F5CAE850C0B9B63845
-E286F9FD4B36776E6BCB5B50363C642CB0BC3412575AEC36641359D9AE7213FA
-2CCBD133447DBDFBF08D26FF363F0964E21338A996983FCAEA17BEA7904886B7
-EEC83462C80CF36E3277F100B9C817AF8777049E1015FF4C04FD31333804B0FE
-702124BB7B25623E1AD4544606851EDB3344613E1728B900D029ACA6648CBC2C
-5539BB413458440BCCA852819D9BF4C35F13FE9A29AC7161DD70F1DB44880026
-E9F65C5D4D54A9FAEA5C13E7A18C2007AF84D944DA724DC42A6A7280347C999B
-C1AB5DA3C2C3534EACFAEB15935CB79D6AEAE9A4321BA858B3C197F2C732EA06
-2EFDB15A3376656B9CF5663D5AA331708A2E320AE758904E3CFA528784EB8BF1
-440E7643488615BC788CB7EB8E0F7C788A67BFBE1F4DBEC9CB0E96ACD42C0227
-DC83E6A8C734474988D0E935F08CF90CA3189B3328DA6AB2C5C291A26BCB0B87
-A01CB9646283DDB58AED6B7B7AB477C0641333B62B9E98D68B0F8AD1949653B5
-3E6A0096B709B78CF6CC57DF491FD10BA5F55608E5419FF8FAE98D5DC9CC66CB
-04F779ECB0A4595A5803C6EF04C146DB5D939781AF320BC7978E4AF9A28EFAB1
-E5BABC546C5DD8902BD122213D675545DADB5A41CAECE37CE21020D14A793FEB
-776C1DD474D8139E44B0558E244B7EF7A856A32AFED6B430A54292BCA0E3D224
-7DA360E727A9B309C70EE3A48BC0A9B34C02A64D11CAA012DAF1A0C53CBB1495
-5CDFD232BE35A00F00A995B27A978212673789EB98E4F616F17817850F22CB95
-962F72DB3742777642370DC07CE689B800EB599FBF6DEE7E5FCAE91657430C40
-401BAFB7ED1DA01A96B37A090EB3E5CE1E768BB8A0A98B99AA680BF29CC333A5
-7B74DDAD6A8C564E803A76D991401C1C2B819B0E396CF890DCC468BE9223DAF5
-E261A984AAB93DAECBFA4E96FB71844C4EF456E3D9404EEECAE1A9B4EE5E1A54
-1D4EE0620D24B920095383148E4691B1EF1E162814AA711878FE331FF321E563
-A196D93BEF92F936BBA51B88E3B9E3CC1BE002ECC24E57326F24945DF980CA8F
-69840C8F2B6CA8CCC2D314A2D03CF4667B3DBD910312A909FD028913BC625EF2
-C52F334966C5319986030A8446B53FA94A1F8DE033752CDC6007C4B51CF18751
-9F3CDEC18B969B577B69730A5B3E6C52AD92E3F90457DA1BDFD4DD37FDDDD5BD
-A2CD807943F92C8C0CA2637B53A3AEF7F0667B84EE26AFEF2B609C1AE9848D84
-2A52AFF915929A418C9255178033B0CAC9C63A3D7EB8911437B3B9BA216AD8D2
-2445EB8ACB4761B37554D365ACD8FEC50D1D5E94710A6217041404EFAEB93317
-CDC2F9942AB7A04B93D64F7A9B1413D039ACE22E941005FB6F9626E681E1C2CE
-D3482B29B8E4551374CC67EF36BCB784BF78DABEB1F1CADE7CF2F90CABCE9778
-D231A44503336DDE82513F038816DBBDF13DA33F77B54A6355CEBDCB8E0CD9E2
-750F960F03BD2A0B95BD9F92DBD76639466291CC6A2CEF92DE62B1BCFEEB0D99
-F23D1CAD25939F76BF65FE96D051B359301D5EB12F31F928A1D734440D5619B7
-3A8FE9BBFBCB1F51F7D24E298738DDCA55BD893BCE6732D03E28B5BD9C323C6D
-6C9ED723688CBC26A119FDDF00DCC0328305D39EC775DA6F27EC500991761DF7
-14C17116771CBD85BF2C436ECB0F9C57CECBCC9441B3DFE4AA41081EB8E97E0B
-AF54C007774D93E90C0E0692FFC556639EC45218BBC787CD50F69B3601E192F5
-3F5C79B8D8D89899B7ACE5B50537D43F7EB0A6C1B470EDCEC6A3373BC98B69A0
-5669DBB294B7418CC85BA8FBED39A8E1ADA234779EB84E7B9FAC59B94B8802F3
-DBC4DAA0AB4BA8E149F9B9E08F841EBC290911C4A9CDDD0CD1B3C867C02ADF19
-CC8E0CBA8EFB18B4C6C6F19AB2DBF50ACCAB8CD17852B4209907BA2921E6F1EB
-083294E8167E7CD0AA4950C3755C5D06CEB24D593BB914B7D3B6A794AEAB41B8
-CB7602EA4FE60F70FABFD2EA0AF5F75C90287A95C231DF36CBE4D08B3D1C6593
-FF61BE21E3E570655CF30CFB6ABF02771E51D8F467C5437914BAE200946BBBDD
-7480E840500FDE4E68C62FA6428571E533E5CD4D5B4660453F97FCB2BB973115
-E1B0050D9AC684
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMTT10
-%!PS-AdobeFont-1.1: CMTT10 1.00B
-%%CreationDate: 1992 Apr 26 10:42:42
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.00B) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMTT10) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Medium) readonly def
-/ItalicAngle 0 def
-/isFixedPitch true def
-end readonly def
-/FontName /CMTT10 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-4 -235 731 800}readonly def
-/UniqueID 5000832 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA052A014267B7904EB3C0D3BD0B83D891
-016CA6CA4B712ADEB258FAAB9A130EE605E61F77FC1B738ABC7C51CD46EF8171
-9098D5FEE67660E69A7AB91B58F29A4D79E57022F783EB0FBBB6D4F4EC35014F
-D2DECBA99459A4C59DF0C6EBA150284454E707DC2100C15B76B4C19B84363758
-469A6C558785B226332152109871A9883487DD7710949204DDCF837E6A8708B8
-2BDBF16FBC7512FAA308A093FE5F00F963068B8232429ED8B7CF6A3D879A2D19
-38DD5C4467F9DD8C5D1A2000B3A6BF2F25629BAEC199AE8BD4BA6ED9BBF7DABF
-D0E153BAB1C17900D4FCE209622ACD19E7C74C2807D0397357ED07AB460D5204
-EB3A45B7AC4D106B7303AD8348853032A745F417943F9B4FED652B835AA49727
-A8B4117AFF1D4BCE831EB510B6851796D0BE6982B76620CB3CE0C22CACDD4593
-F244C14EEC0E5A7C4AC42392F81C01BC4257FE12AF33F4BFEA9108FF11CF9714
-4DD6EC70A2C4C1E4F328A1EB25E43525FB1E16C07E28CC359DF61F426B7D41EA
-6A0C84DD63275395A503AAE908E1C82D389FD12A21E86999799E7F24A994472E
-A10EAE77096709BE0D11AAD24A30D96E15A51D720AFB3B10D2E0AC8DC1A1204B
-E8725E00D7E3A96F9978BC19377034D93D080C4391E579C34FF9FC2379CB119F
-1E5BBEA91AE20F343C6420BE1E2BD0636B04FCCC0BEE0DC2D56D66F06DB22438
-452822CBEAF03EE9EAA8398F276EC0D92A7FB978C17805DB2F4A7DFBA56FD6AF
-8670EB364F01DE8FCAFBAF657D68C3A03112915736CEABAA8BA5C0AC25288369
-5D49BD891FABEFE8699A0AE3ED85B48ACB22229E15623399C93DE7D935734ADA
-DA7A1462C111D44AD53EA35B57E5D0B5FC0B481820E43222DB8EFCD5D30E15F9
-BA304FA879392EE0BCC0E1A61E74B3A1FC3A3D170218D7244580C7AA0DC65D19
-741FA5FE6F8CBF60250ACC27454BBF0897CA4B909C83A56672958752ED4B5E79
-E18660764F155E86F09EFA9F7685F2F5027EC85A775287B30E2069DE4E4D5712
-E7D033481A53A2702BA7542C71062173039030CF28D8B9C63B5596A9B42B33E7
-D922944A38713383D3648A4AF160A3B0C8F3379BA4372BE2E7EA49AABA75AEEE
-C5DDE1D8BF68483C3D21271280ABB91D54CC819680322EAB72E1250A760BC8DC
-FF798F2ABFC4F3539392985C4CB324B00072295FC160818BB0355FDC4F12E39B
-984826450553E3D271F03D8DC2D12A92A4D32034FD16DA13B876D88C8C097384
-46D8D7E41CA1A8979F9B07EC3337E70CBBE3A377235B04C79BBBDB66CE1C1A41
-89DAB7CE91F2FC0CAF6DDAD09992D56F72299068192610EE3DE5DB7CF6366B4C
-D74F414484DCCDBA449BFAADA39D0F27574E604E31CB513B18E3821A33076151
-C2BCB6E957C77A0AECA48C587ABB5E8C7624D56B32F80BBCFDC874AAD6EA5119
-C9B06886F08CC7DE5400E0F52B07483FD4BAF26C1556CA27B259F845681D61D0
-2D28B185C9F052844D9A5F91CF19210CBFB21B55CDC8C684448E9B5A1D249E15
-56632979760E2CC7075DF794E06EAC2C8E770828837AEBDFF1A5EAE67338CA7D
-F0A477DA679EAC876B6E0F0300ED4D9097E654F197198FD861ECAD138AD5B484
-A28E3CFBEB4CA387F488BDA739EBD767BA225E1E0E7CF5D75C85B4DE5437481B
-011B4B5C9590CB8309079CDE324CE4C2EBC40CD2A6B6F20AF0CA05B89586EB58
-4210AED367DCB3FC3A5845CC77126DF2DAEA475CCB4D94EA9CDFEBFAB137AB61
-D03EE9555BA9C6065EF9ADD376F6ED4971D546608D763570B9ABD3F692D505A6
-49543687AB7A8CD379693F71C6C859796B12E9C834E18DB0FC0063D502AEF1F6
-F5324EBC13AB3FEB378BBF9BA3A9CA9F2DC6C03E2D2102C5F245242F736450A3
-2BDC1E924E1C6F28DDFC3900CDEFC793B94EAFBAB1D8974A95B424C6F9D71EE6
-AB1414BEC47E836BEEAE29C8AA3A1BB09067CBABDE9701D65075D75A43BE26D2
-B0153E6EA2226BDCC9DD52FC8ACD2437BFFA60C48B558A3481CF70EB9B4810DD
-9DDC306C60835972912D1C8B91E37BFBA6D073403B7112D28DAFF0C7EC8C5AEF
-2222EBFA58B67472EBF5CE8986EE3681AB1CA8D16D9A2D6E64C3EA177A19D756
-655231063A387F1BC3EA15A1670867D9025A82421D1DAE6A674D9909398E1199
-49738C66FFDF170D54A748C8F10E22CFF8F0AB6B0C6EE870B589D3E3D9E548FE
-405D01D18D8D883151034AB0973A3E52B2394C2DB707DFBFB26BB937B4F16FEE
-5FD39DCBF8FF3B1A6258B0860829C1923ED50520680FC6AA3409F9BCC0E571A6
-9F9EE2C2838982303318BA603014762E1354039D59AA3A0D6B503AD545050663
-7BF58018253C2E99CBD1868FE34CD15C0F9ACC04AE1DCFA5B0ECFC5DF9D80D15
-4FE32B4428D2ECFEBA48E87168ACB8931F808AFAE6E23AA69E7DBF3EE03218EE
-97EE38CCC15BDCAE42BA442307F1CA795B39D45B390F965D28D61C0D74F87227
-A9BD80821776EF541F95735F3685D189F8A276F9A9D11DDD8B63D574C95E539A
-D0394FF86D51CD478866134BD6B616623888EF8BA726FB18B9D788147C5513FC
-70E3BDD453F5CF5C969B9AD0EFD63D08DFFA844ECCE12608526182CDFEFAEE04
-2BC1CB5B423CFD045325B46B869D936EA63A51D7B2948A6EE6BFC96606BFEF49
-3B39DB9EE88B8FBF0348654A7CD596EFAB99C1FB47421097F8BFACEDED57754C
-C11784BE56BF6AFAF29466CCD58F3BFD93E1E7317926DF179C25E304CB237874
-09F2D9AB5C51E590CC7F7760E20FE692BCD7909DB4B11BAB7EF8D796F2772B23
-4F50A2FCAFC7ED271D9D688443791851692A81D0E29DBE22E1AD4CA2127924F8
-D395EF943A494B7199B6FDCD446C307D5EEC73CD2BE9B8AADB6D669018584ED1
-61D5A2876FD2FCFCEB820C096826C2C8B8A71EEE301368D8339B21991DF5F2A7
-086954362C24AFF5F76BA4FA4DF0FF25F2A622EB4AB569DA6A106CD137D676E8
-C1AC756124DEFB783EE4A691EAC8BEE98FC7E026D0930F780020DC27D2D373FA
-4A554AF9F00CDC54808B4BD35C4ED86978C1B036317A31B5BC6FBB1BAAB15B8C
-7B721EF7DF444D97B91F0B9CED609E76359E34388E0C19714B2CDC2C18952603
-FCB0488E9FC802DE94BB728D7F4D7239CCECB2FC7B01133205FDEDE068F05953
-058111078CED0A9EAF4E0D72CA5462269DB816404416BCF96487D489D057D47D
-F5014FB7FE63D925F86C00BA070358D83027ABF8EED8FE452DEDDB3F7171DB0B
-47175145B2FE6070FAFCBA3AEE9653649FED0D1895B5C3A1433A8ECB4B2ED9F1
-8A7F624D538811F48A755C43F12C592E86217348660EA235D1BA47B78A795D0B
-D1BDFAFCAEA4921D787518AC3314B99159EEDB8BA080BBDA46A24ACCEFD6A6FD
-1507847DEC2D3571F291CC89F08C293003BB33AAA1F59679594403EC55094DB2
-9A3E7F8D0EDF7AEA70558C271AC27D901F5C227CFFB1EC944F7805E34F80567C
-E765134C061094FFB282B5DA914C9F65F74FA51A68AA8CC3D45D318AA0F9182C
-BB08B6DC71F171DED6239F4C5C8A568AC2E91AD12643245600771CEE0981EE20
-4F7BF6D5D115B7CE46B79079803002092ABDC9B5EA9F15AFD082488533D91312
-3562F2530C197500F5058D29594A6045A1FA22D66C89E502DC8617C491891A73
-11CAA863D7DBEB448006A4B3DC96FD218756034750074CB69C345F744881F53A
-94CA1CE26D7E31B3EFCC915999072FF10632D33C12D25753B55982DEEDA801C6
-327BC6D5A4E6C248C0DEA632CC8F9D4F8D2E927AA5BC9AA9BD7806E9B4285DC8
-E32C45946BB47E57A200B869E8F5EA0E3F8709B8A8A412BE15E97D0BA542223C
-D177EB5E3DDD36334E7A73838B2A24418CBB92BC5A47F24D1A5F3F12C1AB53AC
-F76DE532012C0D235987426B79D4BB1B5BD001D473EF7745D997948E267956BB
-58FDBDF3932C3A4EA4B105B62E5DBCA7196063B0C64A42367BDE6E494426F72F
-B2D670BA36BC7AC258593A4443A917F32483AC9D107367CB27F670C02EE60962
-707BD83E0B314882EC62A79A55D977E5EFED74EE60F2432281335B5E4EC88CF6
-DAA9D750541B2E4ACF45006E3EA2F571147045501601408332BD8B1F2C45D1AC
-465085558F62C4E6EAC092DBDA8DCEB43C00429D5ADB2B2F9B6F6D62C1FFC930
-CD3B0ACF2B6381E8897A071C19F098C2395768A069B01196925C7153E65712EE
-1E321C0DEE3D57A0C6FBB95583D8D6D16A1B53EAA9BE3D70897E01E87A06468C
-795E9A7EA6D3455E98E40E24158795EFF878D8C3168C0FD23E3CD76E1161EF3C
-3AA4D16701F748014CBD1210490FEE000E6967AE7518A923966242335243267A
-52D5E959F9FB907A3ABA7DF1A19E7D19A3AD5D33BC615962CFAC7DE588EA240A
-436597826C16A3716BA5FF64F5B709C3E0B35A07A6060ED886995C8DF6DD653E
-B3C84108F5BE11857AAF84768E6D11D2BA5759CDD06B6F76B0BB9CA39A4DC9B3
-32F787D1F5AA9F53A89376CFDFC2A3F02F4335EDF95DBC6C39CAE3DC7363E053
-010BF93A5A919D196EA30B7C418DB1DF3E6E77A4DEA9DBC5A614658C8D4DBCDB
-399D37945DAEB3B7A993BE2B8C5DC1415056966E0BB6B37B85F2A60D62613C3C
-C25043A7D096AEBC94F8E71359369123E9A6B6FB25C91926A87C939642A3FACB
-915EB261334701B4738F05AE355585AD0C8389C734390F271333657F2024921B
-0512E5EAD1ECAC7E8A953543472C60D46FFFA12C9806AA685CF41C6DA171615C
-539807DD35F7A11D3488C0274930360EF17CEE646DED1BA14C4CA9E1D49FF864
-0771C046CFE96F9FEBC7C57A80081E082D05D7D8F47A7CFF5AEDB00AC0C3C592
-C37BE62AC96A9145C6485DFD54D45FCEE24A6970485082915C60D751F1BA9457
-21BB5C1CC4BFDBC76A0C4F3E70EC7F656EAE01EDC3B019139B890500279F42B2
-87270972971F8367BFD7B37D97A6BB45F9F3B81DE18B89307CC1520270DB8CF6
-3BC4E21C9CAE6F8AA32DA60984C61B550FE10DE70713552FEBD98E12353EB037
-DF1863F50E992D230794DA92AF15A44362A17BADF992C1621021590CE733552A
-8E45A38999ECFA7EB0DF784534CB39B3E508D492DA8F7A5D0553772491A7FEA6
-73499F0A8282056A3726CD3E2AEDC789DDC1D77F2DA8629C5EBD7FDC213A9FB3
-6787694C99CA4C8F3321BCC444805AF19B1C35145CFDAC8C276802A6687BE6FD
-E83E0F144A4DF7EBAE478068255019B2D62C3DECDABF69199F16063A791CA321
-B970ABF9605CF8433B16C75944E2F932AE5466D17E20F528AA5E857A1B377A25
-1FF166BEFD2D078D32A7BC2F9CB9E5D60B9288DD3B2AC1785B7D098B8EC15E5C
-B9A600993B8760291CFA1FA6C39A4B75E0E790FDC9DBC1709A5A9E1AA88E96D5
-6E664B0547E02CA0ED129067C767E106AFC368328F7246FF832CA2FFD701774E
-62250B5D25A529D9135B408BCDC76C70CB95A5BF4CBBB6EEA8096CC038F9373A
-A2D3AE14ACA0EBD22BDA928781EA14845EACC1BF3B08B12677BBE20C07DF93C2
-3C2D3F4A27D8F462422D94DCCB5AFC0A8A73FCA8078147FEE04EF5602E08B83D
-1B6BD93BC2A7547EDEACD5953D00FB336F9272F9F559308E64A3C986FEACF6E7
-E580A4A75709D12F38CC2A5F5AA9F9A6D6A2B01C8EE7941C6FF26C991DD8737C
-F9363FB119121998B78147E0AB8B9ABA9EE8BF8EE916732D9C667E0B9A5BE37D
-8AC77590E0B68C619980D62B66AEC029D60D886DD2BE653BBB1F4DD231E8A9E1
-3D962A2FCF2DF02A1558BEF2770FC9C140B02E6B09F912E4EC7CC02A745EFB1C
-5A04A0DF200F7CA103BB67AE81E882DB7D4C02B6420F63CA767EDE40FA252816
-60F0A3FA6671B1F880E15E5B1E2FFD85DD5B032E2011122AD3AEBE51074D9F77
-B77C3FEBC3792B7FFBD0ADC7C8AA118E6E6C8E4BE29AF61B419E97C5A9D5DCB3
-7002194B0BEE60A5C5E2234B6BD5C4E5759CEAC3FABE3B727D1AB9635A780F79
-8CDFAC295D19AAC7DA9AFB6B1BAF4C23B605B678D8401BE32DE1BCEFC3CBDE6C
-C44273F49001405890C52A82A851C32D262FBD8050BFFB0F1B26EB2ED9C4FC16
-D1E580E155B097D218915057F18AA2D1DAC0251C56C8E9F8B1F7306C39FDC139
-C78DCA99BFDE0CD6169B24233042A400E061BC814C01B391FD0EE298F1007E18
-CAEDC60BCBD3546D055DE67276A37ED946FB27C8D904D8A68B262CE8AAE277AB
-DED75D97D5E13A3A7FE67B19F50559E4556DA9EE233359C50AE90E0F51A15E72
-665264EE34160E384C92D96443EDAA3273070E229BEA018756B9CC17F318122F
-C57FE7E2E63DAEFE77FB64A987AA01A18E9CAC1B405E74F4250B7D118AC5F293
-37AC269DE45A124F394E1CA16DCFC0652E0B38556993EBB38D87AB1B69F033CD
-061A2B15D4726067F869FA7D9987680C6609785854349C1EAF710B395D62B863
-C42C2DCB31EB06155CB1D7FB65C3F4A0FD773FA29B67FA686843949D0AF7AF49
-B26849A723FB471685B2E280AD166F57BDC02E6746525EB2611516C39A48DF54
-B66A6B7AE9581106A78BE26F96818362FAC2865DF3E0C12AD50F630431D722F3
-53744BACA67E750C5DA7A659C9541D0B2E3F980EA92E796E4A58DA80618D9D3B
-D9EF1A5A0CABEBB7AB56E3B513079901E8B7F2D462E1CD86C5702AF64BA164E0
-E7CE17926ACF2B1619B57998170DE283C42DE186D066923C4E6097D279FB4FD6
-7BA40403335532F4D6419A85646EC392C721F4B1F38B48EFEB0294876B25E6F4
-BDF81A0D2DE9E691F0A7EC3AFA2FD8DC0F2F1CC1667141B9E379EC26CD0D5A13
-8B9FEE4C4BD841428F48D2849751AD4B0E444684836B2363F117F9CDD211F4B6
-957470A2ADECC53D159FB62C1993C3466E302E56C218E874A1FF17E93CEBAFAE
-51EA431599C1FC4322FD600EF3D75D8B041503560A58FC8E7E800296BA913D7F
-82A6C3D4B521B14952CFF5461BDC1FF4F4993D331CB8794224AAD6182B60E856
-219AAB0897B61860792ED485A5E85888028FF8EA57630C3821D66E833F44B047
-79A75CF1AC04E661D2F1A34AB69DB138B55EA4AD1F8AFD8C25B365299174E147
-56B5D2BA005138F682787599F09335B9E68B9516AB697172866BC111987A303E
-33ABC7A68731C2ED2A35CE356DD2F9110F78679296D66882679FD2AA0A549E2A
-44386DDAEA8F9EC957023BFA86CA50086BEE97865BF6EB6A26C4C87EA2426894
-A14D68FE61B71A6753E43CD39147A5817507DE4C2236B469062B9542A8163509
-2A2B04041A26970B21DD09E0DDA4AA5791FC461086A6CF8B35C006129174F4DE
-69DCE91F1FCD1A343740692E72AAEF08ADDE91D09EC74CE29F7754E9B115AC1C
-B12DAAF384F3F8A20EE86BA2E78C1D500D5F0943371A184DA3895E7E330AE15A
-B7C8BCD3288D8281FB075FEED6D11A561ADFFC9DC1F108948CD78A3F9529E1C7
-C216EA7BD24C7BF7625E1A9CFB1383AD64E6AFA67910A506DCF7B7CFFD6D83B8
-0DDF64008F725E05EEC01434EDEDA4C0CEFDE40EC5FE386F8E92824DBFAA4A24
-163E5646B8AD61E1285B59AE10929863403AF3F41FE9FC9B6150434560A1842C
-BDB2468AA1A84D57064AF11AE7EEF3907E41FA56F97B547B9480D002E6B57CD5
-6C069107400EDC6A9210B042BBCA0130D3FF4EDC1B02524FA608EC62F42CE8E6
-2E694D29355DE50FEB8E3B6874064E043B8144AB5B91B2AA8E968580EF856030
-0784CEC138169EB38F7702ED4F671B5479EF480FEA2681325212DA1FF3446E3C
-63B740AD7F9C9428D147DB4DBD0B1500AF3869942912D5945BD9ADB9E0ACB5FE
-B2D5B8F010C7155EA94968136817D8FA21271023B847B94FFB57699A8D0B078E
-609B580DA06D71A1C859DE5BDD590DE43D1BBA7BDEF5929C5B23AA38BC1EC56B
-9D0DB9FB8BC983F0982E583C2984891264B97DCD5381BD1347269330537D2056
-ADCD1B6E3371CD95C2DC1368B73B3883D98096B5DD57811A9350E038FA7E6F3D
-9C29C1A8B7A480553A0C49E619A1D68ACE92B6D37E88B5C54BC3BF8865307E3B
-1D03CFAFA9A27470EFEC0FF156D389E72BCDA79F850BF7E295A4609229F7A5DA
-D78D125E599F6A7DFC8338A76134ECF68BCF96FE9F6F8F1A226DA2D2FACC0FF0
-6FAE3B47CA68C8BD3D206BCC6CF7804477B0CADCF2639D3469DD130248AD7BB8
-025182015F8CA829793DEA2B7762F9AC18FC3D972219398366C7479E9B02F561
-054011A6318133F38597194FC449B068673FED86D50B2903B63676001345F088
-37BC0995DFDD5507FB8C5223BD445468B231DE8114911857B9FC68DE1C1BDCDB
-AF8E9DD3F7D88D4866134C598F3E53F043AA27FFC110D71726212F950A72422D
-0249BAA49B72A8A10890616A7ED565241E9415E66317983E6F7ACF44E700E92D
-19417210AD7697DA7105A88E8FC0196CCA4AF03763A528B64165090C440762C2
-5A716BE4A65596A73BD360F845E8ADE102B296CCB46CA60B5845BF7C8BEA763F
-02F50119DD97AC8019CF05EC680A542868C59B457656010026CB85B64587E8B3
-B95DDD6FE01D26C1D343CF0CDE837066FF1F55B39B214B40728E0A67703E05DB
-FE7B61322D7A8AF6D8A59083D90A37CC0CB130AA8B97A465739986A901F486A8
-A94391AB1AEC1EEBFA3C59A8690D4D3CF426244D26F0ED2A260FB055495B4B2C
-87273AF95F4A3204A4F9556AE7830C396B685292C7991236B7FEC579A206B6CD
-7F273D7AAE73CEAE2D43825B12FEAC52DDA79E734D32A515678C1C36FDD38011
-2BF9F64ADACA3805782471A6FCF0667004BA6399375AF74F15E819C71284DA6A
-D4A74A30729104B85102C71C570415E0D763FD3B15B295376F413D8A567C62FB
-411E712E5C577235F194C5244FDDF3D980BA59B52822162966368F0F6BE6EF92
-1E5154ADF6644E835CBF01669AFDB6B4BDD8DCE8C424AAAD5BA3A11734AF5106
-FDD3E82304BD716541C301B5BCCA599DC44C7B1F02472A30D885715F1BB7ACF8
-0B898CDECA627C4C241F9C3BF954A4D009210FA5B7472E4E9A37E83A8F412D7E
-E69C3AFCCC634BD5DC8846F86C52245807890B6D6FF815605ECCDFC5C17CDD26
-38EF4B1337733A53ACDE58079A3C5BDEC5499ECCF23183169C5D1AC858B5B922
-69FBC7F343B95DB603ADFEE2A61FA995B6EBEBD94AA59041536A1DD9E94710DE
-BDEE396F4DC70B28FABD01614ABC59E190307E093F1675550069144753E0710A
-672C714863DBF5E5D6AC6FD7722674FEA6413758203B9004223E6A242FF30160
-A945AB94F1EF68B2ECCCD78472E6B60427607DF5BAAB51D5258B78AAFF934D1D
-3C6AA9EF6167B95411F5E8CEC3C73FF4D4AB9E710A5E165D8D5526C7FB8F0C4C
-77A557242C68BA3D0CFE82B7FA18DA5421D2538D67E5E4595BE1F3C203E483C9
-B4FE9EC5A2705E276CBF44F4A2F0C8018F3830BC44FBB3463770AB308ACFFF77
-9366D1720BDAF92ED385A8BDE55BF7D43034B8D2D634F4509D761035B44F3715
-0D9DE450D86D77D6120F50C1DD78405AB371B5E8A53C06E8D127075F7A680B06
-1C431B2F8898AB407E262069775A0AC76754244FE9326ACF3B0473A36E559211
-7BCFB8603A821CAAA3B5FAA1D49070A6C491BC9C411FFB33112D13D43BE4F1DB
-C4F4800DFA69486B659D1DBFE7B791E9DDE5AD04F0767BC9CE91F26A4AF6636A
-E56D64A8812F1452744FE5EB382E966356E214E105995D2F7B91229C54431AB9
-F4B5335810AA64C2DD5222B5FF6D74835EF0B95D3C13790B4DA3E291EA42D2E8
-94F9B9161BE75F812013555F828C549E190031C357DF1B21A848FF2362207118
-F7CCA7C34FBB6EAE4C0C2A930117DF3EBFDA7957E199175FE2516E3C1E4ABEF9
-E9C54C7DCA0DD72E1106EE37B9285A376D65AFA6BDF59C426F9C92F5C2EF341B
-EDCA5162513BFCA516A04B7C0358169EDC8B10714E7AE35E6668D605D073C00E
-0C8E56C51063949D3FACF7E488D5808833B4572F33F8F1F16EC9B3D39752251D
-4705A1DB8C0CC00303009E3F579975C349BC7D65F96800125492A4E403980DF3
-0F2C10635079229D3299494384E31790FB8EB20D794AD2109901F04CDE3349E8
-74F7B11AAFB9B065D5500EE065D1449E239DD1DC750A972B94619115D33C1EA8
-52F008122DFC01D817151DAA25E8DC205570ACE6D517909EBA939D6D42C2BD3E
-9660623863F1E71A1B3E35C11E052B1F48D1E3B018BF59974B6AADABF071D73C
-81EC636C7E38F42D2DE83B19C5F1FA269C87FCA0E37C9FD8EA0C65550CAC8E0A
-BA94513945FE5F41312A32B82B4DAF5EAAE8FBA4528378AFC8EC517B550659BA
-038511B03D1A79D6617B15E8DFE0B4F81BCB7441459A36D89EBD6DA56F9B9262
-B0B4924AB677180A862F679EAC026B3DD1654F683E1A0DA3C72D373A75664D90
-4D4CED7E1E864E8A7454FDDAA411FABE99DA356A087EBAD461DA5DE313601C3D
-1179ACC18943AC096001B8D275AE0E022E34B856210601CA71FCA1AB7671688F
-CBBFA2BA9F7A9F9009EE474C4FD1F46AF04CB920EEE7BF44D980A7A45AC3C48D
-4C8CFE73E71096DD6DA6B7B7BB84345E98B0D35E9C112519401B63040C843CDD
-71C0E96586C51BB322F478D5C0E1A070A604C2AD91F6744CBD484B6506064CFB
-1200CD55434AEE45A9E2BC24B04B3C5387BEFFC79C059DB11F36696627B55444
-F99C310787585BB9C6B44FC96AD2887E830C2CC6E9DCC6B0BE5A0706205ECD35
-DFB68F56302EB865744E7EF868D0AAD911C292232232C8C48E0F502219E1BE68
-43467927647F2EE75A3D7C75319A694CB05CF5669D1BABD0BCCA6657A40FE9D6
-42A39E8D98158CA844BD8147A8EA188E4C99B2CAABF202717DD0FFBF6C50DBA2
-810D37FB016A670658CBB01F472D35C2D6D26E9AC53AEB455AB291032DD3C942
-4AB932835E4F3A719192DBED1AE5456E9C3CDB489AEB5C34C38D9FDC2285C687
-4891EBFC6CB634B973D33B67A5628712F3CDA48C64684D0133C42375EF15847B
-7E66CE7D356A252494F2AA57229575413BE5B2C8C11777B9C890F782A403D624
-011A8F303C2E1523DD22020F74388B741B4B3F6637F2B87AE70CDB045042C7DC
-05F0842FD0416DE91DBDC93E41DB1F530253848F21FB9063BEA95F52B1C6245A
-9F2596EA88B2D149A4214D4D57ED7B19C1F9D2857ECE2746F787C8AA3A2F8160
-C5D031E98B7F514F69AEDD800F687924AD0F997768E31DD642C568E88B2EF953
-CEA769065D5EC23018BCB7A66909F7D1F6C6240C79D9D680779A11FAB7882B4F
-CEBB69FE1E4A4CE4F60D2EC233CD04E816C471F7EC92B8DD4D0D28E569915B28
-5B5386F91EE0D4598578209C9D2CB4AF10530B92B89A28568AC2C6B72781F451
-503D6D65DEF810CD8B391735F0206441B51E685BA168DBD9D6B67A7F70FCF6A2
-942D5F1BC2CB6948B04BF14E6541DE769DD9E1908A609070B5017849B98E9376
-ABD29965DD34E25EA11BC8FB58D22E4FCDBFB1EC136F62DA08B852529BBB70FE
-2BF34826AE45E12E225F67478AADBEAC83E4EDF9FB18B132AE91727955C8BE84
-497C5E842B3624620468949FF85758C43442C8E0E7E8A540A4D880A00FA8A671
-3374FBBFCAAE6195C602FB46CE0DF09C1FB1BFF5FEF124F71B5AB4B33F362837
-DF20B411B92BD3179A1A15759E04304ADA03F7E939DEF25232CAD34A63B209AC
-175551CB47A40D02C46BA392A1800B70DC31CEA717C749D8CD13AED86825CBC9
-B329C0DEBDFD38C52CD196A17A111C1215D2F53AA8E2539493A04E135E4C36D2
-AE9198124DC59A955C52A87B0DE79AED89DBA12FC5B690B5856590C25588D417
-2ADF8F8FAF41F4CC5F80465326869683B1A76BA4B70FE8896E8DAD1AFBC39CF5
-3634CD72161E6F32BC683247FABC73DDA8920B58768B3217326DC14D7FCF1D9C
-C2D1E21419C5C6048D5F5645CDE71CA0531017B9D13D884550C4638B7EDF4B8F
-6DCE66B6373E10D12A9E464DEA8DA027A0B4FCAB93E00D66574F274F38659421
-86FA580EFBAB5369A0B993E21ACE3CB981A0D81ED35D4C85AAA3CB3AD7AEAF15
-44D76669FD6FAEBBEB1853EA91395C987DFB698EA66942A361C3C9C85F18D977
-EF5D23494701CD3168F89304C7225E4B1DBA897C8877AEA466EFA28D432941CC
-A2EC76DF0F2BFB13872E7D74F30C54405E0D2F0CD4A2ACEEC5142CB2CD3CEC4D
-6B9BBC57A29334693DCF56AB811C2511288BF35A7D71D0F6BA8943F20E32EC97
-D3656357C236817EE9E0D79949BE6308C860A6A0A09779C9E665F6F1B8FE7E3E
-521953A392DBF1CC7842F0DC7E0B2318BC9B2A7497FD7E03113C5AA8BC57EE07
-D954A2F7769FEAAF0BECB0A8979C25E3ABC66642DC9901FCC7E042CA3160B86C
-009116E9F48E97D0E0DA4055B56F9C232E9F0A53D56640DA208DFBF120087126
-FDB8FF1CCE56D441297F75EDF72C850B94357D259B1B541AEC7195371029F11E
-05CCE7CA6F7B37DE32E3D57D7B2023AED06719A6CA86046EFBD73040257E6D2E
-84CCAB10D436E31FF5BB3BFEDA10FEFBBDC570519A40B5CC2A47B0B9125F377B
-CA6D595E53D78D473D55C401B59BEB1D2BF3320DFD86BF96FAB726F04C54814E
-95B7FC219F41E49C51D2EE729DF2EC25F17F479E4224A218707222BA1E6F1DEC
-5A88F68A0DB91D026512C03C8E2D68E15A2AFDDF14291B2B0E30A69724E591B8
-21CBCC6BEEAE606D6AF61A8548AA616C94BE4DD133B687D5D530C4ED2DC1F78A
-0D821D05780550B53CF3F60BB44AB6F55A6CB0AE724A67C304A2611B36B61887
-54D653E2A1E5971AC927C631039B6614DE619DCB988CDB2FBC4FDD342777EAEE
-3B3964843B10E04BA4EFA6011F32FED117ECDC89AA1D466C6B96E5C75EA802F0
-5F661A0401DE68EB137FBA91A0B6C7AB28B730EE6AE1799B6508F145426473CB
-27C07AAE26F88FCF4DE67DEFFEE6D572AC8738DA47CB7D85A9850A47FDBE0D59
-A6339CF283CF6DA940F7533BE0E88182DB993020B7152C691B0EDABD05BFE98D
-AB2AADC47F672119B4199617686A07D6D48AE044735AFEEA407B87858309FAF4
-EAB9826CE2C17A8C50F99354006E0631AA6088C5749BF180A18A2949608BF51C
-1EE095BEB8E1A22BACD90CA184114CDEC7DA1C5FC1AD105D964EF93B1ABE0E42
-A426E2127595F763CD6A1FAB0F467D23C6D16149E490D1EA817E1F7674980AD0
-EF2CF7F0153BBFF536C0E1343377D94AD7D2045DC3CE439ABC864E2AFB61DA5E
-7AE11402522F482765AC10FD050BA031F757969F691D256D982FE002BA38B4B7
-46DDDFD808F68C8AA006788F2BB79BDD080EC8A64E88CD550239434964E8107E
-72CBF45CAFEB538DC668B455F6A017FE471E7EFDC12A348A7F193D54B3A9A84F
-A7B9E44CB76BEAEB7FEDAF001B0C2802C0CAC32A12FB212CFAEEB60FB752E46D
-979017DED77BC42E2D86BB2B0A5BD652EFA9B34975E0AFE4AF60CE1F671459E0
-DA94C01A6888D97074DBEC3C417B769D97B9320E2C9B2C5B773271C8C6325F61
-9E1CF227C194A0B7D58B45677FD3BAF018342E7009958D2DAE28A600700A7588
-0EF66981674D173207EAD09E7EDF88149A50CCD92B85D983A865CD2A37E3FDF6
-510B48DC3A7FB92537673D2AD596142C77C7CE88DCF8610329E1911C6917452B
-8BE292384C63A614908D66A7A2F810DB0FDA4BE3DB35E35DB499C5E62EB5E569
-13AA4D661EAEBD652D1B3EE727D3D5B519E9C39FF8C6A8BB49C1CBB065FF0ABE
-7E1326995761F7510D5946F8A89565431E74B881FDD89CDE7860FFC35C0DA56C
-FCDBFEBD10FADD9FDE25392BDD66139ECF9A5F9F957FB14846F15732A08ABBA5
-824FFCD45F469D255A6BBA850DB97A1C2C57771873D179EF07DBC892C0E9D57A
-9411B6867F5216AB0C9C5967D2A0385C6FF36015603ADBC55C392A3326FD5AE9
-1918306B4048EE8CDBE2D031389D58060B25068C90A224989E496DA34E3BC0C0
-159FD3CC18864578F00B62B531404A2DB3E302D141821364ACB96B20211D0861
-A317DEB0A50EC081966F1D4CBB545C4E5BD53085144E9DC276CD145235ABF328
-924475A52852554909E8AF80B82F22D33906EDA1FCB05630036CE7B64822F32B
-8C8885B698AF4283994B86E31C065FDC6DA3121EA730698EC23092E77CE54E52
-589B2641A412C8213775385DB7E87C7455EE01479A6D637F895F9582ACC5CD04
-E332D5D850CD59D9B64FC7340660C7084529E7C43CDB08905F3558BD3D26B0B7
-F5A52D921292D8CC7E8ECDEE34E5BFE90C80E4D238B6EC6F22443B5D5AAE5F53
-18D8639F8F0857E4E3889447E4A70B547166FF5035F47B663FCBC534E171DFCD
-447507D0EEE98683A1CA1B3A12D4CAF7FD94AA6FDABE0728AD0E2D85D0017CB3
-B17BC17DBAF2D4291B3D687D1DAD9252A0D85A72BB55E726DEBB62B6E58A632D
-097362BCC762F51A12919BDCA0E332CA64169A63270EA95AC0F3499032803622
-C585E9FA20327353B62C1DCB292F87CC4678C1F19B4280A4B363F2C9CEA2646F
-3AF1D021812422D3B10CCC08447AA230CEBED1D861E96B312C4FFA4B4DE51F40
-10EB8CB178D583FC6F3B89F3F344C6A1F2B3BCE71CAD7097528159142CA8AD04
-F7B97F6AB96B2F3AC1C3931D0E5DDFA34CAE46D4165ECCC5EF2B24AF78A39979
-7CB293F1D508F5025B34029F572EE22A01B2A575D3C45508B7E562C2AEF7FDEA
-0B58797F20E5D8E2554E5DBFFAB010A82D71C9AB6D58C2A97301A43BF0B2E0D2
-E6AC020EFC2C10889C5063E4F0AEB56398AA92BD045035C6535B2BBE47D2C569
-9BC105DE17FC24FEBDB9B4E4B2B5C71AA3A08A835C9D8F757537EDD33BDEE69B
-8ADB5C14FECBDAA26FE326B38EC7A38C1612DE29F19D5256B9ED80AFB51D722F
-12971EE46C47F4B382439006C52DC0D458A3B6CD529955090BDF44D915942061
-30B91847F2BF79AE62ABB7655DE0DABF5373B4B65271B6F0C9C495054FAFD27E
-E6BCD9A061661004EDDE73749121698F90080D31E850D857EA7AD53B39EEB510
-D47A7A3524DDE138FC008D8147D4C9F5CF9F147F481AE5B801D151EBA3AECEBD
-B0D1D4E07E39634874AA9F64665F88680E9775B79F5D1EBFCB637DF765942E70
-34383CCD76D7F2E44F21882320A5ACBB4D22E52DEC5DF736317E7D449D148540
-38BF5B27253E650E0ED93E39A86F9EADA44884775FD8A86E0C832219EC0CA5E9
-B92227F8C91F173690BBF38B5165FE404E232FB06FC30AC489E51C3FA95F7CFF
-E580FA0465FEFC8C1E6AE32AE4A3B8396536AA552A4303815C5B54D2991EE9E8
-E8018A94F1732C04E570C9CFAA67AF4B650B30ACC51F33D22EDE53543C801605
-3C468B86B650EDC223082994BBD0B5DCAA8DAF3FE20E5412A49243B77E10140C
-9DCAE1AB0545AC999C84491DAC7076758211F0541FD116ECE6C883866B997555
-D979B18805AECF2649B8477AEB4CDF0BE281A87CCCAB7E42B02BA27C6AE72833
-95343994EA87C4758B1ED92E45807EA69D7528141D1C8635837F503A8166936F
-06DD9FD7DC588B83BF69959828D8CA16777EDAF19EE9A6893B03629B85510538
-EE4E4C19E0CFD823CE4E4CE5A228772E153244A8B1F146D6B61D8A23B6C6EC15
-847EBE71321D37EC4C8E6899E9B6886008F1D2E385835B76251259EE6B5A7F23
-4B0B8D01D309B181C618E73DDC3805BE5DF5DBED5BF438C0245CFDBC423B5739
-1A38144B3BE81A10538FE43A80D1198E17392DA030531A14D44EF55807DBDCF2
-3240CCBFE1B0B779C13C86E72BDEF5C5FB3E12F0BD1EDF0DFA9A57277D0C293A
-572FA52098BE23D2AC05BCDC49D6F17D33E5D36021BEA557C01FD89E1B60E38B
-269BB02F34734109536513A2336E995F084741F7BE1F692A271DD9A86F8AF349
-E1111EDB3D180AB4319F918D12DACB92ACAB5780B23BCEC7F572709514340C19
-6E8063C1D5B9ED6ACB64886AACB7DC0DF4E8E9CDBCDB747F63D4EE76E81C2E9C
-73C7DF1055BF66508E90FF17A67A9D8981818ABCB0F13456139AE3C089990656
-B6CD3ABC7C91C18D8DB5EBD176004DCB2A6E333E7C3C23BA613473042403AB9E
-CAE6DC60142209D3B1B6B4390D4F190289FD7187EFE19F177666322390F1F2AE
-935816B4AC6E8D4EEED18ED3E8602E2474E533FBFCBE6538C6DEB954925227E1
-927F70F4D04F1AB2980BAE6D2D1EB902C2CF0B94EBE608DF98A66FC23A2AD835
-1D6CF30C837B86AC1CFF082ED075569A43431B2C9F3485629415641800033F30
-B4AFC0045627FB8B02DBB5124EE034BF433562896219D08801D8BE18076AE95E
-B2F71C3D91717C6D67E482F2A75949778B7762B5969C306597D3E7DE1A2E0789
-4C2E05719FD56E7B5A00297236F7E64FC1078E6A13509E40F87C7B35D95B8E77
-44BBFA83901FB3B367D76BAC58E350189B08A9CD3B3C2CAC63EC563983BB5DA1
-12DB3D76CCB26D33AC5D6667575100A99CB34C9758FFBC6A2205FEA06113430B
-9E5D469FA4B52FF994EA44EB45EAF43C200AF3900FC544C2E87EA173F6F5306B
-276A5DDAF7077463F77AFC425A39C5468577E817F6937F2EE11F4F482DA3B5D8
-0A37D117A42DD4CA2B68905DF8E7FA3E255A1B944FB8F4EF4D9028872EF2D312
-A6DAA6330ABEC442BFDE476CF3B1BF1EC74AE785DD0E254FEB37AC0180DE1323
-C66D5DCCAE570E8CD0906FB2C30EE2A503560232E70550B287D1BDB534E5823F
-070F7B927237C12F7078E5308420515140B95A3E79B03D173E8B58EE20C13B8A
-1750DB02FA19ADA4486BF57E2AA639DD17871EFB0515FEDC0BC48F05EA63661F
-26C127DDF12168592D937549F3519242DF0090EA4C062DC032DE74EC23178994
-2A8F993B7E3BC8B818D7F1B33576A555EAB7B3EDF7C15E5C6AFE52D40D87EF92
-F8F0A187EC4D04C74A273B1B3C3669929159552CBD372DC51CEC0D003E88C491
-CD8ED174310E9A52ADEAF358C38DA297352C5F01B9F3663F8856B2492678D77D
-ED585A6DFFF14C996E12020BDC73E8EC9CB2989F0A43665F7EC189B458EDBFC4
-44FB54318E3EEE3D9914C1F8DF58F65DF9B57879C1DB3207F4C22242FE0CA876
-D8D19BFD1CEC28F5C91DB738F0588B8D9049B9D207BF061AB96986A1F071C4FF
-318B04B7B781566D9E4C51EFBAC1C686F9D4936BB28B7D95EC0C3847B1083334
-A9DF01C414AA1B465EC0B000B24C5B63C86497F3AEF237D708BCFE837B26BD39
-7C30FFABF50A06464524110C7D1F68861F460E1CEE0ADADB4608B8EFEBAB5802
-190CAA2C19483F47142B0BF3CE37C0B314E42DF72754D2F5E36981954DC5A6DA
-F823A984C802BCB03F17C1061353452F49A7B7EC4EBFE24161ED71BD85EDD6CD
-AC5D9AFDE544FD71C2169F06432F88A9781F9B5CF004BBC084BF518886395FC7
-FB58308F1F43496EA1B46B0AFB2F35354BD131F50BEABF18FB86175D1CE7A14E
-D3F18D19EAEA4BD0B4D7746B2598119455A51C1066C3C822986B6997FC76E337
-BDBC15BF95CA7BEC99F8472B68BB2E8B6FFEB59B9F6475B727B63AB628ACB47B
-C438EB30B8CD350A30371037AFEB6AA99AAB22E97EAB63A28AA67AE010103915
-32F3258CDBDF27EBB381ABD27BBBC47F98EBDB6CC91AE6A6593710A243C55A50
-C6F01396855EC30AADF5066A5CB4A6BEEAB87D85B6CAEACBF121B18C0D6773D9
-1E0A051AA4330E34FF66CAD0B636BA97E396DE3964CB8C510C096BA3D9F763C4
-F857924349C792F28E2D0854BE62C3CCFAB054965FD18F420BA29D8A7EB25787
-E7ADA9B0B5CE600FAD7DFCDFE98CF7EADBE7EEE849720BC5AEF8CE425A488EBE
-60518A16B0254C6E3C9D23BF2B813630262C7C6150E7A01B2A90B458CB4D5920
-696A0A706E53E669657AE1E0362BE66B19C34BE6B1B4546DBE2817043454BF86
-3F1650BA9AEDB4E24434662C53DDC1977DA288471CE0A760B7F4
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMMI10
-%!PS-AdobeFont-1.1: CMMI10 1.100
-%%CreationDate: 1996 Jul 23 07:53:57
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.100) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMMI10) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Medium) readonly def
-/ItalicAngle -14.04 def
-/isFixedPitch false def
-end readonly def
-/FontName /CMMI10 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-32 -250 1048 750}readonly def
-/UniqueID 5087385 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA0529731C99A784CCBE85B4993B2EEBDE
-3B12D472B7CF54651EF21185116A69AB1096ED4BAD2F646635E019B6417CC77B
-532F85D811C70D1429A19A5307EF63EB5C5E02C89FC6C20F6D9D89E7D91FE470
-B72BEFDA23F5DF76BE05AF4CE93137A219ED8A04A9D7D6FDF37E6B7FCDE0D90B
-986423E5960A5D9FBB4C956556E8DF90CBFAEC476FA36FD9A5C8175C9AF513FE
-D919C2DDD26BDC0D99398B9F4D03D5993DFC0930297866E1CD0A319B6B1FD958
-9E394A533A081C36D456A09920001A3D2199583EB9B84B4DEE08E3D12939E321
-990CD249827D9648574955F61BAAA11263A91B6C3D47A5190165B0C25ABF6D3E
-6EC187E4B05182126BB0D0323D943170B795255260F9FD25F2248D04F45DFBFB
-DEF7FF8B19BFEF637B210018AE02572B389B3F76282BEB29CC301905D388C721
-59616893E774413F48DE0B408BC66DCE3FE17CB9F84D205839D58014D6A88823
-D9320AE93AF96D97A02C4D5A2BB2B8C7925C4578003959C46E3CE1A2F0EAC4BF
-8B9B325E46435BDE60BC54D72BC8ACB5C0A34413AC87045DC7B84646A324B808
-6FD8E34217213E131C3B1510415CE45420688ED9C1D27890EC68BD7C1235FAF9
-1DAB3A369DD2FC3BE5CF9655C7B7EDA7361D7E05E5831B6B8E2EEC542A7B38EE
-03BE4BAC6079D038ACB3C7C916279764547C2D51976BABA94BA9866D79F13909
-95AA39B0F03103A07CBDF441B8C5669F729020AF284B7FF52A29C6255FCAACF1
-74109050FBA2602E72593FBCBFC26E726EE4AEF97B7632BC4F5F353B5C67FED2
-3EA752A4A57B8F7FEFF1D7341D895F0A3A0BE1D8E3391970457A967EFF84F6D8
-47750B1145B8CC5BD96EE7AA99DDC9E06939E383BDA41175233D58AD263EBF19
-AFC0E2F840512D321166547B306C592B8A01E1FA2564B9A26DAC14256414E4C8
-42616728D918C74D13C349F4186EC7B9708B86467425A6FDB3A396562F7EE4D8
-40B43621744CF8A23A6E532649B66C2A0002DD04F8F39618E4F572819DD34837
-B5A08E643FDCA1505AF6A1FA3DDFD1FA758013CAED8ACDDBBB334D664DFF5B53
-9560176676ABB71BBD0EE56B4CC492C0652750227CEC70705209555AF57651B4
-2E6F62F4E75D68A882364F7DB4B647C489B46E0677D3AFC159A2E79E4EC4F6D5
-C92F528D4B79A73A30A8322518DB097D307D25048DFFA5D2D1C60BA5FA590EDB
-6564A9C890549CC4D9459ED5BC94191E7327E0DFD8002A501C0C611093EDD0CD
-C4AE45BEDEAC39AE792433001E424DE29CBD2E3D57AB5E51F2C3CB657ED44B2D
-D66A47C06A0C219618CFF1D11F7041077A243000646DAB8528D5946E66383A21
-DD4070ADE71687BAD5F0D2EBB80C2D7F68F7FAD136F7B6B67809917243DF769C
-1BAC8C4D9E26D4935FAC978E86A1D1CF8FFFE4990C930DA1F2FB2A0988E51CD1
-281CB61FD92CC8EBCF
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMBX10
-%!PS-AdobeFont-1.1: CMBX10 1.00B
-%%CreationDate: 1992 Feb 19 19:54:06
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.00B) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMBX10) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Bold) readonly def
-/ItalicAngle 0 def
-/isFixedPitch false def
-end readonly def
-/FontName /CMBX10 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-301 -250 1164 946}readonly def
-/UniqueID 5000768 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA052A014267B7904EB3C0D3BD0B83D891
-016CA6CA4B712ADEB258FAAB9A130EE605E61F77FC1B738ABC7C51CD46EF8171
-9098D5FEE67660E69A7AB91B58F29A4D79E57022F783EB0FBBB6D4F4EC35014F
-D2DECBA99459A4C59DF0C6EBA150284454E707DC2100C15B76B4C19B84363758
-469A6C558785B226332152109871A9883487DD7710949204DDCF837E6A8708B8
-2BDBF16FBC7512FAA308A093FE5F00F963068B8B731A88D7740B0DDAED1B3F82
-7DB9DFB4372D3935C286E39EE7AC9FB6A9B5CE4D2FAE1BC0E55AE02BFC464378
-77B9F65C23E3BAB41EFAE344DDC9AB1B3CCBC0618290D83DC756F9D5BEFECB18
-2DB0E39997F264D408BD076F65A50E7E94C9C88D849AB2E92005CFA316ACCD91
-FF524AAD7262B10351C50EBAD08FB4CD55D2E369F6E836C82C591606E1E5C73F
-DE3FA3CAD272C67C6CBF43B66FE4B8677DAFEEA19288428D07FEB1F4001BAA68
-7AAD6DDBE432714E799CFA49D8A1A128F32E8B280524BC8041F1E64ECE4053C4
-9F0AEC699A75B827002E9F95826DB3F643338F858011008E338A899020962176
-CF66A62E3AEF046D91C88C87DEB03CE6CCDF4FB651990F0E86D17409F121773D
-6877DF0085DFB269A3C07AA6660419BD0F0EF3C53DA2318BA1860AB34E28BAC6
-E82DDB1C43E5203AC9DF9277098F2E42C0F7BD03C6D90B629DE97730245B8E8E
-8903B9225098079C55A37E4E59AE2A9E36B6349FA2C09BB1F5F4433E4EEFC75E
-3F9830EB085E7E6FBE2666AC5A398C2DF228062ACF9FCA5656390A15837C4A99
-EC3740D873CFEF2E248B44CA134693A782594DD0692B4DBF1F16C4CDECA692C4
-0E44FDBEF704101118BC53575BF22731E7F7717934AD715AC33B5D3679B784C9
-4046E6CD3C0AD80ED1F65626B14E33CFDA6EB2825DC444FA6208BA8442C2FB5A
-696E7E21859EBFBFA7CD4EB0C76171CA80918BB7B7101740C0BC82DB66852575
-F0A73AFAC56EC980C4045BAFEBBA7B5939EDF6D38EB52A4B88828D97DCFDFF48
-18C925FAFD5FC8CAE4AF1980E8F35CE170D31F2B1669F9839FA2646BDCC70E86
-98B905B9CD7FE4F2F92D1127DB031F0A2F6E38A2A32415DA33C79E81684C7DDD
-6E260679732A2D20D6BDE27B65F9176558D8B65362F61FD87D9D742336A93039
-AF47F5F3FD6ED94DC2FD9C5DEB0FEC3581E275BC94ECEB7B517E88F6126B8A39
-2F963B8186EE2454E318F5CC571A951409B0E69BB7A86971A05AF4F329B3BF19
-7F1CE08A4D8635BC8BADD348D12AE567FF26A95D677617CAEE4CA4B282C8E1BC
-D4D66958AA329DDE6CAB90B3FE38E49F75EC083CE8A49285A45B4BE4AAB05AF4
-C971DE2097309D26995CDFC3B366F7A7F361F9470E8C548EDB3CA0CF7B4C1549
-5DF5B8A875950FCA3CA294A4D999A312A075FE82E60F8F5E078FD9554AD5FF1B
-3B6977E3062D3DF6FF094944AE4AA939D6C253F4D15F219219825BEA068392E9
-EC101ECFD97654CB959F9AB2CCB8752C341604BF43CC7423F36FFB6897FDFA0F
-4247CB3781BAB367BB79E69C05F415CDF75CA4EB11167F2B2504EE906FFD3EBA
-2FBCB0CBC46A06499CDE099D1C4E462A59235F808BFBF83C44EC8280292E97FA
-0126ECA430CDF257559BF52CCF2D3CC73ABA81659A155C7FA22B15E6DAC8C7C4
-6823E50E8961F05D37843BD0A3F350CC6C62B2DCB90A0EED18069A047975C48F
-31EBF2453FB7F04A266A904A25F16A0B10BCD3A82F916316CD3DFD80541C9124
-F8C7E247623F234759328063E40450C9DD46F5AF536A3AD35E6BBD1016B3D345
-EF77D08D353265AFF5CDD3E65A9ACE024764FE26323A6D87651C8D3DD74A734A
-5DA4CF6B02CF76A61B7CFFF1C1B61F429DD053FB81F7849CD7930B941246DE6F
-66F250E08C1ED841EC3C21C0E5DB81E80EBBCCDD5AEF2BEB305F66A760A98BB2
-DDFAE8FC0A3C5215B67240AECEAAFFCDA4EBDEA61FBE97AFCFBCB72020CC7DA2
-D27FA0A1283708A9EF10AAC7AC325E23A5305A9C52E80ADE6F9069385E661335
-40D93341B97E253FBBAB65757CDFDC64091CDDFFAE2B6EC1B9FB1F73450902E6
-8FFE5F9B24488D7DC6AB23216C21F7B5F9FD436FF57BD4F60CCA33F27F7D0B4F
-9373740113FC9AA64E8E8F21BFB175576CD9B6D3D529A2FD64E630C3B4BC8AE4
-F1DA6AEA8EB784E105014687E2D7B58EDB7020F18E121B6BEF1F7240CAC29B07
-E7E8B6A1A6E80133A81B9B3B9C78A4FAA1F54CB727F1CAA1AD7744F5EE03DBB3
-920D8A5B087CACA471D52DF777E549C92A0AC1506FA48FC448450D086784945F
-4C1100098203345F3BCE2AE1FB5B7C6579B91C8D96290AD99F333000A1C363DD
-19079BA315BAE6C336FC5C32D2E7F9A6981C9CFB6A1DCF2AA56106C601886015
-B2233D128313C9B6FD44FA3C677C4B985F9F1F690129EBDF41BA1779F517C0E8
-B59E5A80C4654D655852F29806C80D6A627AC2A9706D208FEF55DE1E9689FAB1
-7864E7869BBA521729FB0C4193A3CF7AB0E7B411B355341EFD92F7AC1BBD0948
-5A88DA898A01F2EC4180663C58849CE5A1CFCB7FE179B783F37D296752C53BD9
-F892AE55FE5404F83C27C9DDD55139152BFE45471EF32A5B19AE299BD4939EC8
-EB45BF4BE1D815C4B1462F0107DB0A9B9A22C8F7BAC70310FDEB98A2F7013A12
-E8C51E8B889523AB5E73FEC72252597C9159F9AA487E006D7DC8D6AA849BD47E
-2D2096BD7762B3329716E30DC7FEC2FEC110F5C54F38D8EF8CFC969E59F94018
-95B23DA928C0005BCACFF08258C9166922A3BCD7CD1105D85F513707F9028ADC
-93EF4E0F55AD1122CA97E92178AE57B62AF5E6D390AD2E14BEF59553B2FA4761
-29FB1F35E890C15D3881AD7B57115AEF76E6128CCB907E0E2BFD6D5B8235030F
-B0A1A35CB9E53586471EFECE5356C0E35A0273041105DB6FE1B45B5A61DD3EA6
-2823B8D0BD2331B8F64F350328EBC158940CE8429E0CAA8216F497A5A5430958
-C79D838EB67626BF62F1DD98965EEA0D4ECDB4BA15BFB5ED7F568410647938DB
-2B020FB30BA29333747EDCC6483469FBFD006F3CEA06B8E0E72B9263064CB5DD
-E42862F71EB87FC3AC5C433E3D05B06FC23B4A009F822A497591F8BD64C38A8C
-4CCD9B9D879523CF268259FDC13D62B48EAF12C8DE913FDE1B0321F2894AA0C2
-F0A248CBC17D7F6F075CAA012563D8C1C9BA623D360693BA2D1665F2B532BBBF
-51037DD7465E3B65E14A1F29B5A337EDBC1EEE2B957DD27F0BEA22C24B6DFA9B
-138FEED201FF4F40960BA8EDEDF5CBFCB0EB6886716ABD62ABB49F0834F45CF6
-11DD293FAB52BF02ED89197A7BD2D419BB1EDE1757A03F8388875AE484C1A075
-C72F40F5083A9B090C404036A3228FE6A397D2EBF6B2D01A99DF80A010A58EE2
-0CBD8DE33F94FBA4BC06D573C5F2BFF9045A803B1F8B2204F7F72F8A8BACF0A7
-A20CC6A3B888430782242DA75E7B868A94E5455C969C9CBA1C5F2AAE03A7199C
-84E71C606201AC873329F3EBF434FF4979CECF37F4A9D3E9B9AEF45F07ED1CDC
-73CD36A4A1153583314922C1066DDD5CE617B89ABD77E66A2718FAA7D625E27D
-F2BACE408AA579C8D4630FFAED670BD8BF9F31E8E2B102201F5A270FB3C86AA9
-F42F3E5DCB8F7708116B11610B6E7A898A0928D5FFECA4ABA5F87494EEC2FB4F
-AD93C0482B81A151BDF17C324C7EDC9268126AAD4E0B75B626FF0CE8FE8103ED
-E6AB1C9C5976D2C308ABD0FE5AF4290F893F3532C2F2D6F8AF7D885958590318
-07E7A7EFB79115CDA7AC1A3BBEF151135BFE012872D75C1AD3B738FD8377E2FF
-25C610D463F46630F9288F1A4A224638C110D73302CA98D973011F561BCC8900
-87BA0AAC381AB725ECBF902B3F109318F854D56E8E40EE825B828259981FAC09
-80027D7A874B6B2D77BA4A21BADB443AADA891C5EAC059DCF0D6276CC7C23D1C
-E0104F1FBD10CD49C73AC3721DDF358EA83D599CED87B42BB55F83623B78E1A2
-A15FF089BA5500773A0AA2A36D020F8272EEFE118BE67EC135107EB89FE8ED17
-C27B8C8EAE93D496A1187D5D59507DB228CF7E723A21B36130EF8CF41C289206
-AB7B3418E5751CC7DD4B20D0B9EEA3BB37EA52622AE47B9D6D2B8999178AE01D
-C21CF1410B3D460352659D5FEDE07B07461D71B0172E31D31E386CC73501A817
-409A8A2417EBF6CEEEF26A9A9E261990AACA42378302E471C83746724FF16749
-583DD4E0864717C7DEDEEEF1A7051D9D2DC642EB952C2E8A2DAE2FCB0D40CC86
-C58DD69A26AE12DF2E3F6E3E806F356C4837B9EE0E947AA2BE87056147E59980
-1290612C4BFFA4019EE6F7B5FC7E40E940BD865AE44C4154CCAEDD68C2C15AE9
-D87586E3F2ED54B2E5ED33237F7654A27F2F22FC6A7F701199A74F854120FD54
-7D63267425B4996CA56350CD8F5C00F91501D2C30E80C7C334EFB8453AA33252
-5EE39755AE56679E77FEE464612E8FB8B1DF87FB53EF61494CEDAD35B20E60C8
-59A3DFB19ACDEC79241D26F3B0BE939F7D726C2341888482D97E3EC677DE9521
-4D041B236FD16ECE3C46BB81BD3D5C3CB3FB272E06ADA1B04191C76440DD8449
-BD66A398F3F13933B2E7F3E578F01AA9AF1C9C500A2C8CC6EF720C819680B002
-EB6F71883A439D9556552C1E7DB39B31C1FED35EB112D76FA46B444F94C75002
-55CE4284198DDCA9C686693700B8EB63D33F1890C48E2720DE36076AC192F7E9
-704B593FF8949CA4806982FF6021CF4464792138D584FCF21AA38BF3F451DC2F
-EB998B1C50BC6236B3B63B1B8B1EBECB33882B79B8D1158814575C0A7DB7CC6B
-31D8FCD67DF257F0FF8A86485640E16255C4B008AAC06188B0ACB0F5E0672D34
-AB769B9622B5B592B2E697138020133D67887973CF668022F0D90046A88BC7ED
-CF19A3C6310CC20A5A48A08045F6ED9A9123558F913096A4FC86309F07C15A2B
-815AD926F9EA051BB546974136E7053042FDAB0A350E53E9C0808870FF9F4536
-53CC49600A0D645420CEA59C3CEE49341D8C4E82900B19B32568B09FEB665728
-E8D1C3E786A9E8574BBBFAC82F83A8C966CDD51C843DD6B1834D6C0BADC04AF6
-B587DEA65C6640D4D15985B84FED4C855BF4B6E61BCA9E61B138E9BAD58AF2C8
-3E6533D312A99610E9E1A81C6089E8F5825776C0DA810086CD0902637910C1C7
-F8124ED3EBDCEF5F209D3D803393508F7531ED748AD059155581EC7066C09F1E
-2DA8428C4F49A9016CAD752C1D6A0DBBCFAC369F9F98DE7D53507520E71B907D
-17A8E20784B6E6817CB2C3B8535715791B9FE4BD189F7636A691AB086F20B2F5
-53D48F5A1BEA8DD004721F4A1AB27C74E2CB861E82D02099BCA90DC49C3874E4
-87EC21DDC89C84FC6674523DF59D88CAD4787B0E043CD16CB327CC849149FF72
-B568ABDE19B8E8117E7A0008ECFD5D80F05E726A602CCE7FEAA50D497ACD5B5A
-F49A8B30AC5F8A157D14DA89487E7BE9F37E27629E2755017AC7077357BDBE91
-8D6D3FAB8C7E518B171DAF01D9595D81C912443B101F0593669B0D4A21C75C1A
-CCA6AB74E9B3FC6C1DBF5279F2D9028CAF6F74F46632147FD49EB86D9339C314
-D1104C40F259D12FA66BDF52EF10AAF7FFA991AF60DE7778B1CBDB851D0F86F1
-5CD31DE3082E623A37EE40B7A6A6B95D1E63F68C64E3661F87D1139ED66B0F23
-1A373B8D9E907B6EA9124FF5BDC9FD521CE9C9F0C78DEA70149362E4AC399322
-AA46473E2AB0E24128EA3FC3F6926E1B2BA0846FC2408856C80E8A1301B00720
-8E9594F1730127FA150CC8F0BC78FF4E377B83F850D1551D669A0188AD06B92A
-28F032E5E87E928C832E328A922E2F4FEF23C1DDC69586FB52E125D4E2ABBC1F
-AFF0278BD8CD1DAA3BCB119C51ED1D28AE2DACD56D59727BCED1BBE8206546D3
-CEA92798648F1DED2CD3129A3D22F312D1094F851EE3786AA948A0698E66C03A
-9A3355DA6FA41C1C163F5D132A9DB283E79AB6B936124BF4A2BDCA1A52DD4602
-A229F09268A4BFC2E4CCDA8B35697CEC90B783EE370622B897BAC15EE5B04F38
-F6426F60C469904E86E8290BCFE14A2CFA6CD1D9A622621227177BD30BB23150
-11EE73307A3A8C36FAC3B65116140916226A8E49FCE55FA3C0402C44FE179350
-DF27C76A0B7E69C53EBE6816A72148D72CC4EE4A94ABF65CED5F1C42B15CA603
-E0B3EBD83490BC384A8275AAE98FF267DA28627BB0D2BD57146F070BC183F476
-C5792D8A62FD6BF5928D6C3B283C73F9EEC0BB14C7AC5CDF6CB9136F3516A351
-7CEF58BC7D3423009F71F04355D787A1C6B1484322F717AF1EED59E2A56DF794
-42674F81794A621F2886638955C5865B623E26FD09053DF23CB322FF8F4DFDFF
-06B22954817620FB63FD3FFE15A5637F3CCB8240AAD956D23727AA2CA0623C6D
-E26ED1AEC0C0B434ED6765C1E47A15760B00E1A1CFE082C84FD90AEE53697D3F
-6B9AA1C64CD710B2D9B9971D8056C7D0276D4130102074085DE905E29994D5BA
-1B6FC69AADA9EF48F236AF56A4E152E350BC22D77E046070E3F3B6C0BAF14CDE
-74B55FD32E4CC9937EA9DFFF2699E6334E906FE5985AE36BC996240C9FB6F7F5
-FFA0B17E220FEE729D8CD42EB970795805E800B88027877960BAADA01694DFF4
-EE491A61B80D3F6A43BEF8B00D51F6E95E0B67010AA0BEE8E446311C79FF25CD
-8D6E592A095AEFD211F62BFCD969E0FB06E5F21C74B838F8CFD28D8E76158DD5
-6D073A64ED69A0D1D88F4E7A518565E04105C153D03A0427BD4BFE6695D27BB5
-FBE6842BA3D7D75C264F22ECAFABF8C1841367A2C6A5381A1707443164606B0A
-83C2CE8466173FD84FE0D51486BAF8AF925342C3DD48C39C1E011083C239533A
-EA33B44B9A16BABEBBC5074CA05FEAF48962332DE705AB47E6B66F03DBAC4934
-360E6520AB076959F3CEC83119115332F452B8B5B3B5711CC436E8832C3CBC27
-A0B788A9555B67AE2145DC547FF53A17E0969B03BE29173D2BB3617EC2167EE6
-C934B5660947B86260C814E44CAB0B641D0F939043C0C63F3D588372C664A7A7
-6169CECE33D3E29FC9F70E3048AF47DE5DC6EA5DDAC874660BD82CC68D2F9479
-E9540B2AAA1CC9A84AA8E666F422F2ED85B5F166789C1485736B3E584790FED5
-1B97CCB53BE427D99B7640C3823E6659BCD770D4D3E7E770FA80615CB7F7B384
-B809C4E9FACDB32FF844B9FFA00A6B29DF306AE6E9A4D2BC3F5B39FBD031C43F
-F756CE43170D6C404E24E6170239792652C6D7952118CC2491953EA5B7F98CBF
-D3E03A71D1A9ABAED114C7E09CE46D132A1A0919C8F42A81DCFE91D3
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMTI10
-%!PS-AdobeFont-1.1: CMTI10 1.00B
-%%CreationDate: 1992 Feb 19 19:56:16
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.00B) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMTI10) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Medium) readonly def
-/ItalicAngle -14.04 def
-/isFixedPitch false def
-end readonly def
-/FontName /CMTI10 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-163 -250 1146 969}readonly def
-/UniqueID 5000828 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA0529731C99A784CCBE85B4993B2EEBDE
-3B12D472B7CF54651EF21185116A69AB1096ED4BAD2F646635E019B6417CC77B
-532F85D811C70D1429A19A5307EF63EB5C5E02C89FC6C20F6D9D89E7D91FE470
-B72BEFDA23F5DF76BE05AF4CE93137A219ED8A04A9D7D6FDF37E6B7FCDE0D90B
-986423E5960A5D9FBB4C956556E8DF90CBFAEC476FA36FD9A5C8175C9AF513FE
-D919C2DDD26BDC0D99398B9F4D03D5993DFC0930297866E1CD0A319B6B1FD958
-9E3948FFB0B4E70F212EC976D65099D84E0D37A7A771C3101D6AD26A0513378F
-21EC3643079EECE0C9AB54B4772E5DCA82D0D4ACC7F42FB493AA04A3BF4A1BD6
-06ECE186315DBE9CFDCB1A0303E8D3E83027CD3AFA8F0BD466A8E8CA0E7164CF
-55B332FAD43482748DD4A1CB3F40CB1F5E67192B8216A0D8FE30F9F05BF016F5
-B5CC130A4B0796EE065495422FBA55BEE9BFD99D04464D987AC4D237C208FA86
-0B112E55CE7B3782A34BC22E3DE31755D9AFF19E490C8E43B85E17ECE87FA8B9
-1485831624D24F37C39BF9972D74E6EC4784727AC00B9C4A3AD3DA1C22BD6961
-7E0ADAF55422F22ACA5E4DCD4DF9FCD187A566B7FB661D0530454D0DD6C6C50A
-7A3875C6CBF8EC7769F32A1F3F7FC1C072BADEC97794D4E90E0035282A170402
-356E5A9CD9ABD80AC4342A5283E458A7269252F4541CBB6452B39ED54D336D0B
-19928E9CD1AB26AD83EB209E2EC75011A2643813053B5DBB0246097C4821B5F2
-C92554E9140BE35B2DBFCD98809A8EC9FC910FDE9E0D86457C70ACB056EBF90F
-244DC0A5BBD455E15D6E3180311D52CF50B0BF7D0A7F64F3A1821E0AEDBC2E7B
-AEB549FE1D51088C153799C6E089B5D5D65E1C4E2D2B430CDF1FFA23CCB25D95
-5C4C0A4F4995AB9FC821B1B553C7B589F0893BBC85EFC15FD2A1360E4BB3D051
-ADC2061B72302B58EDB8556D03FBEE3576F35486D2DEBDBAB0ADA7E680FE420C
-7368C5E731CD3B35D44599254A45B76119B19847881361091F0E4F77DB626B83
-0A357F0336017A1423F82AFFB57F9804830497C2C6C83A85A340D5D2472AE0E7
-425166E9591254AE4F45B4060F080C4EC92A953711D45B6F82B5A3EA5231FC9E
-4794896CAB73A2F2ACED52AF9D066794BEAF0EB7F3E3C576E45B9145C6614172
-A38A90C448FDC45A93697A4F8FC0033CE4D66EB5099DF3242E363DDA93BEB695
-CDFB109F708BB748E78BC3EDFD4E8F036B7A8E0B933723216C053851A681C77D
-AE71C9C8EDA1C1E01FED1A686EAFE3CB12F1E2FF149B02463596BD26783DEDD1
-D735DAC9E466646FBBFFAADEEC1277F9FBFCBF4B160F12C32FAE78D098507DFB
-F409AC799968DF1151F83AC0A94C4A033E8C93692F172514CC3AD0C5EA2C6E64
-928210BE563D4FCCF53E003CCD154066643C8190F4BE6266EA71688D6DB16248
-8763FDB07939C1D43487287D266EF1582F93C08CD4D91985F1C734DF16F2A740
-86075CB42E09F62FF768EFD891834C0DBC02BB592941848B4DFABDB690A615B3
-F17940D8ED5125118300715EA2CD3F36885AD45509FC3CF5D3E4F82442A03259
-E1F4F64E449892AEDEF424873D9F0A05E5499620D0698F4D12C25F19D6A4D06F
-29289F3B6BB2511DC1F0BC53732AE59F785CD851D30AFC3E6E6DC7BA850C1B52
-71D10F7BEB2652ED50E83830D9CBBA2A39A813FC25337A00F9E0CD6EC5FF55AD
-9E836D7CA369B2F3AAF8AFF7714589DDF03556DB9F7AF2094EF5AD0CD8C23DF8
-1D6ACA2AFC59CE3B18247D936F889486DBBB59B8D4F04E0C3EF87B7835892AC4
-8BA21AB58795BAAACFA1860A24C6CA59081F15148D64FABEFE8B1962CBB7CA8E
-0CFD713ECB9F3E2177D5F08D04A8C33534C20915E6CB2811ECDB90D4B2ED84FB
-24BEB3804931DA40F7B62F00F970D67333B0AF9E39F460B2690F89486DCB76F4
-7E46DC785BFD19300D416A809AAADC86CD415700D8ABF62C8D4BE6EA0990B1FE
-947FCCC4FA63F8ED2333857BDA3CDF21ACB7CB813B2ED9C4949CD0AFD9C8740A
-A193B2F0CC8368031C6F934ABF14715C8732BCF31B0B8BE3715EDC3DD9F3E2FB
-78FEB21823176987D0D80F4A8D211FEB625B1FD473B73B8CDAF123CC51265649
-65F7999CDA2C3EC073A0452D9BC1BE9908DF1BEBA2A7E78DD29F1C04F9C299D5
-DF651C65108EF858E15E3BD2C49BD67E41D267C178654E8B8E5DC714963B31E0
-DA12E138D0E3CC4FED89798296C41379BDE85C371FCD3DD7FBE07D1CFE0EF4F1
-7EE98006B3DDD027CCFAB270A3778E2723EA6E1D21F36155EA8F3A6408293CB8
-628975E21294B59B8EAFF496D5B5F2908A3E841AC519F3493D6B276AB9EAB52D
-08617E12E0ADCACFD1BAA267EE7FF31964D587517F11E3BB69006325666070D1
-4CB9E480A38044B3C6FF5988845114882D44C75A9FCA833213E2604EEF2788BC
-0EE9DBAF0657B12C2209BE192FD178184576D92B6EAD099A3AE94E06CEE9E3C5
-AA1D63D2BC485AE7EE9F04A7CC7AB93AEF119EB3BD8D6027B20C8F1EECF2544D
-8991A7514F3B291825434238ABC50E8655DCDD20284185AED9E43112721395BD
-FBB0C9DDA5291A595B396229481257988320D0EC9E017D89840C936C8519AC75
-A3A5198F782AC0C7647D49F7FC03940F5D9C0D1081985C5EBB8A0D161FF1F622
-6EABD40B1F68DB99154B4B608CC847BFD33B403CC105136CD5B8817A0C4F26D2
-FA75D956B99F5CD373D4FA9BD1074207F189E107C304D905C64A5419AB18F7C8
-7AB37D96ED5CDD2C2492AD2F30EE8F706C8325FF7DA066C30325C8E5C71AC446
-5D0964905AFEDACB2B008B016FEA4F58E5F410E1B4D4689A9731812352837CF4
-44818965AA6D52BC4160DB323B352220EEF930955B9E08AB7D0A9B95AEF5F6FC
-3B663D0B20A40C53503B118E180139949893063395FA111FEEEB0C8E3C0BD69F
-BEECF0FEE8049082FAAADDCCC2A1C3518A19378638A5352192398CC67695D84E
-4894BFACE7402AC5F4685E9C90C6409B1C9B948FBD412F1EB4F4AFF0ECB6B209
-D82D199A5B0824B20C280641BD6EF0EEEED3AF287EB69897D524D7C67F1E7F65
-A91F7F4BF3EE8540BEFE50E0E892FE82B64B3C5F2304F3E2EB92DEE1F404B939
-B06720D70D7EE51E23D3A29406342B11140852B96B1322F2A99CAC73BCF9D2F4
-CB677599565FD4DE689B109F6E260C6A9D34DB6A07E47EF1E8A7AEF05DB0A36D
-7134C682871A5934D10575FA74778E6D97D3F3FFFBF3855A9F8DF910C97E6C17
-94A38E2481D7E1527A2A618D58FF11E70490FC03F549764C04D8F24AEFDD8D8E
-CA0C15E2A2E0679EF66F425A3C55197B4D096FD5FE9F1AAC9CC16620017418C9
-56BD7532AB113187EB583745B16F2AC6A75602BB9E138E9D29347982F3A22C62
-DCB8A71D540A6D0C3ADD8F186E95E99C2F8F0125A2A78D974E88E2D946E39A36
-E5616610E46B5160183917EE976009B8AA4AB05C40EA7B44C6F6CC2A5FDBBE3C
-3F581D6B4A458277B3506B727CE042BCFBE6BC16FFFAE457BA0D22133A61721B
-7917348B53AF384FD0163307D795177D15F2B03990DE9F29D0FF34C6EC132390
-E9F47FD927B044AFA15DC3B12D812F8DEE162F3E32A5ADD161A25F0EC7795262
-682C615CFD421DB33AA2F8FDAEA78DD6F33AE00AB220A366F35186D563365344
-836A22485724796F80910D7824C8253CFE239067A265A5790AB009DD5EE2CAED
-ACEEF27CA9858AEFA6C39DF96222C8D0A6BA3CFC8DB96FA28426457DA226C3A0
-7D3F0C0333C391A0B08829DDE01E246F796B6CAACF13BBDD6D949E0632043D6D
-98143B278E9F8CF1CD12548C136306A9A13595F56319E122A143CCFF3D5C6D99
-0B7672D3A69F43D2683EE941C1ADBE767326194948E6BC402DECC0BC92BA7B79
-16B1F9F28A992DE608361F39B6A74EE9F5E461647C6C51BE369150951B8F9028
-685BE8342AB67165C3E833FF0D7106AE9B2F983C12EEFD9035CA4AFF96493DAC
-FD0422217AB24FE8D611D3CF58058BBFFEF504D3574416506051066423F83A98
-958E4667864BD2EF6FFCC27149AA27F472C713D302A6F65EA2F2EEA413EAB110
-13504B8B8A22493C1A2D9ABE2814200415C2DFC6CE767F6CE5443C74AA9DF000
-15A5BADC9F0B01A935ACD0FB49D431D01116292CC465AFDB4D870DEED42E99EA
-49E8A6E78C9B034858DE2DBC1EB6A6CD723CB504AFFE6C4F6AAC494D362B0CF1
-F5AA2476D98725B92EF876916351F4B0ACE36EA9F87D81AD5D9B78CC67739AB4
-65F17CC24005A4D2DD7DABCD0C12CDCF65462C3AB6BF3E4F7FDF3DD56743E6A1
-31B8EC4AC2CB9B07A6A324C6CF8299C67E77036A7FDAA1EB0EB85927E33A056C
-CFFF269E780DC56E27C924A2ADCAD680932768BA26E99E7BE7D703FA964E7425
-1D3436440B41DF08638628D072D02F357D41AE5B34499CAF433C89F70EA06061
-2749D560B5278A04424BAD2A18EFF876018160585D8EAFC157C9AA36AB2FC360
-7BE8ACBE3040E15749CD34C2930702CAF3404CD484A61222860FBF5B4BFB093C
-6111FA1CAE07528270E52CCCA742FB6419A590B55A429354B340064455FB8F8F
-F47C365932DCDC6560EA96EA7F540640988BCF07A6FF2574EDBC5D250A885C5C
-20EEAAB7384112516EEB9722FF2620B64C7A46723C2116F096B634806C145A04
-DA10D2B332943EEC74B7322AFD7B0893CDA309D5AC6FFC0D775BFEE136480A12
-B5AF10E2C32CDB9C5A85B04C9D2546499DF87CD3AF638740BD879401C2C3C923
-5F45ACA10B0B2C036773078248A9A8E49290E19DAA463A44D944EDDB0EE0F694
-8BC19A918A2A6405A2C08127E78586D54E8ACACDAA0738BA6C0616EA90FFCE18
-5383470FBBC1FB8F7A9448C85BF00F7A07CE543853CBC7164FF89B9FEBDDB845
-0893B0A1EFB863FB3A2141E49A7BA949E80D9ABB76183BB37D5F08A93636F4A6
-40EBA0D805B9FF1E379FB44A01E1FA09B37F3406B9FED491A17411B047D062A9
-2CB49E52AC6D92DCDB458A9D1A15E284A55DBBEB1D33DDC8C2E9B16A1288F308
-CCF623C29EE123396D4BE8E927FC12D8E9188C41CA66CFFC8033E018E7A81B46
-9C2A2B0949A6B1E63EB3943A6D3A0D3C8E4268CFD5C550203A23209ECCA92D95
-4E71738B1A7BB068F584281B0C8EC5AB56003E38B6AFB30B1BC78E353351AF01
-0E144B3CCEBAE4ED2407C9A6E7B950F5EA34EFABCE84F3F0668A5D6F5B9EEDFD
-9FEECC32E9941A3E9E4CA76FCA765468462B908F13AA619CAA22F446C28188FA
-A304795B0EB13877C467BF5E06FD41094EC880A894128E82A14046C92DADF82A
-25F36E490315FCEC7ED0A13DE0B89EDB37391E812C7E18D223D56FAD1C53B87D
-E222380D0CAA20627E9A36AB04ACB147982192BDCECBB31AEC669A97CCD768C6
-F15FB020CD8255B7195D6F3E86892EC1D46B905F3CBA8173959738C73506F39C
-63AD92781FCA814D780104C1A9C9E618F9A84D683F052084BD2FA802E52CC99A
-3C209A64D1CB310677C4BED3E4223767EA7A1F5D1FB0B58DF4E7D1BC2610F9A0
-1889C1717DDE6D328029AB71A4A53A4DC62948E49158BC5D257EA6793DD5D92B
-3838A081B871E748FF7299388D9B56499662F59B846B7AB5E5FE33FBC7856789
-811C42A3FC4258358DA8E7275DD14A0EDFFFDCB011CCC679981EF1AC0B4DE50D
-CF6D7A599C4846EF52895B0E6E68542B9E49AFB0FEFDDD1A0E91D762648CAFEB
-F385191667DA5B90DD8082B030E6BB6A632C1F675D708DCCBD49E412602B2981
-31EAD7295A7A5776A97AA84F259A004A69D142F753CDAED19C11F7C53C91334B
-40FE0493D92CBBBAC195DBEEDA84EF292DE931B85AFAADA0FB658FAD05BD653B
-1351039E091E7193BB0D26C2386469B91B81339C36A6072BC6602CC23DAB3D58
-2944C0FDD50679177AABBD7614C52040F88704845C9923FCD255213E289A8E64
-AC4CB6B33B5684C2DE016A4EABAFCD9F1ECF0308DDE955E1475347CB455403C1
-E35053BDD0EF9AE42DB5A0F392941A10F3D97A121D2EFD1FD55A743694E68BA8
-3D9C8FCEAAF587953253D27C573B5BCE097A83A95660E3730A32713A3C669F67
-D21EC9EE98BD9EE92921B06CF6302537BF7A1818A9F39F5F44755539B6819730
-C4B626BDC83B46AB5DA1FC08D8AE85FCECA41893507FDF0975A15E88480867FE
-280EEFE6E8CFA2B67606EEF3A1DEBF46D332225A8B4F6B9DA46F6F114A352DC3
-F5B641D507F8661EB6253CC6B878DC285894673DA773A347627EE6C518A87BA7
-B62236FCFEED7C9444AC10CE48246101DC31A16380DC2F596ADE6B8412A95A62
-DDDB82AF32425174A14361E7916E6B5569BA05A3989414A6A01313F4FEE2D9CC
-A9BAF58A8E119243048DE38C9F0124E019DFD807FD180D22B4E8FCD19191CAE8
-0FBFFCF537D5C338B0ACBBFFE1ED4B0419CB13E441DCCAEF103402A8DAA7B74E
-1521D44459B572CB30EBE5FD86F09AC629AF4A4ACF046841EFE0D374EA437660
-B4375A75FDE67F195EB3C0CF4FE187FA449D35B23D2A0F446C5D8F36C565AF43
-A8B87FFE67B88A4A91A731D90513FF5DBDEE3AF6E8044D53C123A89CA7532131
-390B0D0A1456506264F48273FDA0FF332955A24376BC89F783129B52A4EB413F
-126AF88AC78E11B05DE2FB0DA7F2D0966A6A4B7FFCCE7A2556C983C4726D5771
-75B1ED7549F915E803BDDD32A7290DE5FCD5E0E45F5711A859585A2AC680A1D2
-8AE81E137EFBF80AF4698EFBDFCD4113DF5894980ECA986067479A900B885A95
-CA13C1C81E1D2258870A3F0A1E9A63ACAD329AFAF75A350DBEC675CEE16E174F
-1EDFE7EE9A09F2279B357530DD0CB809F57017782FDB574E027F4CC90F676FF3
-D3B0E22F8BF3B41AFF87ACC36A3FFBCD5F27985BCBCE9E52D4643AAB62D27278
-5E6639D60D75B444E5E48505146CB8B922500F30F7912F69C345CF0C4FE77832
-5E4C3B2120DF56B59434F02C95744BF8F1C8546DACCEC0FC2722FF19AF5D4543
-B8D2983EF45EB4FA6E89BC53BA5468FB12E85AEC0769751A00D33BD632D67E1E
-E5981174B6DE0F1B90E348CD3E0CF43080F0EF0C1C95BDB77973FAA0DD3CFC42
-9D1DD2E8EFEBD82092EF53E64B30B013348012A73CFB1FB395AAE75418764AD3
-3180D18FDCEBE6412ED9183DADB8615164ABBA778292822568EB55881B656545
-994E3CED205BFC65ADF2F5125CC6B604A047D99D78DAF9B6C6BAEEADAFFBF781
-0F591465F91E518CDD090F46CF1A08225E037F3AF2927DB353D03538373B5019
-3686D6D15355BD6CBC4E6F6226DA916C68490CACE9CAD81391ECAE600FC30812
-8C5EC591C7C0DC89FF8169FD5F8C65A36445D6485ED9291C65A1097B75249CA9
-7F21C8FE6589AAF1D43C27065E6E046B5CDB1FFE9B9EEA7B3B646730664D893C
-A15D2778880C139F44C98D14D603D41D6634A25C66D5E71419CDD1E4A904DAD7
-72EDF04C4F0D64F02C0A9F85C11B98024D5ECFD3FA978DFED9DFE8D5E2478A10
-DC9E9C0ED0F3D496EEA6D10DD49175697D12EF3AC0A96FA2262E382205A4A431
-CB7D837092099002893F807A34210835436139CE964D40B10F59CA5082E4B2BC
-9FC175217100328AE0A151C1C56AA45FABF625928EB83B46C53BDEB84A2206EF
-3E0ED256188316573880A68E409CADBC6EC91E06180E351B39ED8D6415887759
-3931B7BBA2C3BED9BD44285EF1BF523BBA7400DDE533DFB956E7434DDEB285E4
-B9CB22489D0177A280A8C433AB10C9033EB2533B53B09FF656B99261A62BF14D
-9489ADCF055DF2B681E74F092ADCE1004172445D889A3D0056F3C3D30559889D
-AF0018CC4EA375D674A529624F800415A81CC690D105D3838316F20B54B1E56D
-3FA94F7FED61A4F2A03C4DF024075EB84476D9889DE7ED043366AA866D2E2019
-C12A04F3E51F55A6EEB2CCBCCE2927C5E60818E9A05C779DEE5FCAAF191021B0
-D347C274C4D3774F0764647D0DE883DF7E08D72A6A2D3266024F65E7FBDE953D
-2073047675152A43C4FEA0E1C39ABCFED70218F8B9385A251AB3C43A597B5923
-45C6CCA4EE4984CC8E38EC5D11492970094886CA7C7EA5C05844A29B77AF39AA
-43C3599BB657B5E8A614EA151CC51E7D9BE06E482C04267D9CAF309E7F297E77
-B663915461CD7C4B6FBC913528492CF1BF03E99A2B43A8FF5CDAE2A5B8589CE3
-D4F0B9D3138BA58AB26C259175A7350B132F22416B6ABC10DBD2EEC95BDC2CF0
-1DBFB922EDCA13B5CCDD23E609934E97CE3A1B4BC832EAC65D6F5DCB42125120
-20457C364C4FFC5F439F541DEC2F8CA2950AB6A3F1903E43598DD1C3EBD2F99A
-9D792EB757B358FCF79C5D80383DA7B5304A4132E0BDFAD03A55A4051E6157F3
-279EA61501DF712B03B00C3D9C4498C12DFC5A4F61E6063CFCEDF25F8B22499E
-FCDFDE3D92C06670AC379255520AFDCE29BE53BBE1F505A80FC61F11CB5F33E4
-1166CA91BCA91B15C4744FBF48376CA381CBFA6C6467E0E0DF040A9CEEAB0F0B
-C935F514B60F7BB867B5EDFEF41215FB12B4FCAC78A7CCEB61CE173F685C2648
-2FB126132664EB678BF5F8C282F7DF0482116626E471B1376097489026E41E6C
-BDF614C079B5EA66F2BE9CBC803DC3FC95EC396B03422B30E2C39874B2FA7C24
-C48C18202E625F7CF2696C141F6140DDF9F629C01C450474E4484145254D24F4
-491C48A9FB5339279D4D6E3C9EED830B3FB1A3859D32CB4A3F24B042C06A7960
-C10834F00E530E3C440A2DAAA43FDF06F50047CAE0200D5D5DD85DDFC9CC0796
-E7E8BE7A24819AD34A61C3FEB5391DE24F302F45C91BF854C0EC0A9735B6A378
-A62AA95BD987081DEB232015BDB19566974D2BF42A325F3299E501F900D2EC23
-909F69CC9BD0F8079EFC029901B5458CACE8BF0E4475761E0E361ED0D5CA52DA
-388540B808DB9F3E641BCDF88EC56864317AECB1FF36F9666839E1758147A280
-721679D77789D80EDEE8292833FF8A86E035E47645010E4BAF476E76BEFBD240
-33B6D82D16848FDC6653A6D26EC2FE877166D654C25A4B09504AC36E944EE977
-DEEDD102C02780FFF011A1D17FE525AC68F607747E35026F2832989742424A65
-7D22E686EC94041335AD68B4003A3C255970AE16A1A96EDEFF036987640BA70D
-9CF29C586D00A93C7B1947998574FCA4BA512534934379E0EC25A9887AB39DA8
-CBB29E1D2A101317FFDDAB4FC0B21714A32957618B591786D9E93FDCA2C78A6A
-E41D31BAA6899B3D3A11FE452425F1017549B6BE22CE747DA4BE61F5B66E3449
-0C90A70790FA71AD63EA9B71BC284066B66C20F5BDA515AE93F422002D8A9556
-6982A571CA79241A9F86656C1A820C264A5D308658298B21ABA5CFDCC53344DC
-9F2FE72BC75A8D532450390298A7E7B683E2D44B6691943028CF237C81760BE5
-707AD4BED5A2B8B505F2C3766A932A1DF82CA0EE04E84310F00B76D9750486A1
-DFAA13C163EA547FAC050081B696A5B366243994F63111D3F2C0FED77B898763
-9FCEF253FDA00AFE9BAB8F01B02AFA733A12AD2F990A7218A1F77D7D3A92E418
-7187CC12F57DD06F54188ABF32A0477A989C658D6542876FAF0895A8044F789A
-B0E42A56DE677034CD7899ADEF20DC4EB63098629AD751AA30FEBCE559C47D5C
-5C9C41E065A75E27149D31DD9B7FAF4650279FE6E5FAE408EF361474E197629E
-01D70B1E8132C0485003684641ADB319F946FA85E9C5800CDBC40860186C00A5
-2D3EFAF6FD501B965A593FEFD2DB330EA364160A5A975A54C123656E49762647
-275599C1D130C2B2969F0E0A3AB1683F494EE514BB4DE902AA813D6B10B707CD
-F803AB9692D7EE7960ECCE3B47FE26E12596F97D29FA54DBEC67D8081B25B5B1
-4A7D01A164C0F1D25E333B6002F4F660B98C6308756CC899E96EF38AB08B768A
-7CEF31034D69F88841202BBC65B4BED85F0354A1603DF6B9645D8995370F6CB1
-986730F33CD0476A43EB26CAE0A8BCB69AC2044431B301AD09F4EB3B512927C5
-1C9D67EC43345F53475F4ED22E0C10C56FCC8D4226D405C9BC3BA9F47BA4C4AE
-896B6F20CCDACC05C6747BD5D058B32B6ED775CF9E101320962AA0211211CB5B
-F938DC2E1A2A87072C8DA03CB38AE4DA550F2D7763D0D5268B4F2D1C44542903
-6C0C9E3BC53F0D405D9D8533F979527A04D8BC48578B
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMSY10
-%!PS-AdobeFont-1.1: CMSY10 1.0
-%%CreationDate: 1991 Aug 15 07:20:57
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.0) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMSY10) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Medium) readonly def
-/ItalicAngle -14.035 def
-/isFixedPitch false def
-end readonly def
-/FontName /CMSY10 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-29 -960 1116 775}readonly def
-/UniqueID 5000820 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA052F09F9C8ADE9D907C058B87E9B6964
-7D53359E51216774A4EAA1E2B58EC3176BD1184A633B951372B4198D4E8C5EF4
-A213ACB58AA0A658908035BF2ED8531779838A960DFE2B27EA49C37156989C85
-E21B3ABF72E39A89232CD9F4237FC80C9E64E8425AA3BEF7DED60B122A52922A
-221A37D9A807DD01161779DDE7D31FF2B87F97C73D63EECDDA4C49501773468A
-27D1663E0B62F461F6E40A5D6676D1D12B51E641C1D4E8E2771864FC104F8CBF
-5B78EC1D88228725F1C453A678F58A7E1B7BD7CA700717D288EB8DA1F57C4F09
-0ABF1D42C5DDD0C384C7E22F8F8047BE1D4C1CC8E33368FB1AC82B4E96146730
-DE3302B2E6B819CB6AE455B1AF3187FFE8071AA57EF8A6616B9CB7941D44EC7A
-71A7BB3DF755178D7D2E4BB69859EFA4BBC30BD6BB1531133FD4D9438FF99F09
-4ECC068A324D75B5F696B8688EEB2F17E5ED34CCD6D047A4E3806D000C199D7C
-515DB70A8D4F6146FE068DC1E5DE8BC57030ACE57A0A31C99BEDB251A0ECAD78
-253AB321023D15FF7F55A3CE81514C1E7E76240C1FB36CD4874DDB761CC325F5
-D588700B294849D690F93526EF438A42B9B5B0508584EA3766D35F5B8D51C458
-ECB9FBD23A4CE296F74B412F8A26BAF8B05A6D5794D1CBBF299B230BE3F3BB0D
-50677C16791F11388BF9F950E8EE6282CAA0700CD3F2512498C5983531AAF4A7
-485932BD20EDC6E9D1B3609EE68EDA5742FB36F14A41849A913C91635D6ED840
-6557FE3337935F695F2CDE42F77E7B9E5CE75F7F1D9951599838E8542BA940BA
-4ECC75755B7FCE85E791335E156B1FED30E9154E4D42DDCEA2565989524446CE
-08FB6FF3479B0F71A903627289E723355331FA1E9433F49D042D2BFD574787C1
-31F3E647835B5CD2D91B42954A87EA0E76E84212ED57D29EBB8C8FABB6E6FE3E
-854F65AF2BCA9745B08164593448B2833A8A718938784CD0B8B8816534F01F09
-05EE76EDDDAE60FDB3F7FDC2DFDB13E721EBB175BD3856449151FA373AA6659F
-063DF183583F8520615B06D64C8062AFE46C526E75431704580175E0157A927F
-A56CE030611F734F95B64E01E6DF328D983418510E8701E7FD80D21F0A0165F6
-0633185D5EAF29B76A28A21C1A778289EE852F4C19469E9730A770CA41DDF38C
-826E947FE06FC827B2BDEBF03C8DF4360D6C57614F086753B072612F41277FB9
-F97C48FE673F7E803779341BDA9D5618071BF7E42DC8DD86462E6EFD08A8D526
-21B106E73887FB4191E4497C4A5D96AFFA1E1C84ADBB5742EFC0771E4B5CC79C
-ED9844E2C14E7CAA5817C7457EDD3ACBCC424D25A1EE960C84993A7CC8245238
-6CEC121F967CDA4D6105AF5CD455F9AC220A28C175F7A7D5D8E4C59DCC304673
-3F46B6A13E926B2451F721176477274BD4502135B1A6E3772D0E918644CF6AD9
-232887B51CE5ACE6236B5303EC719EFBACA3257A975A56
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMBX12
-%!PS-AdobeFont-1.1: CMBX12 1.0
-%%CreationDate: 1991 Aug 20 16:34:54
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.0) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMBX12) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Bold) readonly def
-/ItalicAngle 0 def
-/isFixedPitch false def
-end readonly def
-/FontName /CMBX12 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-53 -251 1139 750}readonly def
-/UniqueID 5000769 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA052A014267B7904EB3C0D3BD0B83D891
-016CA6CA4B712ADEB258FAAB9A130EE605E61F77FC1B738ABC7C51CD46EF8171
-9098D5FEE67660E69A7AB91B58F29A4D79E57022F783EB0FBBB6D4F4EC35014F
-D2DECBA99459A4C59DF0C6EBA150284454E707DC2100C15B76B4C19B84363758
-469A6C558785B226332152109871A9883487DD7710949204DDCF837E6A8708B8
-2BDBF16FBC7512FAA308A093FE5F0364CD5660F74BEE96790DE35AFA90CCF712
-B1805DA88AE375A04D99598EADFC625BDC1F9C315B6CF28C9BD427F32C745C99
-AEBE70DAAED49EA45AF94F081934AA47894A370D698ABABDA4215500B190AF26
-7FCFB7DDA2BC68605A4EF61ECCA3D61C684B47FFB5887A3BEDE0B4D30E8EBABF
-20980C23312618EB0EAF289B2924FF4A334B85D98FD68545FDADB47F991E7390
-B10EE86A46A5AF8866C010225024D5E5862D49DEB5D8ECCB95D94283C50A363D
-68A49071445610F03CE3600945118A6BC0B3AA4593104E727261C68C4A47F809
-D77E4CF27B3681F6B6F3AC498E45361BF9E01FAF5527F5E3CC790D3084674B3E
-26296F3E03321B5C555D2458578A89E72D3166A3C5D740B3ABB127CF420C316D
-F957873DA04CF0DB25A73574A4DE2E4F2D5D4E8E0B430654CF7F341A1BDB3E26
-77C194764EAD58C585F49EF10843FE020F9FDFD9008D660DE50B9BD7A2A87299
-BC319E66D781101BB956E30643A19B93C8967E1AE4719F300BFE5866F0D6DA5E
-C55E171A24D3B707EFA325D47F473764E99BC8B1108D815CF2ACADFA6C4663E8
-30855D673CE98AB78F5F829F7FA226AB57F07B3E7D4E7CE30ED3B7EB0D3035C5
-148DA8D9FA34483414FDA8E3DC9E6C479E3EEE9A11A0547FC9085FA4631AD19C
-E936E0598E3197207FA7BB6E55CFD5EF72AEC12D9A9675241C7A71316B2E148D
-E2A1732B3627109EA446CB320EBBE2E78281CDF0890E2E72B6711335857F1E23
-337C75E729701E93D5BEC0630CDC7F4E957233EC09F917E5CA703C7E93841598
-0E73843FC6619DE017C8473A6D1B2BE5142DEBA285B98FA1CC5E64D2ADB981E6
-472971848451A245DDF6AA3B8225E9AC8E4630B0FF32D679EC27ACAD85C6394E
-A6F71023B660EE883D8B676837E9EBA4E42BA8F365433A900F1DC3A9F0E88A26
-331A1063F97A958B9066B51C7EEE1181DAAD54742F78829FDE853223CAB88C9F
-FBFA181337A0EFB401E8EB72B3FBC58F821837E84C8D4A0199F286247AF2977C
-70EA6C3BAA2193FEEE3A2E0C3FE8185B9F4AB5B43B1F39A89D5F18D9237799A6
-1F674AE3FFFE83AC2D4CCF6B3CD1F6C1E1B07801D0D22228AC68CA23B020F8CB
-BD91451E8EDEEC2CA2BB7C9F73E19553E8A62BE6B57D7A99A8EB5B60F0DC8D1A
-D679B2282A69CBE85A5B8D87D425C47C18D5629BB738756C8E398DC830EF585E
-DB8A5EB6BFE24A2DAF614E47D08B103035E80F7E3EBA9EF4E006F0D50AB21D1C
-E6CFA8A2C3EA7A7124C3EA0250656F2F6484CDEEB6C6A6988AD702E7B8F0E980
-FE005DE94E75E8208163CB14B66B5D67D296CC8218C69D104861B3C1CD032A15
-5CB2D5798FAE08C7C96633C406E920E0C6104491E00F747ACAF78A8A0C43EC1B
-6E65A3EC4FF68414B22200A545C54E677218C736398D5426CE88E8F4AB7819EB
-22356A8B3B73A44785FFB7E70EC2BEB756BB6116381D74607E88B141C68DB0CD
-61719569C425AA332B27128BDA04286F82D64BAF92BC4FD599AD306EF5810645
-DE9047F9A47F11312666AD67B7431FFD47D91A08DDA9ECEC72278076D7B657B6
-F07BFDB728AA7F0EAB5E6D5035D51740773EC711C22BB4D5CB673D1CB35DD36C
-0601C519A8969BBFD9A1B424E8C8CBC5D2236AF48B857AA00B87D5078D3AB832
-314CE61DF2B0CBAA10E2AB178658ABBA96C74494CEFC46DEED0A5D7E72872667
-3784D8F85A489ACF23DDDE57941431EA0FD000DECF0DDCE23D125E5506ABD99B
-80C828A2D7378FA01649E195E0DE1CC98E8A397D0FA2751EC6A0319F571D9C5E
-32CF2DC7A455471AB9BF07AAC16BDCEB731A52AB9A523EFD62B63F945196C5BD
-AE9ABF5351566FE4C97C23AB9228826BA1F89FB53E37C08C2008E4F519ED795D
-EFEC720EA1BDEA982628B3A564B5EF016B2E8BB5124B0B8911386EC7A4A28334
-FC23946574B6B81AAFE90C62140F444D0562000339E16A19063F884DD1992BD7
-41C7C1FF9C41EC1F7141ED9DE04E243C187FEA413F07ECC0A2C85A27166AB011
-B9C116964D2CF791DA77260380EB7D3ABEEA2843ED9B9B85321EFAD3E3FB4909
-E0D0B168188049A46E4150E9268B8DDC6EF8D817FB65DE740CC56914D7D944EE
-E19F4720A94880FD5C59A5479623B878BA04C2876D5BEE7700B637FAE7C4ADC4
-C3C1100A4BA2D8EA4385DE10D57AA7CCFFBBF4BA9CC9302A5B18DCD969AF3784
-90E24EF5CEF5A5237B6A61C90BB1164F5C139A2B7A765F535B7699A36B90BF9F
-BA5BF62F4C5E4233D0B4531E0E2013A34650A524C754C4C071AD79E413A09EF1
-45791CB8B5ADFF6A86822A3A50200012B721F8E0CD99AD00B2CC43AB2F86B204
-E46B4E1C126B6FDC2FD62338A55BAE29718D743D7EE37CE09BE4267039602502
-9703408D7AF99C78846A54491CBC79678845351F21E36F933EC3FE06CA6EF544
-92155727E94F641A98BACBF656EE90C3AC11CC0A4271856073102E0FDD7ED9BD
-8263214DD0CBD7A290A35B5F908E54127793C7E502A05CA9223048F409976B3A
-DADFC90300D7B6DFBB74D6D9FAAA2C231E01C5B9DF825A2F18E0130A9115236D
-96F05721497AB38820E9EFB5CE6AE243BD5BC0BB344800EC4DEF1249942A508C
-F1A04AAFA1E0011FD46CDCAD35E406D9D64BE7893AB34C7EB497BFF934DFB4B6
-699358E26068DC19A571F70A8C2E1E9F39C9AA4896222764860F2D20F34ECEEB
-89F70253F828AAFE6FDA6FDBBF87B7BB19AEF31CA89DB1CB8FD04E2DD0E59B03
-6FD7A9CDD7179C9278A88820A63508F6EBF2DE10589F18928B83945A8698319C
-44EE8CAF5D10B2C7044A19EB075EE54606E002B4A1FA0366C62F99DC2D67C9B0
-5385D055B8FEDC2BD5EBB18D48491C1FA27F5604AA9F9427812E31DA8DBEC903
-F3E7845B63C32986D46B108858730E688BE5F1520D1332FCED90B52DCA1FEC48
-6C6C1216C877A95315B177B9575E9167F0DF64D5D295120B98F1488019078960
-88E9DE4CDEF3541C789F6E1579ADC90763C645FBD03BC3E186FD7F85A20DDFBF
-7761CBF03CD948B260E556DF5FA1497434C14EF4FE2988F43210E1F280CC1ACE
-1693CB31A50EE0BB5FA7D24966076E6A1C978E8F4E3106992D2F3B64974C5489
-B47863C60F9831157EBBE9BF87E175217E583041F30599E0D51C85D2E46CD91B
-71E2469E5174A9740B744F9C92C3499DC253D82453DB027F94D5D61BF24310DD
-8089D6B6A6D43BCFDF7B1D11E6AE43F06F0A91D53FE4A957D708D9A7D2C57A95
-DAECAB73B1159C9F75AD48606AB5B4EC5DB9FFE35A770EB6B574624CB11DC27B
-FA3BC198083A86359FBC276BDA1A56BBE446825F7313FA6396464E7DBA100F3C
-043178CDAA6419CBD84AAF4A11B5B03591D691D7ACA729B6A7793D98A6CAF73F
-3663397D0D8A2D78F8E273A3C5560D096EB95B59BFEE2170A4F28B4672BC79D2
-71BFC813DEC91BEFF15FCDE057209D4F244E07B7F2996C665E6EBCB2247698AA
-D98AB87B828B7B4EEB9B0972C812CCD87C5DCC0ED89AE9DA771253E706DC2B29
-9AAAD51421CDAFE13BB83E2DB900CD828DB75CC7197C50BDA4988989464C4F4B
-2D704D023A86E47906F2AE76A214B4607792ECE9743087C246BAB3779625E816
-27A45BB6E6A5EE239E182819E4D23E7FF69ECCA8785C44B62C0633D2E2174DD7
-26FFEE4D36017CEF09D91451598680F6F4B5B9705BEF28A584BC5C99FD65FA0B
-360BE5854011FDF97ED134549B3DADE77B469681214E3DB35B453A4827CE8C2F
-3F5E8B7C1031A37CCE4F1C5C528AB81F95DFF24BB42964B6C30EBE405533AE52
-25DFF95E9785850EF9434C5BC604BC7F7581C9A52E0BBD9AC7D3E5420A8F43D9
-49D76503FC289789BA3ADF019CAC07976AC7C3A0830CC50D8386AB3287B0786D
-E34E0F392C5CBD600E2B4E872624D7F1462F925616D55FC0FD320FD9473A760A
-01F36FB744AFF1941DC192BFE8D2526B179905195DCDEC241DA73A5137A9EC6E
-96E1B07D90503ED8563B9C7D5F297A43D3409F26CA5118A049C09869139B40A5
-FAB64315FDFC6E8B18707DD6E74D4245ACAE6EF843766140841791297AD4682F
-2EA18B4B608E73699FF60060CE6B8EAC9190EC17C03013009B9E8E2E85279449
-991A1FEF7F8412874D8D9947AF8E3F8CC79BD3DD031D8F25FAB060F6CBE46779
-0141A55E8CF8C6900031327FEFDADED5FDB95F3F7848FB9127FF3E615C73D06C
-D6B8A2A61154D620B28A362604FDBE2B5A14647A1DBC90D98242CA188B612E17
-B016238A21557BE81C9E500A6BF36737B031555D5BAA0486C15178EA807C8DD2
-600846D65DFFECC9FBD91B8E884E5A0E2E61FE224D0E5D2B765D7F692C024FB7
-360E388FFF9F161AE88F3C472D64C48F4C34FA1AA463E2B23685EA6ED10B5154
-6E1D2CF408BEE83F081ABD6F4A8C866530028B8155946EEB3D48ACF1176FFC8A
-5D6CF0F41C6E7809130DB7392433619D9BE8D7E3AC72D4B8C9B3F44A40E1B4B5
-4AE3693638EC96D12D12391CA12CF19C86D96F605DC52E3DFC1E924438354CA3
-C0C42950D02C36E59E937C569B09407F113A422FC5E0D0FD83D9D0FE833A53FF
-CBBB59B5E18133A5D29F1B9DB064100FF0D27975BB5834E235089042FD12D7F2
-276395C0E1268E60C82205D0C3FD179E4708042291BA2906C9D1C5E1F1446640
-4CD28D6733A3875BD15104A0EE173462B533F1D08FC53C3347CB97EBA04861D4
-D6F33A06572B93C2F02F08D64BDFAFDAC5289B4EF3DA65FE1B5BC433D84B9415
-06427D3BF6C22200C246A2126EFF7C9A5E46264B0F0C659226E4813B2604BF4F
-7F8165903182E633090CF92B27D7FF9EBE439D43A6606D69A60D13FB1F32E5F4
-3C5C0540BDE6EBBBAC82087E2F68BF02D4779A24F49283668E6DF318405F81B9
-A487E92F7BE686EF5B3A30168E64963787A7F6846A1F14A92B71AF81BF77B33C
-3574F3071A97B281D287B702C2B377826880C493560BC8ACE688A05857311890
-14F5435C687911FDF8B0DEEA0CC9F980CED768CD02BEF96EAEBB5409696E387E
-8A201FD3612B89DC41FF177DCAA767AE304C861157A2E6591438973EE0578703
-F0F65133F65D4EE9EC42B7C9572CD685096EAFEF7A1BF3A9EFABF196BBF0E808
-A23F556B738FF876C1C3AB7A90C1F5E3B32C249A4F65CAE22E5A91E5FF1A3BDE
-784F4BCDA0799F3B6EB40F31C0CC87ED719C6A789FB98B8704EA369C65DDB429
-00083B43C4163FF1F7DE81417B74470884B31793E28310D5F78CE2FD3F15C15C
-7545F3FBA3177B3C93EB89851E44628E8E99E44AB8528D929A597C55626E37FC
-6C334DF51C7CAB52E014653C6F4EB7783A3EA98F5ADA3A249C637C3739689959
-EC06825CF0B8CE072AD4DC042B641B2DA05DC6AE98E5BDBC50670810B2140635
-376004C3E77A6FE67B4D884B2A429FDC1D18FB2C1A1AE1FBE5BB99C980B17A52
-967D6687ABFC30B4210A20424AEE1F562CDA3FF2491056E05F248CA7A6D1BE4D
-3E2BB64A20CDA7602ECF7066413071DE2DF45932E79727C9EC1243EFD2677D41
-705F75CBB823690D5E621FCC197970EE9D72E278ED1A74B7443DC3C5AF70EA4F
-713EC71A0CF22FC53F864D47EAB177FF044A16E54FA7685AC4AC4F65B295A02B
-2809DF99FE095F301E0C4726AAF4E5FDEE9BE6E3E3A5C8640C973AE2544F82CC
-D4D72219EA775CF7D548F69E36D9497616BC21E9F72C911C163A9187B4AB452E
-E94B1D4D429F23C78FC2EE8BE0F34DE7F5141CB2C8262748FE09D41B2892861C
-210D30361868E0630C288983B94E2F0452FCB928CE06749B67BF8B28CC34EFA8
-2C4FC77182A883F7DD14F5DFE07BD854CBA01D21DBB312A06F6AE8ADBF60731A
-C48B007B2414CF63264F99CE373A4001DFAEC18D2C95398DD7BCE5026A843D2E
-9ECE39EA050E8A77D26715BBD5B71F268BEC0C0826D660B2E979703D39359803
-9AC438C337B3DBDEE1427BDD850133AA6131C57C9743B9FBF67997E4A27489CA
-470ABEDECD83BBD5B0844B82C81EBEAB85D466F58955B62451289D85C14CA400
-A9448412995C76CC1DC418544A46A81CD311729BEDFA8709B5B11A82108FA681
-7DC7E474FF3C4DA9BFDC29972FF574B5D69628628CADFA4874DE04CD5833F8B1
-9E38F885856D24A44FB71874EE20FA82E2FB0643626D0163A39686838458AAFC
-425BC6A35CCCEA45A98202C8F3484D260E83A542F7094B4EA5E12B20F5C9FEEF
-7FD54797B3D7224C3B6DD888A591F4D25BEF3BCB07E06DCB7DF3E9CE61EC8667
-680B4DFC82C21361601ACD0B3F10C25307713C4E70EC927CF824F2285C505614
-820FA875A678173A5E92D84A0AA9E6174F03AFE4473267095F885DD16482175B
-2719B266B58E5A00F5ACDBF3F7C00E562BF048D5D026C0D70203C2B81ADFDBEB
-62D16CCD31BAC120D953EAF902209D39891B7702E98C0998910C43D7CAE6A142
-20A7F3BDF8F86CE43F2549E583C589493DEEE2D289361A195112217E280BE501
-8CEEC7E9448F383985F6F0A76F2995A5C7706AC66DA94C0282C76764B42DB674
-95C457311748686445A8C27A8D5609ADBEA16790D21BDBEB12B57C2E2CF97115
-4FB4924401FEC1E130A91D226B19E6A57794BDFFDA97624265770E5B1B100774
-92F9674C51799FB0DBD3F6DD040A853D145F814A928B0A78041D7CB5990EB08A
-6EC91384396FE2847DCC3FE40BD3C56EFA379B2C2DB0A0C51B9CA407EFBB1BBB
-8598D05474ABFE2A33F0A32C2F11D8F84599D4457D68A45D728376591D77296B
-B41C30AFDC76A8794E644A8D88450FE818210F10A765CD32B3BC997C34DF25AA
-22EDE66DD3DAC44E1185B12F818C7EFB73C084E67DB1ECB944E02D092B1DED6F
-55279C191FBA6DBF883DC5373E51F37C0F3F9A8F6B24A9E20F01D92763FE59B0
-6232B8C4CDF0A9A887B7793D777A72D5EB5BD741D122265BB895F786E2E0160A
-B28884F974EFA275EBE68EDB4D52767626E54B3FF27065CDAEBB90FA10913745
-A64D41570731ADE508A87BEA9B3E3A7A16A34D99EBCD0A476B1BF8D8D44C9944
-5C0D2F5E597240B17CAC0A444A82E8F0E68F6981CB5B1B5E8E0420E9F7366E4D
-68B925436647A058DD16D3683F71709AE61E31F9AA5D0D9D3CF4BAE2C7B3F63E
-DD663F51D53C537B284E01C1184447ADDEBBBB87AA1BA7F9FB149EFA3315F8BE
-E12D46399CE5E058B18DA851FCADAB654F373B5A50D8DDE823EE400DBE9ED05A
-ABAAEF3F6C7EFDFCB3F80FAD6B80C439D81B5D5D8F2AC45C5A1AA5E609A10999
-E754FAE4B37CD7CBA9D9BDBEE3E2368A0EC9C7C1065542146DC76E03994FB5C1
-3B6E2E463752662F2AB9AA9F3FABD7F52A5A6CC57E1AE4A57717469A87081FD7
-F72D8D7D131B331F3098BD00614481AE9623EDCEFA71E001A45BB530CE5AA548
-C00878E87C635C38A83CF77BC4C63547360DD7CE9990B91B1B02C63A3F09C472
-A4786FDBEF0E5F07F1CB321F726CBCB5FEEB8B4DEB9B1F556B14E0405D104FEA
-D33C12D1ABB78B99377E9A04F1768725C16625BA8BB49C7A283F8DA97F5E4320
-93C7BA54D6A9CBEA38500A0C54B37386EF3AB14CDAB4E13CB3F158114DD69560
-4BEF05617AA05319E2686829D7E8DB54EF6F685B02D2C4961E90B7D903AFD4B7
-AF51E04B0B0B2893382C7AE22C614D3BF5CB793423E686BBABA8B7E184856578
-E5B48A1ED0F186C41B61AF7907241F42D796B723F0797036DD0000DA48B906A3
-B8CCA59C7847CCC8B5B1E64A778466461189247A0D54089786F418F58EF91182
-568A17BD52B227E77E35666102A5C2643375CAB6DA36FD5EED6043AE799ED7B7
-17213A4808F3F30002D8889C8C98423B8DB1AEC3B318BBC0F01F35A8B3BD37D5
-F04C6D274F95A35B78B4504242F2FAD79C867E74D932C8C9F18358C904C6B309
-D9BCFCF80943815C0E635AFB7F3998A9D15371C4947902DDFC8ADE619AA666E1
-9982BC2082586ACFFEA05C17EA413A3A1424CB5E0908ECDC1BE12CC2E37D411E
-90C7FB1E392A9DC3CFFEDC17C7ED70DF3EB9E907EA92478ACCDA872AA01C4B9F
-EA9213B018D496B6A87C0462AF5CA5FF0A12CEBB754F22D3BE95FCFED1844F58
-A675417AF5988BC780C4E33665A7908A2F062F34A9793960940B78C485531D9C
-34141D3285D129BEE220F2C6DDDA69AC4FF05FA439EA219E32460195296CDBBC
-6D3B17D556C2AA394DFE1E491203D38306FBA94ADDDEE9673232D1F5683F90B9
-81076CEF68A63E1D6BB56B108BE93A5A62A51DE8B95B6A27AA6E8B6E7269E0E4
-9BC0A65FAD86D7180F117ED1EDCE603234AC6044AD457AC8D7D8FC3EC15955AB
-2FD80832E6B46D4B08C77E86877A2C3E8F950BE74B06561DCE61EE2D7C38EEE4
-5C7AB94E4C789ED32DE4E590A036EDE7C324018DAD9FDC1F7D83703133789883
-83305C8175B0F5C5B1955EB8CAD1DE33A5D1D65A5260BD73C1BC2203FAA62433
-8A0263C614AF5663354413D685438AFC21C81FA39F4DD1AE2703935F2B7AC2FA
-A048E63367D8C3D0C2B7D2514221A4120DAE6A8796284373D50C8CFF630D6A69
-ED3C5A5285B1D2C61DD69265B05B32DCCA3E0254F51957A4A8F0F082E9B9163D
-57DA28BA87A3F63C884DA530285C9B14D4FB4CA1ED5E3ADDA636C2BBF9A565C5
-02C6260BE9D4B2BFE07672605AFD54ED586EB28274245AF125B665EB049D092B
-B54251E99684BFFAA54A912F23A28F12E4B40628A83DF4B4862B5D6201476DFA
-C8450CAA9CF9A6499C833CE2B2C31001DFA9C1AD2BD18BA9043E5837A49FB0F4
-23D011636E66AC548C855EC0E539CA61CCCFCFC146DD47272AA55AD2950854BB
-CD2D5A5E380E6F5F3BC80C37DF3D86865A11CB8BB132B7E3CBB323407BE36783
-41E28DE21BFA2DE4EEE4EC276C945B498D4CFF080FFF451C6791E38851D46058
-D78186E0EEBAE8C16F60AB0356810440E1A490ADAC47E2C35E3402F254BC1B69
-08D087BE6EDD66F256A2B7D557C437EB36F45D5D77AD96EC35D4B311A3334C88
-60392FCA38A27F7625C8C020EDE8FD75FE2D77E2C883C701DA7AECFEC61FB3ED
-7BBDEEE6A66772BE34A7041A2EA6F086589DC089D997E1779271929FCFB9D1D5
-F17CC3B65840956F1AF807DAFCB67873CE07C3649054DA4EF64D3BACA4DAEDD4
-ADF38D111B74478F06D8142A86D977F08594BA4BE307AD84A786BC3735061AF4
-E2D4D822163522D05509FE6F689FE139B2B20DB0B07118BB1C33149AA9F7D13D
-E21A72692E568C9C21677D2E62A7FA7F94787C5FF472833238C6EC08AF232812
-716018F023D097D533B0540A1FD5D67CCBD5A3292A7D3BE31602B7A9530EE8F8
-2E31101DE6CBF86C766498A3E5C944BADCE189506CDF553FEB7FC7C2159F7C90
-37A235688AFFB7C2B84743F7137C8B6ACA1C352AD6C4D0C7E7C4B52AC60B4815
-CFC25C0BFA9C8800F5FA9816A7F879A42DBE76A2B981E3A93BB735160093908D
-EF3F1863BCB3DA32195DDD2B586109691F5A51929E2065E50795425D4E919148
-6A8C869B8AE52B3C5AB3F492F644AFB8A1ED971DD134AE07304CDD6CC4E99DC8
-1DC4D92C55EF642AF08AC9BAB6F482191F56BC06A75A7FB3957CA0E56A516DA0
-E077EC297169AA0E320D85409291FD351D5B1A62B9FB68445EDD1385B0CBA71A
-DDDA1D6AEB35B8470306BCEE9372B384C4E06D5B8810D8D33EBBA51199295C45
-35F6D5E9CE600625C73221C070A3A09E1DEAFE58FB49DBB6BEE24B1C4F168F8C
-9C672AA7C0305F44DE4246EE42735DF5CC2CF0496228E3FAF748734AD18A1B40
-29C2B25DA066D6EBCCE4AB6C9E893DFD620E905680C223B3F62EF696E6E86F51
-45FD79E487229C249660CC5E9FB915A2985946D8FD4902BDB000C71B39400EE1
-52DC6A7AFA2A00373DA45FDB8A766E83E19509E48364A808C4A0650515EB3C88
-1090914F725F568474C678544ABB0225C062647CC012767108CBA402C3DE52F0
-CCCECB4BD0E79BA02BC5D004CCDB2D70C51F481385950AB622C74EAE8BE103E4
-2EA0791FFF631C8F3792F4E4DFA9C461404F98344003795F13BA72CCA32D437E
-4B65E5D9502E398FB5273BBAA759D12CDAEB141CCE4BB6D978A7C8B3076D9A92
-E7B7C1190599CD910314B1F1C2C865B3C1C17B61170088AE14D1F9F3610465FD
-A1A68136789A9DAA18309F3786C4EBCF4915380D92F24470CFB4D5C7CAC50356
-1106B7168234D759C205BD2E3ABC094651C979C460304527931E7F7FC24F25FF
-17CA737F3BE1EBCF933ACD1755AA111D3EE451139087BECAEE411E72C4A63654
-4DEA53050757404994602FB7D0484BFD0A7F935F4E95E4FBF229265CF820C7BB
-F8CE3DDB6085DBAEDCAEB5DF68017881313D509385AC63AEBB059353BFB4A90F
-841C538373C7FA954942D9163FC1A16431E43579829673B8E9B1022922C00BEB
-E87AB325A40E0722DBF94EB43F76CA73D64FDFEDFAD9A1B579793BE0389AF4D8
-9BA0FFB300BF70674CF26027FA7F5D0465654B58FE2970EC65202542301642F4
-A61F204753AD540C94FB56D27B70CF843B65591C58E043AA2AA6424CDB3ADB35
-29641208F4EC66475B992A753CED220371ABB5E8FD55C64178A9ABC081686277
-E85A7AFD1091FDAC70B9D94D502EE982C681719A9B7D8C12A68E7766275E7F10
-139A6B10DE04D2F04E5B1DBD6F9191CF59D0FCDFBC56042F473E72932AC296B9
-67C91BA1C5039C968A76D2D2D22B3FD0C2C9883B408EBF3454635058347D2F0B
-D8090648946C85C2A417D1522EBD4EE60F36604F729026CE8B6E2DAEE852A9EA
-68E0B2A83DFB2FA263E7B0ED3A8405E8E4E9E501D4982A51C1242BF1617CD7D0
-00D6FDEC0E74A0D5290B98DE16588E42CFD18ADCC3B65DEE84795606E6AA4174
-6C36CA05C35F8F44B9719C87097C762F2725D094EF06ACF2846D98C4722D526A
-47C1942FBEC2BE6F4771ED305CB9DF394A4FED1EFAF72250B021CF9BC9DECB09
-A36A38AB99BABAB7B6B82018C9AB022B0C134ACD91F36CA6F6D94841CD09B745
-ECB80830B4E0F44FD4405EBC79BE5DFD0F4262F978F6B78A0B142F0C463BD1F8
-DA92F97210197BD3265ACF6E77A23E486C0B40B25AEEEB766712969E9FA86E53
-FAC0ABE8F25D261EB60E407D4E6430732286C11B9F152D8DB70C53041C01E46E
-D9420503818C363B79F56911B17B3B07339FFE9D7D5849744EC7CAD65E8E9DF0
-079E424BA448667CD1DF83D560E13649124E5FB07FB0A0B31CF5D5D8513DF324
-DC7A8290922FAA3D69BC0671FE5C0A7F6317D377F4AA8F8EEBAD492410087BE6
-2DAEAD04DE412827704EF0879614FD2C367B8CC8ECF8D4EDB123532AC45A57B4
-8998A554E64AEBAEA4EEBFB3694303C9AA0E3D2861792DB7DA7A5F511C694625
-D6B40B40AF28A3AC0EFC81123CAFA871EA1BC77B88B8F6B6CE329C73F1D2FB34
-5DA1BBABDAAC754B9B53A214694896B4F70328C494A0214730EE9409784ADB5E
-88226C5436E6F50422A5BF21649A044902379868D305A3CDA2AB20957ED5E263
-8F870CA034E7EAB94A555FEF8BBB0C21CE95E6DCA8020FBFBFF9303CA43AF552
-32A8165F74C1C84BF614FD5E6A0DD27830DDC409810C9AFD48373797CCB14146
-ACE1B3C4EB7E4B4A6CE328173DC6F8600ED3CCC1E178CBCB544488E69E70E160
-87C2E12B7CDDAE07E88926F82FB6A9066A843713736F64F56D530F1A8BD6D266
-F230430CAACCEEA92D72879BDEBD1AA82801FC0B11E51E2BFF1DB56BB87F0FB2
-BB39066B7A857E4C35F5D7ECC436C5E41E45110E11C97817A63B98FE9547D590
-8D2A86810A65C4DB80FF931972A0E366B6DB0FE986A63DB38FD80180F311DF41
-FD175E989E454580A03C764C5D9E400591D59B5344886CCA663EC611B184D123
-2F0BB6C27C224E031A1DFF3F5D2DC60B515701B01700C5F60A0DB7FBD9B27BC9
-388AA04C5B17ABEF7E68030CA33CF1F8F132D816C0EA4F651A0AB1871774ABD2
-9EE017BEF02712A6FDD5AF0C10EFF4F3CC26D9F641F1EFB080A165AEA4B9646E
-EB62A0EA5BAC6DAB7C36190E4A2925A1C8AC36FD486FB6F192D909971EF24A33
-64A2DC4B789ED6C9A3A18DD3B53941FF5F2613904846DCA2762D613E5DE1773C
-6BCF2BABF39249BD707650B613FA311B474E1C7836A18B2A441177AF540B557D
-CDC6CD76341D7536CDBF223CD33EBF2166E43268D55535DE4C44D69F05DE46DC
-ADD6051906C1352E8496FCF72824A0DAD307727232FE61E9032E2EFD300E48C1
-966A09A5605B89B82E3CE1EF9135608681F58DAAF8047D0B58844989EDE335CA
-BC2885B78750EBC173CB21CDB25852F14F65ABF1FB454EA6662BE2FADCADC080
-5D55D70BD8247030CE08B7F4840BAA2F005B8D8F09FAC4F27449316827B7AF7D
-55DA3D2DC898BC3CEBD51CCDD16F27A820CD52869CA4D613ED71AD53E73ED7A4
-100390DD969C58C6D3757540EA6F04BAA88154A0CE267B782D92CA57FD90435F
-84A4274A8A1918F5595170C2216DB27AEE4D95E573D17B6C14E5724F7C757A6F
-4A9BEC452A5FECB9E50F8282B683B3EA914BDD165D0C97CA0F38EB94D8F7E4C8
-723B7E8E20D3639FE271D390E6AF7718ED298E8130AF5C60C112DB290D6E8FD8
-AEE9AACACABF33705E351C867B2537CA474FEFE1A87572ABC0816CC69B58115B
-858324D44A62AE480DC72C373524D60E00B8EE22C5EDA8E025EC90ABD27C80C7
-1EB96590A5F0D11512A776A3BDE5694A988FDCFCB1B8EBBF9751CAEB42A3B037
-D2E2017D27CDEDB6D6EB2CDF5A25634A97909B617C9BA48F4950B469BA653672
-404030D1DB3B83C2F9931214D1015A8F5627C7A85DE1EAC3695E850701E9B5F0
-E02450E894CE895311F5F16C36DC4E1481EF70F4B42E7B9FB5026E65041778B0
-EBD9936D29BEAE55E700D0BDF3CA2E7BCD24C0343A830BC61FA142C6F05CAB4A
-5C03CA0E981D4B49DDBECFD6FD15A7D89D240975525B816261ED7EB3D35624F3
-3B535FA86AB073A1DEEC455844A18767AED9F676652C9DE5348659276B50DC53
-C8F13AFB252F035A3476B75DF637442F96DBB44B56D66CF9F368791AD9890B98
-BD17304C69A1DAF5A48F6965F59EC1F2E42BCBD834E480FB161CE0190CED7EE6
-E6B43F4326201CFB9C38B467BCBA1D43BD4375825E0A0137E2B56C2169C89DF2
-E53EF4FDBA7D32E8805770F852ABA4AB2B490C0AB233
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMR10
-%!PS-AdobeFont-1.1: CMR10 1.00B
-%%CreationDate: 1992 Feb 19 19:54:52
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.00B) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMR10) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Medium) readonly def
-/ItalicAngle 0 def
-/isFixedPitch false def
-end readonly def
-/FontName /CMR10 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-251 -250 1009 969}readonly def
-/UniqueID 5000793 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA052A014267B7904EB3C0D3BD0B83D891
-016CA6CA4B712ADEB258FAAB9A130EE605E61F77FC1B738ABC7C51CD46EF8171
-9098D5FEE67660E69A7AB91B58F29A4D79E57022F783EB0FBBB6D4F4EC35014F
-D2DECBA99459A4C59DF0C6EBA150284454E707DC2100C15B76B4C19B84363758
-469A6C558785B226332152109871A9883487DD7710949204DDCF837E6A8708B8
-2BDBF16FBC7512FAA308A093FE5CF7158F1163BC1F3352E22A1452E73FECA8A4
-87100FB1FFC4C8AF409B2067537220E605DA0852CA49839E1386AF9D7A1A455F
-D1F017CE45884D76EF2CB9BC5821FD25365DDEA6E45F332B5F68A44AD8A530F0
-92A36FAC8D27F9087AFEEA2096F839A2BC4B937F24E080EF7C0F9374A18D565C
-295A05210DB96A23175AC59A9BD0147A310EF49C551A417E0A22703F94FF7B75
-409A5D417DA6730A69E310FA6A4229FC7E4F620B0FC4C63C50E99E179EB51E4C
-4BC45217722F1E8E40F1E1428E792EAFE05C5A50D38C52114DFCD24D54027CBF
-2512DD116F0463DE4052A7AD53B641A27E81E481947884CE35661B49153FA19E
-0A2A860C7B61558671303DE6AE06A80E4E450E17067676E6BBB42A9A24ACBC3E
-B0CA7B7A3BFEA84FED39CCFB6D545BB2BCC49E5E16976407AB9D94556CD4F008
-24EF579B6800B6DC3AAF840B3FC6822872368E3B4274DD06CA36AF8F6346C11B
-43C772CC242F3B212C4BD7018D71A1A74C9A94ED0093A5FB6557F4E0751047AF
-D72098ECA301B8AE68110F983796E581F106144951DF5B750432A230FDA3B575
-5A38B5E7972AABC12306A01A99FCF8189D71B8DBF49550BAEA9CF1B97CBFC7CC
-96498ECC938B1A1710B670657DE923A659DB8757147B140A48067328E7E3F9C3
-7D1888B284904301450CE0BC15EEEA00E48CCD6388F3FC3BEFD8D9C400015B65
-0F2F536D035626B1FF0A69D732C7A1836D635C30C06BED4327737029E5BA5830
-B9E88A4024C3326AD2F34F47B54739B48825AD6699F7D117EA4C4AEC4440BF6D
-AA0099DEFD326235965C63647921828BF269ECC87A2B1C8CAD6C78B6E561B007
-97BE2BC7CA32B4534075F6491BE959D1F635463E71679E527F4F456F774B2AF8
-FEF3D8C63B2F8B99FE0F73BA44B3CF15A613471EA3C7A1CD783D3EB41F4ACEE5
-20759B6A4C4466E2D80EF7C7866BAD06E5DF0434D2C607FC82C9EBD4D8902EE4
-0A7617C3AEACCB7CCE00319D0677AA6DB7E0250B51908F966977BD8C8D07FDBD
-F4D058444E7D7D91788DEA997CBE0545902E67194B7BA3CD0BF454FCA60B9A20
-3E6BB526D2D5B5321EE18DD2A0B15E53BCB8E3E01067B30ED2DD2CB9B06D3122
-A737435305D42DE9C6B614926BFD44DF10D14402EBEDFF0B144B1C9BD22D7379
-5262FEEAFE31C8A721C2D46AA00C10681BA9970D09F1EA4FA77428025D4059BA
-2988AC2E3D7246BAAAFB89745F0E38580546045527C8779A254DB08DCC6FB9B9
-0E172209FBE3857AF495A7F2B34BC895A39A30F903DC6E3202D29AC110D868F4
-7184CB78407B8B9D42F6375F67FD4B828592E4A977B9E71854D143CD1A9EDCD1
-767CC2929E071FBA4C3D17500E28A23F697B5D5CC68D5F56EAD14BD504E07182
-3FDC12F5404E74EC1C02AF00C1A6A17F958770ED4A024F5B3644DEFB61F2578E
-56013D0B4E7CA3AD255E23DD63369A921D427EEE0E098E8148B16E8A5613A8F8
-A5F1099E15AD16EC554B644DF306F0CF3571055A81F1B464529DB49E919F88E7
-581066BEC4765E31BBE28C245BBF0B74610DBA30C63A71A4F3B60593A6B41C6C
-636C980828CFE9A3362FBC02F1967F0F770A4790F90DEF9D56E0A76B0703FC58
-2841E6E8D984FB476D4FEB960FFB6B386EC6CBB9EB83704B0AF63F38C77090A8
-DAA165E6C6BC86601B14F8E9F504A9D578AF05128D8C1BCEA9D21057958D5DCF
-653026524A2D101334AA3DF02A3CFA410836E6001561C00FB34AB04FF97302F0
-7CCD024F8C61577E82FF229A45F7FE22ACEDD95AE8052044A41EDF46B8F84346
-7275F5423171DF88188EE93BCFE0A84AE5C999E9C774A32B7A2826CEA8A8560B
-2F61A42F967BCBE2081DCA5547D9EC53467ACF8A6AADFC54CEDB7305DD661ECC
-3FE33D8C93D2425ED57BA83F360A384F6B94023EF8938DC136ED1F66CDB618EA
-F40377CDEE0F17653E011F5CDE11C81A3FA5F7168681C02167B275AC0F73EF89
-521A152823FCFC811C71E5D05D99094EB69E5724B34217D101BAA302B5BFDDF1
-4DE66F7887BFD458C2A97A835C72E7A6EC2500577B0B057BA1B4773094EA1954
-589FE5B1D1B4520FFBEFB6ECD015B606A244E605E78D39EDC316D97D99862CCE
-898341583D28F141A02877B76050B07694737E9F107F153E5A5C7393CD479A09
-114F07D12DE0185B971BD526301914EBAE20A38DC804C2319EFF3C8C4186630D
-C91141528F408EEB02C718A0A3E0D39D1C9853F71113AC07DD209828B4873031
-3E7A4E45D95025D9C558CC0C313BA3333EFCEB2D95B7BDA88C062E5243DFBD99
-744C678DF4AE3478C68B4F7BF5C52DFD8A81DA0BD2C95229BA43D15986717CB8
-A925638049C2A15A6913B9819B3642F68A07C4FDB2552C97D29211FAE2F16E40
-076342D4C5A72E0D5185CE8EFB7A8D87D7F345E776512E8B41609794052B9A08
-87EE0DECF203189379B9DEFB8DEC9585DEF2B44C7F64B4DEE827C74B975BD1F0
-82D7E511A5A0FEBD52702F7E68157B509F303378B191BAFFB4229495AE65C558
-D72D9AC8286E61633B29CF90917E4A01030D6B82CBF263751BCA8AB219284B04
-80A8F4B34D0592EEAB82D64F9A5EB6A08A6CC5A7F3D3EE2B61710DB386AEA658
-7A059E9633123EFEC39FADEA37C4205112063F7BD3D2F8319A30DA796E55BA23
-00DE2B3C15511F87044ABDD9DDA9247B5E785A01A05B39F1A395E36AEA4D3D4E
-ACACCB99E99DDB1AD1329069714FF050311B274E495FFE43D33DB3BE958098AC
-61150EBC4F9DB7BFC8F6C81047DF0BABBBE67970D14524C82334B693724A0818
-0007E4E848CE4AC8F07E72F02D74CC5C06DE0A67A63156F950A7AA1E0A110C6E
-D2B909B5509D583DF2F64F313FC8E07CA35A25885AF09F210395DD420BB71BD8
-478E6432F1CE528B757170D0BBD9BB349259BB70625DC1848D86B5E8793BADF4
-6330F6A01861ED57B25945C642502A733B4560D1811C7B2B5A3F90B15146A58F
-14913A4918A5468A18AE63C12490E15E3FE40A5AD3E95464663CD370B5EB55D6
-0BA607CD19597DC75F39DD2E8AD0F509A8CB2D15ACBEDA7600B91F35BADD4A8C
-C9FBB94DD16DFE073CE89510D2D6B7EBC43488ABAFC2C2CAEC13125ECAE922B2
-C4667C6A599151ADBBA22B97BE44E0F3A615C7A6A22A398903A81ECF77A9F01D
-7B6BBC17DD8EB3BBE7AFFD6803B38840E061A79C6C7A93E285CC8C506F14AF71
-FCF1FCF22828A3AA6C500797EBA483A70ED2B941651651358BD9C93626BE76D1
-AAE251F4D1F376C4AF4D48F0D581AC6D523060B855B31A7645D20E8308658241
-DEF960F89B54381E238DE2B104BEE74F7FF2C6DD9B925FF42A66DC9E275A782B
-16876E1619D6C2B1490C6585349BBCDD6262A945CF42E6C35E7DDEFD0233B798
-BF433F90021F67D54CD1B4EFD6968A1C5B29CEED2829BFA23C42EF2D747C57EF
-1CAF94CDFE1FFDBD6F88C0D2E8531A51F1BBAD8E57461C9310D6B9BAD7CEA09C
-8C2FA8D0B43FAD7C13D8AA1711BBEBD3B89BC9D91274F78610F6D067A1700AEF
-1E123CC81561E56259BD244840B2594A24AFE21F214222F44F6A59FC0F84174E
-7EE48F916AB39BE68281BFF1463A355A56CC7BE092EAF6CA0CB3C1E06C928E1A
-0D3D4CE85CCDF7F6B62D0E08E2E46FB7ADED0C490AFF4B6640097A4DD41940F4
-E2510D07CE29DD3A6CEEFCA73DB8D86A0014B744CE46CAEB24BE8B31213C46B3
-83017C1CC091DE57648036F060652DC324855451CE2959CF7F982CAF21C30ABA
-E45A1014AFC690443439574DFB464CB1CA8C6F350735678FD1A5EF82D20F1D45
-EE23C99F25351D350334B10E360BCA91127E8E2B8B30FAB941194FC08B1C8DB5
-2A4C35614F176AE7B0178DC1ED39D4F624B2FC74A89293CA795478DC0CAAA1CC
-83964CAFE4ED3222CB1A2572A8AE65FA335DB5677FC8C3ACCDBF4D7E86329E75
-A4D19EEDECD1A502B1B7937E02A5C49D2505ED4D8C80A48D116541A6FC97587A
-57AAD15D62ADB4B192335A76AA4D0205BFE668C646637F699A2C5495DCA10C3F
-3F3AEAF0406796289C5B652A96A44D1238571B7E419AEC85CB155AF0B099897B
-D2975906CC6C116BAD26E0DD183F4C831207E990DE542CC96540AD79D323D766
-F2AAA0580178942340464F2DF5FDA64D9938CAB032CBD48101C3D7E28F61445C
-7FAF809C359D9E0A2369F106D552B26668C6AE318E6FCB92DCC8939C3706D6B6
-CBA4F5424DCDFDB813A1E90657FD4F8AADA1F2FB211609B65E270E3E36C60B69
-CD42E6C576B7C35C2A45BD74421A82D5B0001934448F44DAC3BAB076C32B5FD5
-950D770597239FA277363D4784642ECC2229655E8DBF4F62D0020511F032EB3D
-84C5ADF9496487177CD0155E9118B029E6EF1EB55FA6E7A93EBDC5750FFFDB67
-9925AC018F637E6B632A9CD63D508A30124358A5499CCD789B0AD5460BE5EA9C
-AD047E6DF2BED2FB9B6769C40097B6A6B914DEBCCFACE48512E0F4FDA854E4C5
-C9F59CF101F530FE67973A97179FBFC82EEE205B3C1B0A77E4254C7F9BCF2069
-6B8EAF29D2A97DD2730B11A57B9A151B64ADEB26F94B22916D0B67103C8AF85F
-3CF7582F82E094E71C3BD8856C9A288A765E2E2C03314B0B0B6551015DA0BA55
-58A3DA441A972603867976B51561AE9BE1313CFA6A2CC048CC8CBAD5BDD3BDE7
-08A64C9DBE148774817259097257CBA0E410A2F42B2DA41F73E4A11EE0597813
-8A9D83F90AF1343034CBCFE195A2885D5B277297FE2AC6D1BD51B180963CFF87
-28386A938F7C716EE79E49CF02F581A44CA7514175932C37C0F09D0DF191DD60
-61B631EA311E619F2C0DAE744595C80C58B868B3419DCD8886426B69F9091F8C
-7BFA5F66BD9B9991731157408CC6442F4AE48B6CFED7F998698FE52C480B5760
-E692A67C1C3BAE839AD0B0F425CAF6CE1D3626F178C2307ACBEA6DA6FDC43307
-2FB2EEC0C5EF69A4F9D259218A3AC07B21C672B94E295115645C967FF5F70490
-1AAD989B37587903DDC9690DE2053E9D2B1C4C21FC913388DE4A64E87B2A7CCA
-6AA1E548C6AD28A7A2A5EEE835FC483D50C2DD749E423DB7BD1676CD28307B6F
-176EF792D46BA6EACC8A2F67388A41B794FE2E414ABC965EF46D4BFD32FCEA3C
-D0342D9F7F89874C2511295B6E4751DB7C846D6A4D555A1BC503C8624B155863
-0907597B0DAFA9E27A4ABBF92C1D37F263A49FEB3053E22FADE9DB15ADF12E28
-8EA9FF9A9FAA1F7AC3B8A75C9E9A4B3498C2EF4F789BE0DE2ED7A7D9C9549A6D
-06CC506A3883809C07A7C2734F4BFD85695FDA21D3D7846A5FEFCB422E101F13
-F8539892D34F493CCB83624624F0C82B5F4D738447701B11B9E57B8FD9E6D08E
-A00603E80B941151DAAE8C72B87133EEC4F9BB8991DFED684A0B85FAA93E8E80
-78B439D12A47E73AAC60CA0497CDE8D1A0A6ACF3CFF7693D63A3568CDF0F95FB
-551875358E679A9F9EB410F32E6EEA6BB1E05F3721D366CFD1B5764CA7896C35
-8BB41743B548B5418F258668895F70940EB5E645D8DC0433306C2BE78AF6180F
-3D39F0577445712C0F52622F7F1762678A322B80DF694BD4BF54E6B1A52196A1
-BD5DCFEC0D41CC0759750F46EE947B79169FD3A6A32DDB82E26954BB259DBC1F
-A249BB2785C43764CA96055B50C53FE069B5A1FCF1FDE5A89BB5BFF03AA9D256
-545DEC8DBF5438A3A1FDA3D5F07D90E0E65954557595C32D792D2D18B229651F
-2E9C6032A375454EB216C5C2644046630762AA1E3F74BF12D7F88821681B86DA
-2765DD48B4E40188130FA7ADBB0F0CAA2E60777B97C5DA64D3C4D41883E024D0
-8AA1AA29798A0B78B4133EA26629FE3993AA65A758F0CB39F9CE7DBAF531C854
-5EF520920182D6263CA7A7C27157933982B36F26970CEAF5CA3A18B40CAFB936
-86104D425DC9E7366EEC75064E4413C42850C450FEB972510BA51E38A2BB0F66
-3AEF123FB4FA52DD25B16A1842238B91C6D61771BF8A5B6E579845E5EAC41E4B
-65383D9FAAC7DAA6A778F98222DF76C87E1DCE93CCE1ED30D66039855FFF340E
-A786CF168C9F76A2B7D2E30FF6A775825D4775C0A788ACC76F1E605419BB8C37
-60DC30887F651C209623FC086CDDB12916B8E42D0F300519069A51E79EA429A3
-379879D4869EDD39144BC4EAC8143FCDB104C566B29C2E68ACD955FF118CD319
-36D435DEED4B9FB7993213504233B3972775F30AB3BD2E6BA8851A652A432793
-4A04FB1F16D98DF1020D570B2AB48403A1A829923E18364E08FABA34F8EBFE1F
-7409E5C6CFC15B8FA5B1C386C90D7B92518C68D9E7C2DAB02901B90B41113819
-05C0B288DC97385532C4F5F224E7246F4DF74623BDFA2092A58ACCF5272E2AAE
-B57A76EE743DF332473314499B2B498AE9E5433029A415DAA824300CA20F34A4
-AAC9C027290826224F0D116EF5FBFFDE0CBE00F5E6B43D3DD3BD9F6177C2DC66
-0B833711A9224AE675355AAFFE0F9243A733244D9623AF4684D6A0E18FC5E242
-00ACCC439FD53AAFE0A54FF74020CA655AB02666C959EF3BD4CFAF7A63D331D4
-B3B254C76BA8320833346F2A3FA53CE494471136E638268D0897A2F1B046499F
-7BD77605D91B2C5EDE63A276F359CF98BC59D135F033BEFA21D06D99987E2B21
-E5B5CD843817F78AE03FB9B1D78935D50E61F365261330F900055717A13E25B5
-C48C46C6A93B366B13EABDCB1A2AB703B4DDB5F5C6A1A4475E6509AE6294E611
-6E499ADE2DAF4832B233A6FA2570AA6CAC83AE35E2EB446F1A5FABA85B6E4DD8
-E080375DC95FCE7373BC02139DD7DB91963346413744B9AAA4CA95308F82FC26
-5320703FCA9459D6DF121640DAD72EBE2D7541945AC985973B1A0FEA51396856
-9446CB06D1A7086ED517A491FEB1B7A24232799E39BEE5FCCE01289DE30C25CF
-7490D0F4EED802203D250DAC213B6403DC9DEFC27410BDC861B95ECAA70DEF2F
-8DB5E37009DB23F6FCA2B3F32835EDA942BA4EC082C8243682B3CE6EB3CC9796
-D2C6B5D472D7739E70437606095E579069555A64D142945BDD7BCF857599E195
-A9B7FA7052FFFE674298FADD48EF982496E86FC5B0855D83BA9B345B0FDE1C84
-FF2C02A0C9F7F19965F4F1CDD7F20D85A11EEC663E2F5C61B86D6B51A763E7F5
-E23000FD61B509D366D8B2FFDC52BD6836CEF9FE4253B314184D5A5D4C19ADCD
-373D64A51818212962EE6CF52162EABEC88DB7DEE30E02AD28DA7331E2E11BE2
-9C93675EC49A01C3253ADC9625867D4C0A519788C4104854C4761F1FF9136AE8
-21DE74ADF1B0452AE45F9139C4C04E6F67C401267C04E57C5D312D7020BC5321
-00F6816368AC2222FD6E416B6B286066FFB1225FEBD82564247CC1F828D85C21
-45D7195CDCCD5E6BE96932AE5DBA1554E202433E4F49624762D1ADC676ED1E55
-0DF47E57F256F8986949B9F4A9CF83E7598DB82B3866B0BD0240C1D56CEE95F1
-D45FD1701BB321A1AC9FC04CC262DE5FE4C3A13EFF01CDB9B8326CBAA2816DCB
-ADBAB291B2BDE29678E08F94DEC952440945AE6EEC52BCECE39223318CCA50F2
-F02B898463A821EF22C7062F461C837E90AF5940AC24A6B9971EFF44085BBA01
-DAB3832A3383281E6298DB85FEA9208916A3D2AEC043448237FDE6E0984B73E7
-2F36C5CBC7D394FA47B3FBEB92B748B994F4746978746DB2B6096AC93BD0CFCC
-FFB50A50E8345B170C8B7FEC2A9CCE368FBAE683018C628B2493DE27AFE29213
-D4E9EBF87FD27D6A16182F032F75C82A793BC1012428ECA15A81FC9A6976E798
-7E6176F166B7CE3B8E32CED0A65AE3A7B5B806F0DF15EFBEDF3284177E42BC32
-07E06A79CA85B0C055DF516DE0510ED07B1AF407CF26415CBA73133F8C275475
-6AB88C244027FBA8DF3F34563D87DE9185513237264BB6624514AF991B56B846
-C574627224738E86880ECE97E11CB0FDEF6F51F0A3DF4EF202E4B5DCA01C6707
-0F0E593AC5FA1647CA2C91F7CB645E090D764AA3F9ABE16A6C4B5A9DB8CE9BFE
-4D9AC4406BA09607FD336D00B5776BB18AE866B06B937356BFD596645D75B3BB
-C158B097D8BA3FB86488BBFCF5CA81DE2448D5ABA852DBAAF911AAB69FBE1A66
-A439FDEA0740637930A0283B6A45301A8FF676256C6113522C3B29F13379B884
-A99BCB8F5C320D40D12BE0CE3AE038BBFB4E4145C93155F78FC101F92ADED739
-AF3FE2546E393ADD3E848FEB150C11C1F0C6981E0D451243B0043C0C6727B557
-59E7EA413B6D47EA3943B841011887692B330AFE5F67F588A53ABBF7424CC138
-8F6EB83B48E14D8A8E2AE488B19890683B858A4941B15B4DCDA2CF40CD97D9C1
-EA9ABFE5260C2C99FE59D94B79355CFB7761D372C6C62F102D748F139C696A69
-C2821989D33304981FB9BCFF1B25C325C1433FFAE03A3997042BFCC861699546
-83FA90F0EB2E9CC24BBBD089B1EEFD21C2309772D2C89A3D95C45F4ADF727E60
-B99C6B2BF508395A878F824591227359E159AE2D75882CAB0A18285FE0DE3D3A
-81016B46507D7B59FE2985FE7C23FA5C1E5298F0AF8C41E72FEF13B0951FC6D3
-3DD4A366EC1E8259862C3273F9A737392807F0A62443211AF8E033F656BB8B6E
-4DDEEC9C41562809441B4D7FA33AD336DECCB1E52BA8A8D1BC10286FE8114BDA
-286C50C8563503A0F8D537F1AD6B1E9CBB44A87BB9BCEF1E4AB228EE3EE2DE67
-0B89E7F50D001E2B45FEDD1EAB0018FDF7FCABBC2B1F9BEA12930E2C42DF0423
-2741C98026262C19DFAA20D1FB2868003E7F5DB0539BA3A86ACFB10151F807C7
-CE758CD3A78FE2E76BB8008EF031AB5DB5193CB153113CC4106CBB49388C9101
-7D5A45B9A61013989AE0573B354236E98BF873CBC30727C8584D96F12FEA2372
-2EFCEA69845BD7C18BB2B5A278FE40316CE63B4C0DF6CDEC1ADE00DEF4498893
-E272639ADA6008A22543166F39025511D0710D21E7149FABB53A333FDF68573B
-F88FD43E9BF1674D32FAD1356849C2AE5856AE30B694858485F331E04FA5A5B5
-DBECB8F8143D688884FC89897737070B39F145297C1538DE6E8B4712DF198489
-D894FA25205DCEB0B81C8BD4ADA1945E3F8D34D7EA26966383B00DF790945ED1
-AC15AC33D6DC2D53BDAA692589F1AB55632067E149E282865ABA9C52B9A7207F
-2ED97579A16AE18A47EA7F24D095D000CD0F9786E2D136D78F55F3352BFE327B
-9AF9B31B72E0BE5B6D19BDE38C2E47A668B6426A305E4B246EB89831D65A818F
-CBCBCA8513B682104E8A8E95CBFF674B6E6CFAACE48754FC14A3F754FCF499BE
-24B3A2E981BC36694DBB69589C8E98652C7005BDDDD9C20F49B9C0DD26AB6C82
-2AADEEF6CFBA8F014E08DB4E9DAD5C95499E1AB96656819361DDE9050987981F
-9205FFEDC58C7B835288278B530EC8114F01D1373D0D0C037B822FD390EF8D75
-416A657C4E5935BCAB318A7762FCFB1BAC97E4B2C091705D4EA88CA38387271F
-E112A2EBBBBFD49D662107F5749D798D7F9D5AB851140A03B88960ED03524EA9
-82B544A5FDF4FB816D2069759D12F9C314A9764A869D093682AF91CD859D042C
-6A5333D38122F116C3DED8DDE7D0C606E811341E60D769BE3DFCA0AD4B876783
-1D250619A16675BAE9B51F3555B8622C40AA35085E6116878FF7BF32AB91C524
-4E275BB651C67AE7C4ECBF2DC5C071046F8982BDF694101CCD30DE01C4BE9B13
-7BF2CE9D94F20021547AD258C05821836ECD90CD9407D5067FCEB84B3DF9A9EA
-6F92CB7695EC0EB932443FE9C56DD99B70E83FD2D0ED79F580A8C4C0595F35BE
-007A389D854F797D37AA34609F64D13B25B6B135D1233C9DB8B68097C8D1C530
-C938D860431323B7268A665A46B5C72CAB46C5098EA1B97CAB1BF164A2A09AE4
-F5509ACA4A84DECC415D3C84E7D4CAE801DBA6D5925D51112BFFE753BD26ACEC
-EA498CB406CD5115D0B55221C881156F10A102DA4D4FEA3C3B9C2B79A6359439
-1E39C1D4D93431DF030B6CFCE095FB7FB4964BD7864DB6235DBB47AFA4ADFA45
-13B1E110287E295908FD7A3499B3451D22FD17C1F6C0C7D08FE52CF90536B0AD
-397FA2CCCB29F20AB0785C129608BE24A00DB26163EE47E1DC9D3A5DE9C1FC89
-15A7BC9E586A50BFD9168C6BF2029587E51999E284EC49343D1B1AE906602170
-4797567C7424E1900D034AB024C822D30FFD93A27FCBF22DFD51F134FD616305
-AD95674047F8777A5C46D3ABC17D25D13044739865110C9250B28A882D1CDED1
-D72B2DB691E015DDC7E050D9D9610789AD74071F7EC40206C0F8F732C3E453F8
-FDCC30AA3BD1B57B8BEE9699E49E36BF8B1A8616565373E36369000F7AB53370
-1431238A05EC3EA87066D8C40BBC266CAA23D15370B438B803DB6A75ABC79E5C
-EA85A2F8FFC437B2E52A214605CA05BF42EAE0A5A1840B8158EBA0F675430C88
-3888099F3690B0E260F79D8F08D1DA58151957A707FA9D187AE811E3242428C0
-84C557C1C321F436E9CC1E5773566D83E8866823B6B86C7AD37C665423A02508
-85AC9FFAD228733AA729ED572B88B2D39032BDF84FEAD1687E0062E9DFA35C71
-403CF0ADB903F147606C33442F62A8484A01F4438C4906B864F1466ED1C2636C
-0FF4AEA4929E63C9577198F1304BBD9B5B8E05236AD4E066F58CDE649981CD7F
-4B78E4868D4869267F580D485986CED47F55DF9C5C81147B42AC26E2C154538A
-1114DD0F3EB1005F5414C351E7DDEA96E8D6333F06573C6E0521818D483EE6A8
-54ED2A8BEE7BB8A068DE874996A237F3A7C6B0636279B68F1394A54C4ABEB472
-8CD2217D02A772638A58F8E6D74F0754049F1ECB99EDEA043F1FC05064BF4C45
-E9D6721B3642E1D53141E35874BD35D06223B124A13193F481C589C3668302D4
-D678B6DF9669934E1FC83CC069D1772104109554AB3A554E716B500BABC72FBE
-B84FE40A2F6F772B70E2AC66CFE692C6B3768E6FFF8F63E163ABE4157DF2A635
-87A2555ED0F56584F79EA5B47D7FA6675F9D4C700BF6B92487A03C6B0941DF9E
-EE4CD5831779C1C6979E5E2FA3B1D1FA0317A0E3FE1FE9A53F0859A5C689C345
-A337C220979C85F37AD34F2A7D7255DAF35A011A0FFFB559035FB8CD0B90AB59
-2CC2FE17A917ABDC165FC3D1A753A501D449893206C749C1039BAAA11BB33863
-8C405FC93FACE87FCFFBD20861AB205C9F8F5AB6740444D7EBC7DC07C5B8F501
-9DA9663E2B8D29BF70484EA3EC2155A0A6EABE996F33D74D7EF095787BE6DE32
-F51A4A219F0CD9F0860948C5B262126B9B2585C9F30CD46DB4F99DAAD0BEC16F
-63FEEAF9161A2EEBD8927EB7646A9039B6A1E9C8C14BE9709B66A2386A32E024
-3CF0B1BBBB68BCB6ECAFFBBD742B9366B10E5BE2AC66FF40AB07B82FD3BF238B
-219194BBD20164DE983E34234FE2C8EC10BEC4196FFBEDC0468808CA36AA8992
-BB44CFDDB8F94F5D5A494881CBED95908F03A5AD3AF3A94D8C44C7CBAE2E52FD
-7A7F996A187ABA9B3E96118DD3EEDDB2DCF4F140F48085A6AFEF163CDDE0E497
-BF007072F1192AACF9A26FC1821E8E3CD880FA217C0598D9A634EAE88ACE1B7C
-A98295A451A6EC4866F9BA137B662E2E5F62254BF6724E05B0F15148F539C70D
-B6FCADED14BB9ACF54EC2A8000B3C08AFBDCDA70270D8F4021418D2889CCF5D0
-14E3AD0DF281DDD5E4D9F519002DB6FDAE5C0CD87929DC96395859988C679EEE
-058528F3BE744BE524A14003F12CA045F230524140494AF22BE9FF9C727CA184
-D5CDB28C13074D19DD6011D1040EE07317114A8486482CED4A3EC5AC49890093
-C71942DA2A63D91125BAC0BF3FC3659566AF60E01ED3ACF76436BE0B74505670
-FBEE6D3C38FD924699F33A50F51F416850C62142803068C186498FCE4879D620
-63BB5498D83CD023C5ED222E510797A4C8941796792C4B3DCC2B4538759A21FA
-C7E067054C2D3AC313DB7EAA1B4EAD985665A93145E1FEC13598F768FC818E94
-007B4D7C2EE920BD97ED83E2685D0BFE89DFBB52B6409385F4022C712F7B60B6
-39C4E884045FD639FFB89C5FF227C1822788881EA9B50C582AC3F333B15A9A31
-C5F81E1B3041DDF4D5ADDF5C94A7C221D103CE3FD6A85C2D22D36051A7C564C2
-6AF27628E45CC8852317DD70D695F26CB9B42480884D8CA671E7F4C27268481D
-6FD294C05D1731AE5FDA2DEA873626E633E55E82C35F8B27E4C1FB51D0CC038B
-ACB247249E2720FA407BDB55440030A6B0ADFA401D596B98FC1864FAF30DF9FA
-E08D42E2C146E9924372B766423BC77AE5DAB79C5DB2D45FEFFEBABAB2FF4D21
-FC1529F0DAEFEC67E70111ECD8566F21BC36E7972D6BC145FA268DA962A9B82F
-59A0DDA12E80AB03F9D50B572E4553EB8091EF2A4128CF65A12675665809AC3A
-1FC030AE675ECDF7A468FBB231BA6CCCC33CB45EDABDBF350D9F9387FC4F5184
-A9CBA0A592025C347ED1996A0635DCA677F988B58EBB056B77C44DF9C5ED39B5
-D14368D82CDD94F356D3973758EA1E5C62E53A8D0EC8B25FE43B22F2F23B4DF6
-C06DB63F1953171F545D634D4D595812FA8768B2E2C402E26650F365258C1570
-09F07DDD2497CC71D932CB12F57452B09717FC7FD70EA4463424325DF60FADCE
-9609C4287F2DA93300EC4CC8FDB4FC942B18A58DE47AFA62182BDED1072A2549
-B949E975AACAD15388C3B98A68AF9303F21B0617053707DF043D72E182250EC7
-78B7F11801CC27D5658FA3B130AC7460BC630C8FF8EFED814057507F8AD713F1
-F92325071ACCD8BE7D9E76E90F61292203DB7640B3D7922A11D0F2A6F09D0435
-2D56F2A48D787D4E6FD34517068117C42687897A240C26AA700379536464B08D
-069537FC4C42D61F9E172AB1DD42FA57DD80944241434FE5FA00E4F14B839D5D
-8D16EDCADF2A594747823CA87E0826F2289D0566B80653B7B39844B09FECA756
-C558EF67A131FB0B71D471BDD13D3C783CBDE67A3F8D3ADBE0DCC8A39E6A8BC6
-552AB3C0F5F712ECB52F0BC74D1D10D4FD2135199382F3D56515235C33E0B651
-3350D21CB488B6BBB6C9D3B7473169C7BD7EDA4DC569FB0546C7A639AC88AB5E
-ED2EF7EFAC177400DFFFE5470F3CF606322D49BCF40E47846873A606FF9985D9
-8E20C953D31A489A367697DA1474BD2A79B4DD90968DDDA07BA0FE6C9EE3B943
-8B184F498C718E765D3576728876C87C50515D288D2FB6A64D816E8E51E22A9E
-87B6B73D00B0660C2C3DF7D932F673874058AA24B1183DD282EA672A1C4B27C8
-709E88F120A4FE23654091A7E8BF438665B2CC2DA694DE1B18BA2C5332F7B02F
-E3D7B7DCC0E3FF2D83BCE7618B9F572360A1D581C1324C5919C7029095953848
-791AA10DDD56C3BD12406313DC9E64572A66EEF8694659103AE357173EFB5466
-ED232EB0E51FF656283C78113B81150FC04DFCBF030004B7C55A9D656B0D77CF
-7700185466B8FFF1AB6F5536502478DBAFA66C3B215953D7A9E96478E812891D
-D7C5C151D1A949C4D7453AEF07FE6E01BBC933990043A9678D138963E1F02F18
-0005B9E27EF25FFEECE19E07100A970BCB3603908562763819DC35F45A70340A
-7C1F57C0BB00C76AEF0EB12E8DF0266F202CBD3D1B6FD45AAEBEE978D313AD0E
-E4C1526036FB4250887C14DC3228334A15C8885683695CD359421B408EA8C6F9
-8BC622554E2A3A2E7A2CCCE09F2F8B725CC322C3134E0791CB5E9A174ECEEF25
-9B0F0BF136AACA162CE9E4204ECE3C9059250ECD5AD2B19905F21071389F5034
-0E34053479EBED41024FF64304AA549DF3BF21F41A56994AF12D80029670503D
-9DDD2212FBAB31FA0870F72FA48A82E2F3B3CCCC052DA7ACCE81C3759E00E960
-41BC84CEA604FD6FFECED11C49930FAE98DD0437214EC8E73A0421871526418D
-2B1B122092C6C3A83E506985BC5BC19759378BDE912A8D300D75F3768734D39E
-59593D5240E8472DC7844BDE3AF38F9FDA920485B2A882A10419D356631F0BA9
-3C5A3BF39B77F63473B18505CD4E248A2A95370E5D83BABF1D393C75E7E3E5D7
-C8B8D3D3CFEB7EB5C53B9FD5095766FE77909E81AB41533838C396BB78C20737
-75868076301DD5F7ACEE7A20D59F096868229EF39B03BF3F46D2D2FE27CDBC77
-2072C43766DB51DD4625307A10C363E0B7FEE1B1F7B9C38B2518753038323256
-E01CA10049B0B602EBDEEB3F542D813C58097FC87A5C570CBCA2113C0245C79F
-747CB5A447B3A40E0D5774BC8D68BEF2EA495CDF36D18F469566A9B9C8DD5AD4
-EAACEB9081861EF8723A5ED5E02C893325DAF85D549A21784FEC9BD63D9C8B32
-8505669B526F0D97FA7CB55698563D7B01DFF5CDE8EE53D1317D3D410D1ECA88
-AAE1F4CAAFEF86E77F379390E0CD14809017F3ED952F491A23A25298F9722E40
-5B385F4AA2B474210A0CA967B51A45B8D17CB7224A5A2615612EB0AFBD3AF404
-AED70B564A18648A35DF9F0E36CCFFF88FA4718A21001E2B5B4000DBA142F262
-861D45EBA054CE3DA3761B05B3C3FE29D59D3E81D2CC5CAD6D529EAFC6810D7B
-8DB7CF9467FC50252B6D7142C958100AA968C93C123A3707DD4008BEE6D39F7F
-4CD28BB2A1D67C1876C641BAAD8BB9BBBCED59B171B83213D72C1845D58CF692
-C6C3C80E924EBF9B7FB26152F19F519B054E8AE01E5FDD0FF0C7701149408375
-2E76402704034944C103235654F0DBA31FE0042472CF06113A4C2584BF947099
-EF3A768BA9E14E7F69CBFA9978F9DDD7016C697D973AF60DB6F3C2063B80577F
-AD99F40F8EC7F31AA12A67C2622F315E644A8B808F38C877FAEF3D01F0CCD87D
-852ACC6AB36CBF42FEE11A02C17A60CB388C69B690FC81F03357522FC670B376
-A3C491ACEAFDD709481AA37E230C691078848B9A819B73953545767E2A215B64
-DFF1B915CE5F0E009CCAB4D0C4B3B2EDD07975FDE4B9ADB7F5006891122AEE66
-16EC697DB4B69E3FE885A55459A51365E0B2D72E54DC4DEA04B33A3D009888DA
-DAEBD4B1181572C4BC218175A08F5F50BB6269C3CCD49D0B0D22CC72316EDB42
-8A3CDED2111BF5B403C1A4E6AC579CF6C63CD6279FAF9FF142B170B5378CA8EF
-A3654A458BD2F3C7FD957B210238FE1AFF4B18B65DAD7BFBB8F62611EF0099D5
-C8A630E73806F4219FDD072C1DABD0A341CCB37E9B604378C67C87E0ECB712D3
-FC7930339568353B76F567226D72AB9159952570A08FCC0B2B87E800A8D124F3
-85B2A6C0214D533F26E002D92597B97F55EF410B6B54087C8FB109F7B76BE860
-0FF110E0E655A8C3B49BBE0E2F582BCF3C91B8B5A9ECC5FC8375F4EEB4484CF2
-C3BDD4B9164069615F31879D68B2E74F00570A2160AB3854A5E8EA26E17366DE
-23EB2550F88B018C15AFD92656862894C4B2D4D1512A8DC0D64F944793964870
-E2E48907A37E788655CEC0B2528F2A73847B088EFC550886C8987B47BEF988E8
-3DCBC40A1BDFFF75F1AAAF2D497BC6A993FEF661B9C3A5CFD771389CC7B6D4EC
-9FB4B15EF86EF187E3867B196514F3D8FD6B7F7EC36B9FF53EF20AEA17442B06
-C6F60A8CDEEB7BBA94A5CB0FDE96417292722E548226003D4AC0A8BA29656740
-7B1396804886988E2C2BF43C7CE57EE2719B6D8A68DE6866173A5C77B4E25390
-B48A94B3CF392A937B638EAB1E2FB60BDAF954871087D56783DE09A1406665C5
-2E3DFF84E408DCB34B0C0928ED19B26DCECDF7DB4D5DBE35AEF9035C80015DDA
-71E1DEFC885117E1EA3DB2DD83B5EE01B2B81587A0DC48724199130FA468D263
-1D01330037604C1A14127C27D66BAEA888AD7E65140FA9BCEFC5D2D1DB061317
-4EAE5115C548D5A08298FF71959F62FAEA04F3FA85C4CADE97D24C7CBB2BF2A5
-BACE9CEABB91447FE1444D839CFABDB8ED3DB3D0028D0175253DBC9442E13D5C
-C23F52460735A4FDE1CB7CBAA3D6D6BC40416A61634065C58CCBA73B60C5368B
-0A3910C08E94D3807F151628F0412B85FEFB55C550CF0E0B5C6890D031F24AC8
-D26391DF7CD87CE7F72AD3F0DEC57A5B198280733FCD49031E8EDF921085B442
-4CD72CAEF01EB686A3322CB3BE234944E6E84CF8873503950BD5FE9D7504AFFE
-7319BA34F89CD21AADFB51BABF79B45FB1702142EA84A4AAADA0786585042F4D
-1E1167B62455C585BFFA057AB5E5C2B91DB5B453EED7A2E29857397E26E4E33B
-C7BDC5C4C1E113FDE07C899AF092C50D6AB9B3EB3F778C0C13FCC166808B1ECE
-C427295EDA2FC8308572598AF2E2499A50B82EBB2E95A3408C68C9CBF67F096E
-C8EE214071FBE2753382B4C09B428A90273A4D287BABA5A786477BC46B952B7C
-C1C7E080D6E4FD6619FA1B6FA90BF42F007B2993A33849BDC37399B8587B47D7
-C0E65FC34EC11BA84CFDEA661D2993AD8AC58A359B5DE8686AF3F1383F39BAB1
-52F7890C9BFA80FB61C8B5DCB6590763D395676660A35DB878D423532A45B7FC
-330D384863BEC39DDC9A66D47E9C5A078B3374D1F28E70253FC7A92CC85A2DF8
-A2D393C71378EAF96754DA1329CA884E9648F3B1A478C329D4C7298B74E7DD6A
-245BC15C4BCC2FFAFCEA6C61A01F197E0E626DFE323C29EEB9A6C632677B790A
-3B826DC6BBADCAEE0219209F9F2A5D240EBE1423B7BCFC9F07C4465597D8B3AB
-5A3593A0C3449A2E6D48F304D758518867AB6ED7A77F8E976F4EDA54E97EE92E
-FE6D9EEA77BC2F247980E6B2C6AC7B3E5330C43A27EAD1ECECB37945660332B0
-3FA9F704F6CD8A58B6297F8805876EA0D3C41ADADB6E5F03D27588486574A4F2
-10C1396B2BF91542DC8FA0FA5273ED7CF5A49E95840CC2F9FCDAE3EC0D3F8AA6
-240895C08BF9096B45714F15AB4995634F1DCA71EDEBC257339ECF489A2B5A39
-46040FBEF5918E64952A4F253C8807F4B25AE4BFB7641B245F0CD870C537FE83
-F361239B6FF4038DEB4C059B7CC31683815B9D65C1A4782D11FF428CFB7A2AF9
-9CF4D04F7395CCD2C32CE265B28EE9D61B0EA62AA442DCF5688985927D8C121F
-06DC7D1EE69AD86B71A271541279788DE1EEDC3F6E32FD483A42518C2DBC18EF
-67143AEC4FC1B22FCF3B8147A1A7214B590CF918591A96ACD63E139ECFF4ED2D
-7CBD468EBCE8333FDCB29457E81B6C2EBFB05871DEEF406C84854009F12BF369
-541A605173F9841131FA62D94E63077DBFA91D8520979C31367F2A44C7011488
-4C8DC3C15738F654125A3F47013B9759B3DDC9B28E24D7037BC94DF2B0AB09DC
-EA1AB143B25CC14859F7A2145629AF7DB4A332E092E7F8CDAC809F140FAE3EB9
-4D68E5AB9B3DBBDAE065AFCCFC31E9C937BFE4B42F28C4C6A12D430BEBC857C0
-67525B939D69267DCB9186798449A337DF3FA711EF06AB3CEFE6A97F3796A892
-BE12AD74ADE3F0FAAB57F0F0AD4B3F5DC43B1487929F9BE52FF1CBE5F63E2F9F
-A5DED3C4F035D54ACA398982633CDF607821E3D96AA9C339A67560A60BEED856
-9BC338DE78BBD16D8DBABFAB1AFD33CB08C5E14ADEEEF4B6C2D38E76865975BC
-5476A14D4AF8C0A8337C8D3A4AE809FE98C2AA4F41A38341D0128583470FD611
-D6CCDFFC57F64DF97A274313521A1C30D01C5CFC7D11E09CA50551072F54EFFA
-36A3E0943EA8723D6970BF76C051FE9FD4B73E161A1CB1FC69003B7C9716D1FE
-10A98EB2AF52256BE0474D42B0408B6680BBF268945644B09AE11347AB57B0CE
-E2B7047594387218A977B323520E38FA53FC572074967B270F69BD6F680B3E57
-69E022C9B6149512C5E89D1A37C7B8F3BD7EE595CDF76EFED653AA856133A6D2
-16E43D551A2BA3B3C7EEDEE3E07F8FEE715F8C016A3A8E2C8B7260102FFD39CE
-56DF7525657B9D90D0211A788F3728B894C0145C4400F784EFDD78E92E127CDD
-C6BA4DF9C6616729390009CA9FF343009BC9521D96AD6F9CE221DF061012F952
-E7773E5A26D7115F2A4472B4C0CA7B161BD32097569232718CC7DC070C047155
-2FC0ADCED5200FA5F02B94B0F8665E992573BEDE1B2B03C807AD4E35F8477321
-48FBDE8559ABB1FE205EFEF3755939A8DF1214E99A9C614A667234CB6F142DD9
-D7F5920171EC57F6C8117F5D2BB15C7FDFADC09CCEC1A10AFDEDE72E80A52AB5
-2CDD21447AA80F5079B1A759780CC43B5FC0D43275EA14E397C4FE4B4AA67246
-5F7E5AB85DCA5990628C5F7D955766FD8B04D9D669802CF94AFE57C4E59F77EB
-CD0597766607DCC7D4E6F91F57FE82E9F4F6DC71FAAAB891C4EB8FCF06FC9879
-9EEDB45EEA7D53C5716DBB6456084227CACF9ABA421AEDB3FA92D605CC083DB3
-F27E6336514A9B623118A54E51DE93F883211FB1B1A8D9BE8C35E1640D89EDF0
-DDC822138FEB852F92F4B4F8A96CC2C92D64F1DB3514B7AA5E04CFB1F58C6635
-70A30E6E1B5E44CB6F720214B5E395D2E7587EFB9F8B6133BF23B06CC69F4C5C
-CA15F6BFCF4AB67AC296AD10D0936FC92806CAC0EADC1220496EFCFF92ECA9E9
-339364E087BE72685D0265D1D2B95D4D68FCB447D2644AC1B0519D234358CF5D
-FBF1698BC26A727C97599BAD9247277A92998E3709A1021C93286349B1AE8E0E
-580F7F3C7692E55A3ECF2937AF09B1D782F90AA060E7200DFDFCF7869931E2CE
-30A6B5C582BD0E8E822BDC16E77B79F0335A4D413B3802186208162E06B5D791
-0561EC0D31D10E6970D9C28628657F68DAB76D6F406C104F160597AF104D4281
-6294DB0BF54A3A32553EBEABCA63B1C7E35459CEBAC533E1E037ED126B34529A
-286A918360B5BD1B367538594F005F4B34C345F2C6FC38983735E62A994C7CEA
-9666A2A5FC801271EE6490E0E5E3A4EBC5E38CCF6FF7ECA9A9914C5B66DC4F19
-975D86A284408E9BE33203A5BA782F7D39078BF626C427B546D8BBD4E393F6AB
-B561CA71850FA7B5E956BDCB8F775C39312874BE76101B0034540A3CBB5AB3C8
-89CF2BB95F43D0066EC5C8C7C0EEE42CEE53765C423A4E06A1A2FA1FDD18145C
-C1052CAFD53A84B62361066477C57D9BC7696D966861FE3EA79B753A49195C5B
-8E61B077ACEB6B4F8643366762ADCDD2D2CDD7744422BA22D778B9F7F391B5E9
-3D4C1431B772C5A9347B192CDA7CFCBE2AB0E94D22235AF74F8C3D0EED8560B1
-9510E2240F1E3D8AF8629D342B55C2FEB8CE118F8F9497295328AF0CB92F809E
-34E7E48BE95EC49653101EB35B7399E2C824E3420630399057F9B64AD2F3DFE0
-7E780EB7D7A22CBC732DF00512EC090AEBDEE13C29D66D8DB4AF2DCE7FB3CB53
-DD7959BD0FDE48B51AE054BE163786D2320EA7905B9FD0FBA31A558E3627495A
-A967AA4B19982B2D55C8417697374A602E8E05C84DAB00838EF855E82E049632
-B43D83E41E0055424F6DBC3CD104FF7A0C957B210DCD12B8BE3053ED3F7E2267
-01F2AE7136B406E5F1AC1A49473BDF8EAEF2EE3BA2B12029A3FEDEAEC99E8AC7
-AACB7C44642F4CFB24E7656AE620D3AF67E46547DA444A0428E5840CD91C54FE
-8BC58A7AE5DD00182AFC6B4ECDE7155C355BAB29CF11666EE405A7FD57888731
-266E7C857E8E4F84656D7663BACD051F24FDF9EE47770243F219656A2E6A0B1A
-17FF66661126B89AB2E23C4756EF639F5C482E85D098C0A90B03F6D5412D45BE
-4C2BCC48D310E937D80E5DD3E4743F356D8C2FD272B9599EEE2D27DD0BFDEE33
-54FC447A49DE6874C9F0F5A087AAD05464743EE1BEEFEE3683AF9A3ACF065362
-13BCAD10CE9CAD288EA642BE6789BC37F82C4D38F073D5CB33FCF2BB35937582
-9034BEE61F20E6A73A835CF9C0FD8481225B966BD79DADCDADE832C6BA2B3C10
-AB022100D029DEA9355973D7F7AC0140B361825535D189F04361AD41538CBF4D
-E44EA227E4965D398889D08AC292B00F48E3859D7ED4E17075864D286C13C5DE
-5F733B45DF549FD1D775436E4A2A5C98AF842FB7740F7BB58D0DBF2292AFCF89
-1319FD1B0764E7822234BA793A2D1FAD7208A574EED749AA08987435CD2CE663
-729109643992DF4A3C411FA46BA050B938BCD243135A4FB09A42F39B3B67F503
-0962612D243388AE25263A63638D8EF29FA9B7FF5C8D532C28211398CBADF978
-2D82630B86ADE6674FE7FA2D583B86DF883EDFDD9F640729A4425E8B348A518E
-1CA16E051147608AC08F9686351A67220E4741EB49F77E4C5568EDF5EDEAC713
-8B6DC7D31E5C398E9839D312FF3509E39CD6B4A5A81175AE67704D1E8A064848
-C59086A907B5951CDFCF925450F22985402530253D4C7E6359028605B306EB6D
-4A863DAD14B581DD2A7855F0436978308CA5704F8B93362F292A470570C7AE88
-2227C2F98E104D7A2472F3EE5E882764A3940D13E70DC3A70D0C77DCEB02D3D2
-B26FCC5626CD5086182658293DC5D1F02566CC84859040E2CEC9641C6F6D9F64
-FA12877DE33C6D1089CC7AFBF5D8AC4259B2CC12A7C3E7B69D00466F8AB0032F
-5E4C63594606A2EDD9DF34E6236B0AA10CC8C1EF05CE26E8419195AA1FBFE846
-5B287A23003744AC2C1071A860FB24B20E2EE413A94BC1591C32CCACAE0DA042
-675B4A4C612908E64EE78859EA44DD210ECBD01851352EDD2EB4C3F46EDB7236
-D7E0C297CED16A6A0EE23A188FC7D871CC8F2E40411CE8A70B218F00B6C300E3
-224621342EFBA30F6A3C964D6265810E941C0809854053AFC64543BD70D4F6B6
-95A46DAE926A017203EFF93BCDBC4F599B11AB847DDAF39624EA124A54B92844
-1164E8E87E99024EB0FCEC2A424F3F0BA397A1D3FDE5DF122B1D0CA76DF09C35
-BFC0289BC870F9DE010B0127DABBB7B49A37A1B550B18ECFDF97FF716B4EA9D0
-391C3D13C84221AA4B92049C7184D10DB406DB26C542008DCCDE7333EB1786EF
-A0CA1CB28566F1D7C3A973B761406ED9587E077033431F993F6C97BA93D9AE19
-304CB65A2A795A47674FDE0E53F86E7E983B5F47EC22D223C0E49AF1913F36EC
-76EABB1F3B1938554AC6DA19C882D7E2BCB9856735FEEBBAAF34185C68C1A478
-3093AF94A583A9F4FB60E26A808715CB777B74692CFC3071D3EB7C23F633ED07
-1B802D5EC257E19DB39192E073A9E84988EC8B54CDD9031ED5F296FAF42A126F
-7F1597CE1B8A203B192659A10DF6D51AD11FAFCA5EA20548ABD83DD7079AF3A7
-20D4685DD3439B41BEEC87B7A30675D7DA58A7994EE502F0AB165E5438AAD985
-B65F3032B2211A96421ACBD545263E51C7064E21E1D874739FA9284B9756F817
-F94AC94BA348AC6917E18ED90470B4DF20AA4E9E61A93D5D8226CBBCB25DFDEF
-D23B6AEB6853FAFF5441BC3A250F434BC1DA4201C002402A541EE8767F6B1C0E
-CE735074BE32512B0CEE38DDDA12C3AE00A80E9490C6D26003AF9FD671B12DF2
-037FD879A02678A692FD76FA97FFBECD577BF7907B5E16BF5ACE659A05022FA5
-242AF68A61623AA86F7179DD241728E6CBDDEC1E697D33758F8CD88415EA1983
-5C053D5AF02871C30E3969751006002ECCEEE8062C9DC97BC0305190C3386E16
-A31C3902B0B7E2CA22A2B7D492D5827109958823640FEA0B607F19C4CEAE11A1
-DBFAAFC4C42F4898546851621549A4F769B93A78DC0DF5F474C05FD991939A0C
-1639E8FE65B12DD11A7AD3DB911CE3DF79A8BCAA2E179E3BC58B5C0AA4CF6990
-76F90F8C7EC09A1CFFA875C63265C5F6A16F96A8053DDE0B8AABEA1926B1AC32
-9308E8428A1BBA407241DB09F8D834479AC2206BB2F5B5E62643A9304F186AA3
-CA03F9453C9606E22D04E1F5B9CD4F8300FD6740D6B02028F8F42DD171BBC42B
-3AE480477F1B753E7D76D3C72D3858BEE970B29DD3341CC373EA7BD004344632
-4E0808D5DC55C58190635238A8AFACFAA9EAEE4358FE65E17DC99A886CA06860
-906C4DA9BF158601F28138CA4252718CEC2231658E6502DB1F8E396F949A75FF
-FE4DBF1F2B49F8767CC3836EFD6F8F7C438ED86A8124F72D2EA3B86735CFE7FF
-D9BA0A6934705F7D338DB7C002C823BD668F333F17B2B980B2730AFDE0533733
-7E84843A2A6068D52F17A4BCDE265C6BD34828F1091CB0349723A555CE04C6F2
-DD6DDA70BC2D4B7D5E0E3A848E843298E4CCB3DB4F587569CCC43E38110362F2
-56EFE686DD0A25DA693E9089008913D5F7589DEF4B1B10DDF8535221D4B0CF15
-C05AFC299F60AACAF580779FCFFFD3C10C3F5D0B4EA3DD8C1B43DF311B207FBB
-1DCB2530A8FFA6A3836E4759A31DAF02B8E7340857ADEE3D827C43C414957B66
-AA41FFB0B9583A9B06EB4BCA97199C856B4C01B5897AE8F80AD2C9F49329FC90
-B58ABB1D76933ACCC3DF2236906A949F6FBADE69B20B36764A67C71812D1C91E
-48B9CB53E7F39295C0BB878368D170F9567BA2CC4E18BB2A475339611FBCA781
-DB1C4DB195D572FF48D72E3FB14C7F4924478F1F22C4234B38453E9AA7007AFC
-7E007F718C97C600CB9E4E7F75975857634CD939A5DF163EDA88459D1F7C308B
-0A9A03B901A34F81A8DD568A8EF7068AA45C2B71117B447CCB62B9D9477F2F47
-40D08E069066528991FEBB24AF15E3D0333E2D7D588D938EA828259E4E4BD0B8
-9697E6F24FB4AB37AA265577CCF342FEED3868FE1B1926A4016F0E1427344FF5
-15681D2363BF2F06255D4C7ED5B3BD836601FD004031C458E138C887FA5CF22B
-FA89BE4D74C58A3DE7BC0294D95714F1E8DB51178EA4575B30EAF0ABA4D5B082
-847F58210802CFE349C19363F032EB59CD39EB7EF8BEB52F811C9C0D9395BF85
-EBB88879D6CC1F1F70F4710A8B321339996FF8D125BD9B57CF4ECE9CAB813B42
-CC2D4072791CF9E13FFDF1CC52CE483CD3F2DFA0FE1B0473A414B317B8747E3F
-232E287B9B4C80E8CDB964A0F059FF01DDEBA695219DA6CE95E1F4D2BBBC4F8F
-F25F98E9E575CFCE6F66924FA6D5F5DB74DD1D221D77A76EC78E9D765651B7D8
-72FD48F3B74EE865D69BB2B6575E43B2B2B856952CECD9E2AFE4517801B1A2B9
-7F93FD3C69F1DB1F7A15ECA9CFC17FD40DA89C3FF8B5A2174D03F562556127B4
-6BAD807611CDB4819A17D32757C424F749F60D707A2FC4BD8835BB38E9F6B67B
-441C5D70D905A44663FB9AE787C3218785F276428DF8D1A3F568AEC0B3CC5664
-8857BC031F92980BFCCE300E3A6BCA03DA18BE9EDA0903F83D0BDC3CE786694E
-92C402366BDA3F07A339E229B3E915FF70FEC6C6F36E848502282524F9D31FCA
-8CF0AAB13B1C6D85A430A37340B654F34A030A922E79E88DD8FB877A3E4B9005
-B192D8AB438B2336CE4BD478FE17E78F8B50EF4BE1E3F35C760FF2F13D1AB0E9
-18213B933C60468A487D3100C6DD6A1EDC02CB61F33DC916EF33BF31C2C6A98D
-F417DB88BA308CE720D51B2738244585B5927885685AA9638445E5996E2B1783
-B40F0D46A144B2E02084E16E9353BFEDEB3F8A30422DE27CDEC4E65FF33C62EC
-77D4F535FCF6D0AF395ADDABE4104AAC6AEAFADA2F6EC6C0BDE25D2AC77B024C
-6377978004EC7E8F3CDFD4170E8D09AE76B8530038F4A8C91B4D6C87E7642B0D
-5EAD474C640AA652BC599AFD2770753960F5B99BCCFFC8DC49CFCDF8EF473023
-6664405C744B5F8575CDC27177478FE2A64F4F308971664F7AE7617A8E2AE311
-8DEEFA12FFDBC11F8FFD5A6FD2CD4BC0A4DD2FB8DE6A0B73A163CF1E31F62C41
-EA4262A77FE87FA34999BDAAD75BA2C6FDA7185546EFB1FD2597FBA5694FF7D0
-5E150741DA9E3FC1C8ACC79DFADA1561058240E037798E8FDE5F2D3334F2B17F
-14FF95E3E8DD747868FBDBF6E3A4BC4077CB45D71E183061B0F3866B779E5D3A
-6B903829C776114CF670247FCC89589B842BA2A5A74A1A1358F6F7CB0381529A
-CA76B6A36D6363F65E2088D04DAD9C4FDFDC99FE33D9328F1BD6CE2C9C5F3711
-6C9263B9E0E83F21817E100232681E1506561F358EE9B4F739C15B0DFF016BCD
-C9A88D36F967244C8CCFFB5D4F272F16A57BF56F19B947350C28983BE08B4912
-8EC28F93546831EEBC8A65160BB369EE0C56B1BBBFB9F8A9EBA76389549BEDD0
-32E4B1E2DA2635AD7D63B5BC5F445F07957D85B0EB9E157BBD66CCA4F0743B45
-087B68851A2BA50EF6A8974983F690685EB2BFCEF3AC590BFCC66167296C35AE
-DF975567D8B6A0F4633E4AFC9E91B8EFD406F83CF305AAF970FF54B5858D68A1
-813D70B86D7FC9134F448B74A118626AF9640AA94492259FC1EF62EABE93E54D
-4DD9DE2E1189B180A907CA5E7B8A50C764A5207E973B30BC276D1F344A147735
-500897FD4F8A9D8B10B6A8346D21F36D41F3AA36A129F1433E5ED9B3A8CDEC7B
-95C67D38479802C29E8720212A5B49136D3CBEE47102F7DB8A5F789522AC8FBB
-
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMBXTI10
-%!PS-AdobeFont-1.1: CMBXTI10 1.0
-%%CreationDate: 1991 Aug 18 17:46:30
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.0) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMBXTI10) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Bold) readonly def
-/ItalicAngle -14.04 def
-/isFixedPitch false def
-end readonly def
-/FontName /CMBXTI10 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-29 -250 1274 754}readonly def
-/UniqueID 5000771 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA0529731C99A784CCBE85B4993B2EEBDE
-3B12D472B7CF54651EF21185116A69AB1096ED4BAD2F646635E019B6417CC77B
-532F85D811C70D1429A19A5307EF63EB5C5E02C89FC6C20F6D9D89E7D91FE470
-B72BEFDA23F5DF76BE05AF4CE93137A219ED8A04A9D7D6FDF37E6B7FCDE0D90B
-986423E5960A5D9FBB4C956556E8DF90CBFAEC476FA36FD9A5C8175C9AF513FE
-D919C2DDD26BDC0D99398B9F4D004B836D34E88C20EEB527CE1124209388A2DF
-E27A8DF298A2693A9D529916AA0B2176E6ED237F69D84A8FEEB36861D1847207
-BE2BD61C6A412FFFEDFF13AFEC32AC7735BCCE5965F5966418A62ECB99112AB3
-3BC938EC590FF6922659125EB67E260BF02885E49BA6019E696D33F0B53606A2
-F515E0C45F323311613A94B838491BAB9FE230C5CC79D22925E3D882799F2707
-C32975A494F0F9513E4D8332E7E54470D9721FBD345CDBB48286F2F19CC6D66E
-BB631DD6476A509167A49CA525A72CA50E82C1D08C2B372DB54C5949C753B632
-2009B761EB90492ACD3CBE6A35CE1B66F3BC4D8DC36827CE4261A703328451D1
-879438479917C1647772999171DCCF1491A1C9086E0C6393506768F8757BD81D
-141C46EB9BF507EEC29962A0072B6C5D8C8588F3D68886CD2606DD3BD2FECCEF
-63245494E93EEA12AAFB06110E54ADC444C7E7619627A48A464394E5DE06EB46
-4C76A2FF010318BBE48B3776C826A265C66515717F7F2E943C60EBAB23D96B5B
-FD514A1C4E79BB3D3D2DEB936F90CD3FABF7B09FF7F564AB5CF4AF6A40E869FD
-395885A88F4A138B3CA6943A2D430BBE43D91F7F17621CAF52FB7161DA3B2003
-82244FB6EE792DCA1722C03392C296C029A2DCC5BAAB3EA03F8DEB039DC83AE1
-763AAB84776A2CCFFAE9EAF0BFDAE417E8BE682D237FFEDAF224AC09C9665019
-165CE32F5349E857177D94AD6396570932E1657ADE4D3FF57A3419946CCD210E
-57E5A1D91CF708395942527D127606350924D71BC21C6F969288B1C8CA3404ED
-E6219985F7301A20621368F74747EAD38990A4C9F2B62913B8FDB93657409FF5
-178DAA785D1D07ABA0CF10D5EAA01DEC75A8E2AB7078739AE6DB72059E81BB9F
-60B94477802ABA2170AB402D5068CB77D51AD70E99C0A06796C02E2F660C7210
-5E3BE6B1869BD21F449A067DE5B036A728EF55A2F8215593A04CBAE7E8F7C81A
-2ECCCC0FAEDCE2AD4BF7898C099E0A939C64ECEA03C699152B39C68BAD25DBAA
-AE48EF05B3D86667ED1C3734442A0F88085DDD6C1ADEAB6B0793BDC63BE6126E
-9E3EDB6AD3C831C74A3357E1CD9CF408881049E4C8984F4F43E40AADCCBEB69D
-97EFFC17ECD13FB6A3D35D003F874FCBB5B6ECE7FF5D82C8AFB0AA48E9C9FAD9
-77763EA6C4814406F2FD97EFB57510AD3B80F2111FB74CF7391C988DF02810AC
-340065D6CC89F97D30464371387361D6991F62AF874E81BA0D4FD9C4F2D631F3
-38BABD1359B1FB10242B169FF038482F253CB78F5CCA92E3A9F45310CFAD35F8
-79DE5987993078CC0A6441246116236C05DA0AEE454EB7E200A9FE825A21D096
-A0B329E092A1708248F9B9B602A9940B436107E24CCB97418A10A31B036BEE22
-8DA12B890840CA7F79C7B7E241EF4439F61EFA325A7611389AE1CEC499DDDEAF
-A7F81431E0FA8BE4BC2F40AC2711D926E00C75C0AE4F719954A9F60CB60EBAAD
-65163AC3FF882C977A260717B43AB0E31786474798F19472CF45CBD317BA9EDE
-4BA94EACD41AF7E0EDBA83864250B7BF28FF5A281A8D6A265D3F173048BA0383
-532E48F0A97E07B6D4654BF589E5156DA03C8EC6B39993EEED4F9E7C43B10E94
-3AF7D96037A08D0758759637ABDF06CED464F16021E17B16DC2D901DB27271EA
-DD9AF56FE559561CB46E3CE5DDCEA083205D5DB399529CAB033E38AA57E405DB
-9E236FF2539FE590E8D026B14108167876575E099125279536D1BA8362EB6DA1
-21311C1277B4E73BF031A741D36EEDADF4951600159B47DC6B274B68C62CE169
-3B61D2C4EFC44B48E398BF9FC468D70F37466B70E3604F035FDDA8D04F9C8863
-4B81B996E61C6C990EE66801C8820060E6202550CA231E23F044BBC2A20EB3E7
-118928FBDDBEE30BB397FE4F600F87CF1389DA868A1EC5D39AD90025EA5EDC0A
-E45F1EF4E7C3BDEC340436AC8030916B8AE853DBD6BD84A50739D3F9DD20AA70
-868E887827D3E238D013DD47D9DE9A7B39A7E985B8FA87612F327F7252878E8C
-2ECD29AFA5E5C57FCD5E63AA2536F3CF6DB829EB776C50C619AD0090A1B39E4B
-4BE3DD622B28C20C8EB482492BD38226718FA7B7BF945744FE1356C2EDCA3CDC
-EDA26048FA3648835AD714D18D71
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMR12
-%!PS-AdobeFont-1.1: CMR12 1.0
-%%CreationDate: 1991 Aug 20 16:38:05
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.0) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMR12) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Medium) readonly def
-/ItalicAngle 0 def
-/isFixedPitch false def
-end readonly def
-/FontName /CMR12 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-34 -251 988 750}readonly def
-/UniqueID 5000794 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA052A014267B7904EB3C0D3BD0B83D891
-016CA6CA4B712ADEB258FAAB9A130EE605E61F77FC1B738ABC7C51CD46EF8171
-9098D5FEE67660E69A7AB91B58F29A4D79E57022F783EB0FBBB6D4F4EC35014F
-D2DECBA99459A4C59DF0C6EBA150284454E707DC2100C15B76B4C19B84363758
-469A6C558785B226332152109871A9883487DD7710949204DDCF837E6A8708B8
-2BDBF16FBC7512FAA308A093FE5CF4E9D2405B169CD5365D6ECED5D768D66D6C
-68618B8C482B341F8CA38E9BB9BAFCFAAD9C2F3FD033B62690986ED43D9C9361
-3645B82392D5CAE11A7CB49D7E2E82DCD485CBA04C77322EB2E6A79D73DC194E
-59C120A2DABB9BF72E2CF256DD6EB54EECBA588101ABD933B57CE8A3A0D16B28
-51D7494F73096DF53BDC66BBF896B587DF9643317D5F610CD9088F9849126F23
-DDE030F7B277DD99055C8B119CAE9C99158AC4E150CDFC2C66ED92EBB4CC092A
-AA078CE16247A1335AD332DAA950D20395A7384C33FF72EAA31A5B89766E635F
-45C4C068AD7EE867398F0381B07CB94D29FF097D59FF9961D195A948E3D87C31
-821E9295A56D21875B41988F7A16A1587050C3C71B4E4355BB37F255D6B237CE
-96F25467F70FA19E0F85785FF49068949CCC79F2F8AE57D5F79BB9C5CF5EED5D
-9857B9967D9B96CDCF73D5D65FF75AFABB66734018BAE264597220C89FD17379
-26764A9302D078B4EB0E29178C878FD61007EEA2DDB119AE88C57ECFEF4B71E4
-140A34951DDC3568A84CC92371A789021A103A1A347050FDA6ECF7903F67D213
-1D0C7C474A9053866E9C88E65E6932BA87A73686EAB0019389F84D159809C498
-1E7A30ED942EB211B00DBFF5BCC720F4E276C3339B31B6EABBB078430E6A09BB
-377D3061A20B1EB98796B8607EECBC699445EAA866C38E02DF59F5EDD378303A
-0733B90E7835C0AAF32BA04F1566D8161EA89CD4D14DDB953F8B910BFC8A7F03
-5020F55EF8FC2640ADADA156F6CF8F2EB6610F7EE8874A26CBE7CD154469B9F4
-ED76886B3FB679FFDEB59BB6C55AF7087BA48B75EE2FB374B19BCC421A963E15
-FE05ECAAF9EECDF4B2715010A320102E6F8CCAA342FA11532671CCD991F6B9B6
-D3F6484333FC2FA96352A9D0212970BFA7C3546692557505A152618882518E4B
-E1500DD43F54F31204F2419907235575FEE2B9E7E49A2427D48C8330B4C08A23
-D34ABB2F4C28B59600E1CCAD217606B6B4760E2265F3987B5DCA69E5635A3C09
-7AB729ABA2100A75D47E36A3E9E03FEA5F0653C24F6E45496C14A86B344DBD2A
-3A310D9510B8DB2244594F5ADFE2133351778D79E548C04A16E224FD1614F1F1
-F047F15A3C02E03C718E8DBBD00D9B4A6F569D346634D9F1CBF6C86A1EA2FA8E
-8D9DBFF70C1A6E1F20FA33F990FF420734ED9CB4F2373A6B21BB79FD3976278D
-D319C2B1B869D6EA7D03592ADC090EEA46AD3F2FB9895FB5D91A655AEEE7B809
-E1E8552FB67BAEBADA61EF209C41179DDCCB9E14F54EB7A61C68E1E2870FFD8C
-04B27C336EB4ABD8E29B92263EBF7A0D90B34BC0386AA3D828703674FAA97D83
-9B49CAA29A4A63BF5C490C4FC890F221089985C26A5BD01445FE8E30C7676DC3
-8576FE008B841493A1C6754F64E2F1C17E958C88DF2A946D28C40DBEDE02F939
-8673D5559D6F4C52759596CF2AD58222554CB3A646DC37CDB3FA01DCE39C6F05
-B409B96B82683F906EC6CA306654EFDD951948291B05563E8B823B025F0BCB42
-E186B990259DC9097CDE73DF1081FE359FFA337BC0089F9E4BB51CB901744438
-04FCAA4E6B75BEA0347988835BDC9557016C9EDF62AD0AF81B2DDE6E96FE0F9A
-5F493404930437C98CA7B6E5AC9F4B9607DAEDF169C0C9F092DCBC516C0C8191
-0209C3876B69B61E1EA8562EECD2F8F33C128FF8817D2D87F900A9E30328B07C
-C26CBB8548E0F210F621312E8302746EE2631B4049CF8ADEDD938B1BB4C37546
-81B98B1F894E0C46280292067A66615D5CAB13B5D1F360680CEDE0D1B452A428
-8AAB2B1562623C9D2FF605F61AE07DD7C122EA5E6946374D27C32ED7B242E32D
-4332CE71DB0C71708149FDC2971A1C3B77403E0A027759D41DCCA3D99B25A9F1
-4CA0B81A128F9818E028FA719DBB8AC3DD7AD199D986F30F0F3A0E7B614C2C1E
-F53BB1E1EDC3C7A405B9123924E89208505CEAB0788B5F8D479AC0FAB9DA0B0D
-55703E8EF6A7572373913D64DFD8B083B9A0827B0BD14FBAF34E42BDB3D5FA99
-AEBFB4FF8B8EE02224737E4CD40569C4DB3E35B64CD671F7F9E830E155CAA0A2
-68FE0DB3069CEBA81E4A7A1841DC0A4FD96C92B059253120CBCF24266F3C442D
-C6CEFC7D4EDE76A4923198F3C6D54E6B8786C69B2CB12A4CA7528FD81043D053
-80BF4254424CFAA573AA0D1AB79E22C3AC5B1D3F5831E90439E55C57337F6B1C
-5B66D059BC12947F03FE9955DC38BD01ABFF85790F71F5ABE32870B0D81B87BE
-69840BF8119839CE085854B5AF2B3F92AE74C0ADC0EBD24CFC1AC6FD7734788E
-DBEB17AFD0AFD817659F5B7454A18EC8CCA8B761EDF22FA69F4B76C817608B06
-1629150A467142EC53DD7E7C9918DC7A51ECA22290B3B06344DE2DEF4C72EEDC
-05C7F29B1258DD18C54177EBD671B2D1034C84514EADEE051BB8EAA4A06D0EBD
-D4D4A7EA0A0F56B254EDCD5C736F23BCBFFBFDBAAEE079EA76A2010D46E0F6EF
-9EB5F2A481374AE885011AB72F99609557C144E666BF75C0CD55BA5157DD3FFA
-C68A20722852F1F4A2506B19C08EDB8FAD96374746FB8BD39A133C41534A3BF2
-52C68975821BC5A719EBB7B5A0B595DC409A3FF247B3B4ABED5F3C8C18385938
-5B18583A3FCBAA7C04741799A4764C87BDDC6A2071AE98203FFCC6BDFE03F28C
-99173292F3755DE5A4FE8EA53FCEC8E99F5962286016F4C39344D3491B12B8DE
-94AEC84AEEC44FD274C680C73C2B82E37A24443590E19B9C89FA3B042CF3AA9D
-B6618C2DEB9A340A68A6D4C9F457A082B0DED6CF4FDD2DCA0A1A845E82BB6318
-D036084C29DC98104F060363F55D12B4D22DD50D736B0AA2F8C4631787FEF388
-60F491D1E27DDB23DD2CB26A926DC66761D860BD97E4F649A09277450BCC0637
-461C33C46618A35B1DCDDE6686FCF3DADF6FEEDDCA41A38C8CC6BC35277505C3
-5A5E20E9A0D194647C295573E2A67F50400254B8FE01DB8D48A145D761815BE2
-3870D9B47B46A70CE3653892DB110510A986CDB53676D15C8FBB97F17C89F7A7
-5E3354FF8BB480647CA5B7FF8A478C40B7323446591654147E3CC82EFC92A164
-3478A587D10E2EFBB93C08A4CFE75BD86C7E902DACAAC0B6C535AC6F134A19ED
-4111F3C3D22A53EC9C5E1A9ED852CE100C19716C8E97530E4A8044664397FC4F
-3241879A06C8B7576AB010445584280D0F94ED930FBEA8784BD675C7AE58ADEB
-DD47166B69D4E0A58E7AFB614DBC0CCD430CFE90BCC0C4E753A0DC3DD4DC5D73
-05507F0B1FB4B61F74E6D77BBFF74FE192967CE65C87A5207238B38941C81FBD
-A60FE78B400A8B4F2E74371B5A4A0DC2A90938834617FDC34293760FBE172B1E
-61D1629D65AA9B4B3FEED37B089C221C3698D04D1BEF6D517920954159135C02
-D5A5310DDA47103062C0A986C375E95C70FAA5BD376A8E6E723ADB29F7582B07
-4B5C3D9C55E38A3530958F62C8C2FCBED0B3CA32E635D387994072393623447C
-768DB95318C943C7E43753980F0C839094B2E6968D16BA1DF5BA27C3736FF69A
-9BAE60B821DC09FD29D7F3FC84CDC688C8AF2807E83903BCE5E8B982B63C4D58
-F2FC243C2758AED4E717804FD6E52C1A96FAED8542F1E63A73FC303492906291
-05AD13495EFB787CC759E51ABD76716E06B403846D0D1C8C0B0EDB3E6E638AAD
-260F49B98A1AB12788C0D25ABB175D28FBD994A35F864F08FDCC476805E316D0
-A4F593FBB461AF38C9239B69954110352691DDB1C912D4227C734727DC8C78E3
-F5E24FDC28CFCC23EE3803354C5AAD2FA161FE9CEF5815B865A9046B06F98737
-256D34EC59FEC22C3F18553BDA515EE2DA7DC248F40C329B0A9C7C8597E9C24E
-F07A4DE00FAE0CA876FA9D1255C11D041B7634EE1B363CE54BD73E55B6A8E8A7
-AC379F420A8B1BF9EA968991B4E46E134383ED9F5396EA7AB90932A82A436EAE
-757F43B992B6BC6DA5B3D0126BE0E746B8FF16104751CADD782556384FD98269
-81D518A77FAB94AA3DF4385237B729BA4D4EED8B7505191D89B557F0CC681EE5
-37A5D182972BF05F30235367381492BE19BD53B4EAE76ED47E8DBD746BCEFDE5
-F87882AB30094F254129BA06C64F0E67A6BFA78404F54DC7C371BF4AD8E83A16
-6255026E5CB4778854364939CAB6952599E7219BB422E258D4074D3D68397FC5
-00C94A650081C6CF1D91F7CE9A3B10D82207577CD2B142943D8FBC19E4F1E0A5
-BEDAB90541E356CD8695CE08A4C0CAC97BE2664320EE4AE27143E8B86BA37D22
-F48B2CC14B0AEF1EE4DD2B9504A536E658CC70319A7C58AF5177987714A9F3D4
-27526B23725449EE533AA243AE8EE752118C799C14DF2AA31ED34A8E0FFEB286
-177401FF3882AE0C9279F632DF8087CEEDAC5A4A0355E7EB5935C821B7A3F07A
-454B834356D5324D5A8577A2789DF5AB2F098112A7C628CFA0163124E5CB4F7D
-783F56CE008759ABDFBDAA65E1972974B875FA64D1B3A51F96F027966EDE0892
-59A638A1337EF689A941ADE41CA961C81F82EF35C4EFAE92E2102965EA6CDCFB
-B9352F556945C4519E2694E6D2E065E1EBEC9180D9E7324668D451D507BDEA3D
-B0A25997C0664EC2A1233D0F0B4ABD3E3826B31B99A6CF3B99D8A17B428C09D3
-C7E00E47C6906A0A1C32E6AAD37EF765DC6E5C9800353BD35C8777478B5E94E6
-CEA55F19CEFEAE9CE72DD6C2F03F3EB5D9BC510E57F7DB39971DC4FC526B5294
-3DDDFFE22269BE96C8015A1225ED92B2BA9D2A963765E24FEA57788F012162A9
-12F4B32F1A0813B3EFC3EAF410548E2CFC734F72EFA62972F3A50676E392DE77
-AE295CA752C01CC6FB4F297B86C6925CA6C4834EA891649954057F5CFC20DBAC
-3330E66A54DD51C54A2F5829045C78B12E77A04BB0AA757DE7247EF031308A3B
-89923AAF0E39B5397FBBF07AB307818E19DFDFD98B4C7DD514CCC9D2D4A02567
-A61A0E3BE992621A6538119D5D1917907ABA411BBDC9E15667662A926B97BD04
-AB3628FB09AB5F8821BFD64FAF647C14143FF471DF66187884A1B6F2FDC07598
-BA75F609811C5233A00DB44420575804BA4DDAADCD4C530673D72195FC625E31
-60BB9967A3DFECB8FCF594E02849BD0D8305A35312E3AE8725877045A0A52438
-2353FED3AEB7FE3585DF9FFDEA45F6AF55A4119325612EDE3671F474F0A23304
-27622F47303ED208732F7A036A9BAB5C2E58608AF6868D3BA5E988FC071987A3
-22ABDE30B48F1B9F4B59DD44C3C746F3FE82C47CB656B2A411E4F64D0FD02B40
-232EA4870C87890EDA3768B390FF378F406E40A7EFF8CC027D0C75806B0576CA
-B809D354D4B800193482AEA49C742A319CBE4EDDC9B955F4BE17572E014289F6
-B37E0E0EC1F0D10594B3681E3691AA5B5E6D0BCCF305AB5004AB926D1E10ED18
-995C7D5CEEC0F51C9453F0826DE15758E89870D71DEF53F5FFDB080055D6386B
-017F85CA295FFF920F7DF982C34D6C6DEFC2A6AB344E9C8272A4B58B8F9EF364
-77ECBF8EBD88A8570B9FFF76F75E1F2A7D8CA5B4AA9AFC6240EBD08E06095431
-BA7610E2C23DC7942F80E7569AC8D66DD78E5238E61BFDEAEE84D3AC2D96FB06
-79016A4F8C13DC8E881BC6CD8F2807C17FE2211C726E22A30A11C1F379F0D012
-0FB0F63F948FDF4F2E7A640A35EDBF0F95D1B8BCDB8BF6292A00149BA48C410D
-295DD79E06C1470371A38974D264E60B689B12F33F5914DA775094A1E056D255
-9797B51FA48503694297DCCAF624AB08FF9C2379AB3514997173389DD3902C95
-D83B928CA322B98A223A9D7E1A68F6E2D512641D0CECFAA3449FF01F99866BA5
-BC0CF58B8DDF554E6818B58908C8014DED8C7673738C5F9DED9763C748234DE5
-48DDC8E5836B0A0E6F3DCFB4BF19BDF37EFEA6EF02A82CB3D5F3948EEBCC3C87
-72C4899808AA085E9E82C46F0988860FD08E6163DE03243862FDEED651A3DAEF
-4D057BA566110368887B7339AFBBC1794D42C0F05627F540715DF5E55B7CE637
-52112772E37F35480A1839B600096D342E27558DB296BDBA1E81D8DE6BB40A01
-65164571D3B04BCC3B3F127DFAC9D7717E5B236A1D66AEF39E0295F6BEDFF138
-CAE95B90C00F2B2519C88102FDD67CBA3F8D0F60D17A8433EF52D8C8FFCD37E2
-0B878DA9988DBE2FF5276938E5A40CD9BDD27D7E06BF89CEF3A33361A638DB7E
-E522B43988D5C887F91B7D4E7716920A536CC2A2E114BAAD53A3ABCAEE36CFEE
-690174BD078D25E6E3196B6BDE570CC0BB81521776F306745C7E3BC194690D22
-A60482CFC7B268DF063F8B9A8CD6B9D622799BF2488B0F0FCA2A1BD2DB9CEA29
-92D7A46BFAA2DCAF3D49A822AB8881E852E2D921D375609E7B455955930DABC6
-71C4E6BDBE4347279EFAEE48AD012BF0E245F8420C18A0BBB783EE5AEEF94268
-F69DC7F0B887B69D060AC34BE088C34B2339E4D6ECBA206A2E5513DA5AB84360
-34EC7A213F2C73477A17349C14480D7E5217EDC14BC4A19F90BA865A79E608F7
-609EC6DB6CCE91BC646C031572D02E822835BBC5BD1CF283CF77557FDF99C482
-4142024DA7E64355A36863B43937D4E3493B6058FE9E9CF35A84D90246EDF0EF
-C422144A4EA9C418828845540BEBA1AF2049F154254D9D2678238913250A788A
-6FB855A291D07BE8D05BA2775161AB2C2D6C177B874AAE398627B6F731E9B16B
-D9DC7ADF895A85AAA4D6C8AF88D5FAA8611E81944C079FA5271C7667FD2B7915
-F0957DBBB87D694DA97EDDE9182D31406E714E1746C2DDA7262528753F7ADEF5
-D1AFFDD0276A96B72ABF3B31F1B027DD2605CC29C9EAF39124FD85F0FEA861B5
-4DD12FCB704A26E9B6EE5FFA102CFCA31BA68CB8F5286DE8977BC2FCA464CCE2
-355DEE90D69056F69810074ED654AD1D164A1058A076A4117243167BC2048C27
-E0642BFB8937447B830C2BB893A9D8F0706D545CABC8EC7A3F93D405415BE785
-BD931A7BD94D763963768980421F25F7E26BCED9174E2B156EC63B1EB142774C
-14F51327AC59D7B64AB11016E209FEB5E10B08B7BBB722CA492C65FB1FAE786C
-3ACDE45D5517D6DE8D3448A8681FA94875C51B701F743249BD351736C1FD6166
-60D994EA893A2FCAFC49BE2D8276CA4ADC19EE134EA91126AB47F1C3D9BF3CCC
-AE9738CD23E7B73F98B73A5040E94F34841C114AC58FBF9E8BF6E0CF3185E664
-CFCF9075C4B76F255F215525696EFB65D9854235D2A332A54B0C04ED4703FD57
-77184D86686F52EB10AE3BE6FEC3466FBCC7D761C7720FA8551B2DCD3421FD00
-D9BEB0630C0F340D743C149447B3BDF3BC6AD8AAE58BADFB52EA60EBD37B40A6
-FB7B8C87A305E742F1EF14747EABD3BED3BF18A2DD5FE0EE1D9661E4B1FD5DA3
-F978B8A4E3E881A61F9ACC74678C04107015FCE889AC23E303551AB262A5D73B
-0194B4062C306B75B37F91899FB9D0D5EB6199273000E401042DAF4AFADF623F
-EB7D8076B47AC26208E4418E051EE6A690C3B25012D640BAA099D128034E3E76
-8C26AEFD341B2FAC6B6DECA62643E83FC9CBA2C36311F767838792E523010FD6
-0C50255EED8D45A0068A62E2CC91E3D9525340ADD3251C21F2391F0D292AF6CD
-5C829FA558F05A032F77B2EC4318AA6EFA7B9E4F6D119869F7F080224F00C5D0
-574CADBF82EA169DF9A03E3E6A3F4774E31E788881F3100ECDA8AADC83EE8F96
-299BE73717BD80D5957374B63D7CFED26CA144B8E94882BF9AD6B0EB14EFA96A
-EA84149EECEDF255017567E73BD999B2B2EC0E474B56B78147494220E52E5BE4
-93D5C931B2D8F82C15EFBE85EA88ED235D4E20CAD8987E87B4F6614971A5DD57
-D84EE627B166EC59D3D6DEB8C63450B3D423F316D99D2D11F95D47BD074A7447
-2CB663BDA770834F62D486226B65271D71116BE3C5F016278858E3C3B9FCFEE2
-A654B5C42CDC653231CE3F2D99C4DBF6056D2EEE46F2E3772B88C3EBAFD0A722
-0D447C9F2A801D6711C580B836A08217417683684D9B6AFDF16D97EC3B510041
-B4079092F393151CEE397F5AE90E1561F3C608DC3E7594074750356E4B968526
-3B4480D0684A7466F4B23972F424E256AD1F197FEE36BEA6594624A23753C4E4
-70A26091CBE9C386414E42E68EAD84975B9C3996DCE033BE38F0E277C502F6D8
-3E5C0CF4F242CD09F405281736AFBB24246D779423959A56AAB8F07DA2CF5F9B
-7E37BE81222F0BB9077F339BF4400DDAF92D48428E00783255488C8F703534F1
-A948F13D994E84AD4B4A676627A319A71CB974DA124912D15DB9EE85E44E7475
-75C1543FC8F7448AA46DFD49C639BCF2B047B30FA99C230AF1351BD2CD5E6BB6
-F4394503272E5FC9D109F07C8737285C51B8BB33B0337D03C565EDD84FEF1B4F
-87BC178FE9B8B886E46898E20602BCD952E062EEFF9DCABE57A6FB90601BE22D
-9873635DCD84A9841687FCE87B215F2853AEE5C89ADC684D3B7C0A504F06137B
-523300B7F87E3513257C6E
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMR17
-%!PS-AdobeFont-1.1: CMR17 1.0
-%%CreationDate: 1991 Aug 20 16:38:24
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.0) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMR17) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Medium) readonly def
-/ItalicAngle 0 def
-/isFixedPitch false def
-end readonly def
-/FontName /CMR17 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-33 -250 945 749}readonly def
-/UniqueID 5000795 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA052A014267B7904EB3C0D3BD0B83D891
-016CA6CA4B712ADEB258FAAB9A130EE605E61F77FC1B738ABC7C51CD46EF8171
-9098D5FEE67660E69A7AB91B58F29A4D79E57022F783EB0FBBB6D4F4EC35014F
-D2DECBA99459A4C59DF0C6EBA150284454E707DC2100C15B76B4C19B84363758
-469A6C558785B226332152109871A9883487DD7710949204DDCF837E6A8708B8
-2BDBF16FBC7512FAA308A093FE5F075EA0A10A15B0ED05D5039DA41B32B16E95
-A3CE9725A429B35BAD796912FC328E3A28F96FCADA20A598E247755E7E7FF801
-BDB00E9B9B086BDBE6EDCF841A3EAFC6F5284FED3C634085BA4EE0FC6A026E96
-96D55575481B007BF93CA452EE3F71D83FAAB3D9DEDD2A8F96C5840EAE5BE5DC
-9322E81DFF5E250DEB386E12A49FC9FBF9B4C25C3283F3CEA74B8278A1B09DA7
-E9AE4FBAAF23EDF5A3E07D39385D521547C3AAAB8EB70549756EBA8EF445AF4A
-497CA924ACCC3DD5456F8E2C7E36946A5BF14E2E959895F7C94F49137256BE46
-4A238684D52792234869EAE1A6D8ADF4E138B79472D2A90A6CA99E2394CC20CD
-3841733046175B20CEBE372327BF13428EED6A3E2FDF84C2DBA4B0AD584EE9DF
-B51828D3B8F385846158C29C9AC3496CB9692DD10219697B2ED4D425C3957FD8
-C4600D76E045C561216EF05D38177243C314877A69A1C22E3BEC611A2EE5A216
-9B7C264CF6D1839DBBD78A40610F2C0D7C2FE09FFA9822FF55035AD52546970F
-83EED2D30EABB1F303091EBC11A5379B12BB3F405E371519A53EA9D66174ED25
-A2E55463EC71A97BE4C04B39E68112956117C8252DB6FB14AB64534B4BCD568B
-246DB833982B38CDE7268BBF74B6B0C18091E1B1F87D32D66F4DD023D1F10D2A
-7736A960F72AC01F733A11023832CD68FB6288A5977743F6F3F23E0C1657CF5D
-E8374835BDBD2DED3690C84A1EBB8E2383A5E49E610B6F5F0F5F5EC43CFD16FF
-24FEEFB92425CCB577E17FDE4EA6C50E1448DC5726A21888E25B6D6B52DA3D3C
-E4C4C6A73C176DFEB60B6B6191B336AC4F5BAA123E1B3B6FAE4B3FA9DC8F7E39
-335277EF2294315BE95F64EBDB1F393B293FD0FDB9DEE6C89082232013130D28
-9234FF12DF47D454558A1EE8603B2832772E5CA07D18B34A4763D5B890F7173F
-B8FD35055DA892F1421B41A253363DAF6A8CA629D7418A5F24472C93DE80FEB8
-D265AE6D1C4D9A0C793E179E0DF43615F51F43BE3C995CF86CA6D51453E19EFA
-90947D9BEC02D8F1F07EC746890AFB0DB83F95709CBB957844D61BF49D80436E
-CA48730FB82EAA840F71ED5DCC27299921B6C16297230CBE452C966FC7B465D2
-D778616A2579ED8CA19600061C7C39A844FF2AA4FDA48F9563DA4CB4EE36C062
-579F8C81CFE8D6A897B6B0AC6AB68415A74F858119855B6DC559924017D62D41
-1ED8B0ED3D0E888AB6A3EC599377F1E56E2ED468E10F046601FDBF4FED0B09DB
-10DCF85ABF1F06D3AE67B7B8C55B6BB151C3A3760B4BF76B8D183CD32B9CC916
-472AED90B888FA78C0326D618ED4A900B0759352189ACBF311D5DE01E11570C0
-1014FA1D30FB24143DA316628DED1AA13E38FB77FD5FB78655A7281C07AB7304
-67172C82D3E79E585934B8FFFD04A8B754D21D72137A6DD203C2D438DF9FD760
-E8326A889395821E63BFD2649D1E6658210FAEE1D2643FCAAD2229185B0E5778
-0F942A657B03ECAB26E6CD4CB64A23F4B3985018C5E0472C97F8AE89372D6D6A
-799742A1CF5721D8AF1F2AE2D0FC39F29B8D8A04D51D02E47D011EE90C7C0E2A
-53489B7D760F21DD60858060513F75D004D4DA6F7D0BB78CCC8EF298786874B4
-A2A7C6616AFDEAA1BB2046EDEA6C06D4AF7744F5991C6C2D9075EA776119F742
-35059DF78FC559B141F9581B1B99020743944605C330A07AAE6CD61129BDD10E
-1E08D2CF0D5659409362B8ED1A4F4B99DB5FB231670033E8553A248DD109064C
-14969D69E89EFEE0EBB1C3B53DA521C2C9253383C12F40B7E8A98D58B7B634B9
-9C47ED2285BE5716252164937ACD39A8B8E836FA55C6AB942CFE0574BA76B46D
-F9FFFC8ACA91A7BA13634A26EF7C9AFC7AF9B845EB5464DD04B95E7607A2B9D5
-640A759BAEDFFF92ECD900B00DCAE4D56F1F3AF2F72FF88B7839B3187CECB669
-8EA626838DEC3860EADBAAB5E68C99E9E784409BDA8259D38CFB227C8723A85E
-C29B6B578D6CD6DDDB06C79B260EEF38CE7F8B4891037E914D68F6970056A083
-151F4D14C9AB29069FBE8DB496FA1629399FE778F48F9A6734C90AA106A8911C
-01009F26F799BDE2FA3FC42FB98B07E6143AB49782D161E2F932657487771976
-CD63733222A4429C8EB1B75C26CBE3B7428CF4E1E85531D36C69F750A11B3C58
-0B0F6FB1930D49A6BEF83BE815198DAD424606B62E61317122F4E6966A23C64E
-0F8A3E638324883B6F2936C05F1AED20FF1548AB2BD80963FE1AC088F09F3DAB
-CFA8173C37DD82E6B8A9BB5D2CFD225EA3BEF584B245A45FD30ABADABB9E8119
-1D3F43D155761EFC4858D30DC066A5065266AF4468155EA9CFCC8E7A4D9791FC
-811815A955394FA3D3C80C3D6AF628A379D970983EEE01B15231767F12B6E462
-CA7DD5BBE72AA0C61DADA5057FF54C17871770BA3C5D8D1D1FBB345D12B4BF33
-43973F18F8E5595D1A4624DC208682C70478C952F6DF4796BB33C2681A7A9191
-89805387753569B1DEA1953E8069C9A1D30F0405D3D8626EE369E61C6D7EF5CF
-FE31C4001034226DE6072B424EE87F104BD7CD6774B1F92DA7A7738BD250290C
-E8F238691E0DC9D0D040B744DA22D35F2224C682F9566ADAA200995E63AB3B30
-BAA119B92EEAF05B65A49BAC65816B83E58A375E113430B783CF41C7603B9E03
-856730E3C0AD420E68BC68E3D8413B30D58EC378F34D76CA11AC00A621C9206B
-3D72ADA80F445121C0F57F460254EB6BEA290DD5DCCCB3A1A3D806404C7E4684
-9ED8E2A5A0979161E0A34F2BFAEE6E1F56CE138286EDA7F3832B419F4D46E56E
-849CE0134C4153D32DB9E8DA19EBCD7641244DE90BC54E4BA1F26F2659E10654
-DF6499B67164084D04C7AC61C08E56FB32A738D5A8AE37E33748D52130B9C051
-68521D1F7E3B429B669643041BAE84165B626F3D23FE80AFE3C1C319CF69B110
-B7B8A0101AC39A8060161BEA05B1F9209EFFBA8EE50F6AFE55F9F982B97A0205
-3A528A7B6735FEF7E5EA2DADA54DCBCD02E4DD4B7257DB2E30A9F1BFB174BB71
-E4A0CF1E32D373C028488E1FD8E6A1354EC9E2D27ECB44BA3B79893EC357367D
-3F79586BB591EDBE4E3DFB7CCDCC17303277EBE533F81A08D95F0D8E0364AC94
-7D679A257594436D79396D2F0BABA2863075C629274BA962ED0413B3CE58422C
-A4CFF46B6318116AC1191C63D861130EC1E774BD373D8348563D452AE0186BE8
-851FA4C772127C83629B59705CD4AF9311066BFA64BC3E1DFC7A178C4AD1D3D6
-E30F9920605E0A4382D085F839DE09CFD856B1BD9654FCC0716EFBA10F135A80
-9DC1FC7102C57BBD96F5319B21171A068F68FB043B6565F92A17A72768D8EF73
-1B98A87D4F247E3CACEDD25D8DFB1C2E318B758CAF0D567F74D629D392475010
-DAE02422D85EEC8862E3169B9483E4E567E26A0903E357C8BB19DC1CF0B676D7
-6E70E7E0B86204690F8C5565AC704692776AD5776C77BF3063D9AB9ABA12D778
-717F32C9A1B05205AA650BC8BB076A18424791E8D73E86DB3E932E63D6578C98
-6C9B5F505563E829E9304A7987C419EAEAA8A05F65EC14102AD63B9C8820F777
-A0CD4539EA0595DC66017E13AC2CF77E074518D7277ACE3F5FEE1A1AF1DE4773
-EC2D12B184C529CF05A84D12F69723F6925AECB8E71B893981C957CA86F3FA7F
-107C93B2A29E7E9BBB757E79BDDE1B1E14BA1277F6E5501C981701D0C6A0CAC5
-0F7F5115AEA55B26DAE3ADB632A04933EABF98D50685A5CE0474912D73B37F92
-94B3BEA72BABEF72605A3134B42EF73C732D7735A9C3429D2835085BF0391B07
-063A8346A999C542B5BD16FAAC9C78903E6108517D1668967F0CDE9182EAF7AD
-67076CB13CCCD666B513797FF7B69C1B158AF07763F235911B766953025A6CA9
-9224C1E2328F0D3BA75D167D819094ED21956EFC7A3A4D89ECA70D9B23F5B7EE
-5A0F43328D033DDC80C3B1471D7C4F7E1E2136298F61CFDA7E369513F70A5C3D
-F9F2CD7E2386DD4ED63A31F3F7E89D5F0EB9CBAC1D01CEB6E99409B5A61863FE
-86A7869F73A8C9FCF38AFA090193B862E22EC4C95F13723B69097FAC2A2C601E
-F92B2F6E280DC30071EC0A40D9332E574834F311ECE6438279C8038E1B3AEC9E
-E2AA6D6B4A8178B94301797DA673A9EB56DCEF30BBFBEAE388810AFD5A683AFC
-97DE1D2A272C035A306F45C5896F83215A860CC6B85E7F56C1E1DE9017EAF837
-B0F4B2BA28023A3C9A3972A005735278AADBB3D3407C247B36E5953F6354C2E4
-2E898319488FC8FD9F3C3C803B86B323E9581F6849F1E89899006430E4EFA845
-4D2228B8F4298A3A839AB2BA87BD6A19140043603C6D9FC853C945ABB50257C3
-374692908AAD8D3038F1D3AD92F73F65F821A2860D28A583BCBF3A1DA7002D64
-569AD206D4668D511F9258AADD542B918E601C856BEE1C2A3C8A9243BE79A254
-B803B32BAB7CA843A58CB3AC45FE5AD6486A16E1B93BA72691BDC8A9403349D6
-DAB725C5D2BC6667385D5D911F68CEF3709159D13D9EBB033B75DBD276DABCE2
-E38D9C8F7C21579FBB5641A2CD13EA270407180D7C521558F9661828E5257954
-9AF96036916229AE97E64FBCEA2F7970B3A2EFA974A6E1B6F70A63C9A87D06DD
-B8FA54DAFB3982C21F0FFEB66CBB1F6CA625AB655F093C8E547B9F38B10733C0
-09B3740F4D35B1D9A8B3960670709D165CC96E2CBEE6D178ED30A85AB54AA123
-74B86C4CDBDAC1880F5EF1502CD883E5D1A1AD911A0BFD2B9B76A0086A58F071
-E62136784234FED9069AF0E761A8FA57607C218F901A0B3625F844B6CBF3CE94
-97985A9B0F1408E9036BFD3E6475CF66E3ACF415711177F1D09E1581077C48F8
-09EE84587077B1016491DD6D0B5AABE6B7932ADF8EFE816089F5F2563F8A1CD8
-6F5642F959A7632102FC9DA1F3565A71FCF0A6AAC5AA13EECF159F0FEA3B1667
-7C27A89FFD84A2BAACBA48722539CC71EBC6F216932EB58805CA450CFC4DA996
-198738CDF88188F15BCCE2F61673620615E42E31E29886FE160BF10D7D5CFB36
-5EF8D205C9202195EAF699E00047A1317FE973F6F60687589FB0B16E92628B9C
-561763BCE3F687E36A01813CAC93F2DC55D35A8972E2D16CCB871800F526E4C5
-3C8FC02E0D41220FB6C1DEBFCB58B356135410BAEBC034C366DCAA4850F5C106
-788CBFF29527FE9D82B581A88297B539AA8655BAFBD87A026A8469B3F7BA114E
-111C3F8945F243DFB0D08D4EE3716A05B5A695FF9DA26619F232E795DB891043
-56C37043531CC0944F917EE8E6BCF4008A9BEE3DBE7BA8C8581C321EF4159971
-F8478C1605A76725CAA2D6D04BD6C3985A4185B5019C926D9B0397DF6F02083A
-6485D33C9CB4A87496A188FFA8375578DC931E99B1002A646F0888CCEBBD7D97
-8E7335A778BC43F8923E842A37A0D8A3AA71ECBF76DFA7205E8377ACB00A6703
-06E274BE699C1DEB31E9D01F167132FD4636A1E773A32AB58F22F0DC4B323DC3
-03B0C139B8FF9A49751A6076DC721E0041D211B50F64DF6C514FFEA55050FEC6
-0E38603ECF3D4196E1ECE7B318609ABB04658A4BF8CC1A422BA1EB0D1CEC8326
-F16864B59486FCEAC6915564E6142C733B3F768E864D3248D2BD4794511E92D0
-3B0686A9B37039503469C694E506B8FCE3A33F4B472797FDBF01342D694493AF
-F5141E506363205F37981C205092E9C9D73D6D0E79AF6FF78FCE01103330AC33
-AD6CDA0A3C4DF7CEAE7933CE9B8CC665A17DE8D31C79AB2D5F896A122247F6D5
-61989D8F1825A629AA2B33826A53FD24FFBEF235CB4D6635317253BD363D089A
-2E28A56F16285A7A760C89EE8C010A234E9245907412C4696D644768D412C253
-AA36C2F01325D8991818B886F3487D69913ADC6D47A815A5FC85CB5163F3B8B9
-8E7FF88D483CB1B60FCA132B42AED1A22639F0901A6E5A920A6879F800F2A49B
-60EFBB6C6184FA3A462BABE2742EC701B687F0A143650F7D51D6B3B8DBA57B09
-FA1E5AE4FE57BCAFDE11A5A984D4E5478C04891EB0AD8BD49BCF4382F77FAAD3
-6989C81A54158885ACD6E1542DC7462E7F680A824F81F5437D2164FDC55B4DA7
-B887DA5B74ADF3B99885E0C1AD50FC0DA1B80253C7B8773D7298916BE9FF8C96
-2116A08241EFC9DE7887B66EA3074CC1E1235845FA8B6DF5A95D0FFBC0B59BC7
-D5BC76DC75A99D21C2903528731B27830E720EE5D901864D061954E6247B8F99
-2E8F28D9CF79ADF6BD9CCC25006988755A781EDB1E4FB6D8C864C6D4FEDB5EAE
-F50931EC0F3EF6F3ECDEF9019A06FD8C9A1F9BBF2D83689343844C888FC97764
-E78FD317CA4BD0293695BF4652C688B6327E3986D1AB8D4DBAC8F091EC4723E4
-C2484D0EDAF51907FC7F52EF7FFC3498C36F3385675A36FB4A8EBC25AFA2CA01
-E0111C1AD1F2B694DBBA3B6A73C149178C39B08EC700FDC2318EBE2191B56442
-798D4E2F86BFEEFC0039F4A311C54106659AC5292FAE89B1CDC058F85FD0B6C9
-6F3DA1C43174732BDCD6943A2F843A6D556615DA259E272EC3187397B1247AF5
-E291E2F9A6FA3E18C73FB4E547750A5C71BCB0EB2B79AF1782AE74B341E3AF19
-D5D5FF2F43DE7445F5D4BEB0CF32C5C5EF219EDE458B8FB1756082A5D23B0B4A
-BA39C590FB55EB1299DE37D24946DC7CE94F6713C170CA7BC6A2CCDAD94FA6FB
-5A7FD38ED092395A93A895340B67D340A1B8A74FDF7E4E86A43EA972F0848D0A
-7258D30F3E3CF5D145021D99BF1CF69070DAAE9B38E554C31536E4653003A3E8
-47E8F64343E2E14A353138A8208A726FFDABFC06447AE2C8C065291B475D0C59
-DA002D7599D811616712757D15AE5F74C74A553C1FC968A2E97E638C09C9F426
-9BDFAE3796B7EA134D2B724AB2E34B48AF3FD4416A984BEF17C5B84BFC146B8D
-088FB822414D3E09AE311F2A5B829682D1234A7EBE32610CEB275E318EEB2566
-43D4659D42A7A9F5613D0845F9DE20C86A619A5974BC2A18C85409EE49E46A41
-4A8F437A67753C300F528901259057D226325A6469C07180D698DBADACEAB2DE
-601CCCEB40A0C6A9B5B8C480AF615B452E951D7FD4FF9BAA40DD1670821AE675
-B328427E80E8C8E714A1D9101046B0ECB1EF099060236BC2B927CABD46ABE707
-D2D5FFBDD1B5D80C2F77F4FABC29DF2756779AC475B08A91CE6683209F9F938A
-
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-%%BeginFont: CMTI12
-%!PS-AdobeFont-1.1: CMTI12 1.0
-%%CreationDate: 1991 Aug 18 21:06:53
-% Copyright (C) 1997 American Mathematical Society. All Rights Reserved.
-11 dict begin
-/FontInfo 7 dict dup begin
-/version (1.0) readonly def
-/Notice (Copyright (C) 1997 American Mathematical Society. All Rights Reserved) readonly def
-/FullName (CMTI12) readonly def
-/FamilyName (Computer Modern) readonly def
-/Weight (Medium) readonly def
-/ItalicAngle -14.04 def
-/isFixedPitch false def
-end readonly def
-/FontName /CMTI12 def
-/PaintType 0 def
-/FontType 1 def
-/FontMatrix [0.001 0 0 0.001 0 0] readonly def
-/Encoding 256 array
-0 1 255 {1 index exch /.notdef put} for
-dup 0 /.notdef put
-readonly def
-/FontBBox{-36 -251 1103 750}readonly def
-/UniqueID 5000829 def
-currentdict end
-currentfile eexec
-D9D66F633B846A97B686A97E45A3D0AA0529731C99A784CCBE85B4993B2EEBDE
-3B12D472B7CF54651EF21185116A69AB1096ED4BAD2F646635E019B6417CC77B
-532F85D811C70D1429A19A5307EF63EB5C5E02C89FC6C20F6D9D89E7D91FE470
-B72BEFDA23F5DF76BE05AF4CE93137A219ED8A04A9D7D6FDF37E6B7FCDE0D90B
-986423E5960A5D9FBB4C956556E8DF90CBFAEC476FA36FD9A5C8175C9AF513FE
-D919C2DDD26BDC0D99398B9F4D03D6A8F05B47AF95EF28A9C561DBDC98C47CF5
-525003F3DBE5BF07B2E83E66B7F97DDD7CE0EEB75A78BD9227BF359D002B6ADB
-8AC57A33FED4EF021A7085B1E2B933DE602F0FF71467ECD501744AE338AF29A0
-26F7D368AC6F25CCB882DB7B7343566192BD687E1349225982823027D3B66703
-3B0DB7A7E680A682B98023D39C7FAE81A5D5B867A0A66C8AA0DBC83B1596A84F
-0436AC6A7900B767BDCCE0060A4811003C79FDCC71D73F7F2D0A6675E93AD21A
-56B4CD8EF75EED3DE8C0A18BEBF7B9D1BE72504872D56EDB272F1E97FC726CB6
-68C85C713059DA19F6C2E0F3E12710A59B6FC4699AE883DE8C8615B7292AC25C
-D5714B6CFB14EF0EF11EB13009BEBA4F345A5D3D6D9926ABC2BAD7DB1328651E
-437BFB3C46DA7B62219660FC368CF3D3704DAD3AB461C28F711665BF484BF61C
-052093D231CA65618EA463D63E406ECE858D180A6C0589B2FEDC321371C28E77
-DE974D655DF5FF7D41ED01FE717D928A885F6FA6CFE4D2C0807F8E7F937916E0
-96EDD1A3BA67802B1F4A49100E75613BA0356D9DCBBAD4DAB3C59E70A47058F5
-2163D1730F0EE4D1F87C3A4AE723A23CFD7986FC4FBD399347E9F5946354E013
-D860FC446AFF0B0744F5DA27CC777C96ADB388D1E835DDCBE123FB517679B9B7
-EE5A3DDDCD392415AF58CE22EA55B7F47031138C6F27798B40F7E18FDD315912
-BE99F33ADE0FDD538A8A3E5DE58AF68A54732AE69F188F3F7E0458D848205648
-CBE820C287ADC2394520F03BBB97DB893F6A12154B1B7F8626D35CE6B70F8524
-CB128DE87821A0E32F1E825F6C50AE8B4BE37FAA3183BA4D678E896CC7E61CC9
-D0226FC38B9CAE0939D19149D987979B96A86EB69A105807AB426639292FF5FB
-EFF0817FCFD5E512819929280E672C29204632974124DE52409264C8D3C85548
-60D4436A0AB8B3963BC3586F11A74E7419EEEC2D70F37C0139225A21E8ACC1B6
-A2254B8DF63A245F2C8D203A2B4034D6C0495B1CDD11021DB9067033FD8479E5
-097CE08EDFFFD99149359D40735AA5E370D09E8817B7D86D2E30AACBE734B9E5
-5BA5288637323D936C4DDAED48016D407DE5507BA7CAB09B703CE0448F8E0E86
-3A2AF9C78C5D2A3C7CF75199CA01AC9D7E1A137902F5C0726DF19BDC45F646B8
-E417AB49512F98F6211EFB7B94C326569DFBA996E2B46D1870059DC33B919FAD
-C382DDFD8E63320511D93980F23CD158A4DA4A861426BDEB19A31DB7F00C8ABA
-877B41981152C38E119A056D5DAD931D1610749CA5580FADE2E6B62B7D836C1D
-78ACEF7CE51B441A5F03B6DCE0E50FC05B47FC8741C1CA916FC3E061B21D968A
-0D12B83DE627B8A2E61E1657C5B720DFF88A537E6A42D862A27BB651C3721D35
-117B02FD89E971B4EB156D244FC31DC2ED629F8A3BFA884D4452ACB5B3F3103E
-7EADE6DD1671E6CF573AF2758F4A4DF03EFF9021B61C3149FF3EF44875EA6403
-B313CCD9239DB9AEDFF50F2105B9869A4159F6B2582E74C1BF95CACA2C4943FE
-9566571CFEC92E21D70114A73DD6B3855E41DB683B1C4EC53EB944DA9B518FB6
-0A0B55C672AA7EE3BAC1BC4A328FA23078949A94B1D377E4F6B03744034E5097
-A51E5D8326E344EE36169548AD091918273DC035A9EFA2AA298F16FC7EEC66CB
-8AE934E74D9A559F66B3AEA4F7D5A1F875C46172FF3BAC59BDA2B0BFC4F8414A
-05F6C13F5B0119498532E1B9860B81B5AA87039CD5685E020C1F0DFB7B60924F
-F40C525373D8E1C3411C26DDEBD42A6E538F0D3EA7B6D2AB75742BDDFB77E83B
-1D600C270B1498B50A7CC12ACBF6FF116E2C490B9183C67C4CB614760BDBE228
-F890E4FB9948261AD5BC97380DE2477304922A8252C1AB3E8ACACA8DFD8119C5
-CB671BAB6CB95C13E963F7DC5F1E64D33244CE6BF92FCC7EAFB0D6F8FC264688
-BDE3F539204B41A8E234D7EAA884D1CEA4D9E0EF43CBCCB48323053D060DC2BB
-4BADE13B1BD5BFCFD40CC5419D02DF0C67A702B6B14FDA0E7F97BE5414AE4058
-7EB4859EB2AAC275B1E6413738B525931EF948D3866432A6442D0F6603EDF3B2
-E8E171EF4A4A4A19329747A04AD92037EAB7587DF039936E4EA9065F5F78DCEF
-1F970AB651FC86630821C8511546B70CE1835EF5E0B2203413C0FA7D7E773201
-5ACDF8317223A84F4D416ADFDCFF97883F241EE5B319665748ABCFFB4B59EEFA
-0E3B919F7959FA86B287A34A1B186D84319221E220DDD4E725A6912621D31A64
-009CC51BD707865BBC25E9DF7865086FE501E957F3F56C2718B6FEF8CEF452DC
-5DE515DD186E508D18408073C714FE575989EEF88264A5C87CF22140648E1239
-0B8CF9EDEB6D4AEB98EFA2D1E0B589BB6149B752EBC8533F9B10C202C74511FC
-7191CA9C3ED358A0113EC0B6527A6E5C65B20DAADE204A38DCDE2C89DE3A6393
-45CD3E1912D8768339D95CF669E16B1993D2D89336B1F4E46EABE5F4E28B3122
-76D1891E1CBD825E3ED1DB1E773B2C2A9DCFEE49DB6FF56133A4536A570046DF
-50F3570C95499DA101ECF31A3478B30C726D1666638FB8CD7BA68B5452EE093D
-1EAD3B82FF47FF954147DE22DD0F52B42D5185DC1F43B26AAB573D538523B06A
-EC0C3393D67A45407F5ACE1C9E1A6F4A36529F60166CCAA4B2745B1AFC81F310
-D08E55DB942791AC737B8C642526DC7F0A81F99AB46C1D211F642CA7130C339B
-639E52CCBF1F495ED7D2BC217E5F0E55C4484AE458FAB9C28E99128C22CACD71
-77F3A6A68A9EF36E2852307F3504B13E59364EE085A893009B50AFF9DE53891A
-9D4E3348B468F9D8F83B078AE8D6CC7C3ECB87B253205C514CF9B1294B31E53D
-4360F50B19428677CF0297B18FD349BFBD8CB7297B81290A33E40E2F711C3981
-A346FE1358E2328817641EDE7B0DD9DC27E4BD5E0D2FC7C0EE7399357857ABBA
-67B80A10320631AC2247842FAC6209C28A3406899497359534EA20C468D3C51E
-10594440CC51AD3091F09D7CCD15E61CD0CB8281DDD3E7FA9FB9DDCA9EC89CCB
-136B5488DED4F93285BD6B74D837BE87CAFCC7D573D215D80A4E8C12E1FA45D1
-FE8014169DB78CD4CFF1DFDBDFB36BA2BE55E17E7E25559884BF9FAB6FD5B0E1
-FC8193AA94E70EA53859F539260E3A3E072C7E235FFBBC218457208CFE8EAC3A
-BAB84A96AFDE9B51EC723BC57743290FF62C4891BE6EACFCF8A5F3FF0E660F36
-D0E7DC4D1D6AD8B48778A6F7C5D257BAE12678E6374C7EF3741A7376A25B15E4
-C9BCC724D22C3829E1C2A2EACE5384C382C23585787E3D0ED4AC029B7932D879
-BEAB8E4838D3B28770019DAEB95FCC990118095CCDA7506FF31734A0124BF03B
-A73637A67507ABD476098471BB409C5F56980E2A0B6CBB2E57FC23E774AE9DEC
-02023016FF0E86E6912083AB4C4C9A0B5CBB92FCD7DDD663DF7FF4138F697D4E
-9376E5FFC806BCB265CE2E80AF8F941A4105F0552B563723C8123B5230A037AA
-8E8569BF10E769B1B24D60011911707ECADEAE65EBD42597D2CAA524B6FBFDFD
-23A8BBF0FF676496262E2C96C726E0C8835448A6F48AE42E25DD3420E671D550
-BF39E571B0D1AFBBB43CE7D0D5B8B7C3A9EEE846218E487924356B642FC2A71C
-6B403136E738CF9A763EE3233729C9AE3127EA73D13CF92A3B82461BA6F3E220
-DA733CAE69361EE3E400C2AF32876504C3651EDC6E11AFB8ED665A6E025B5138
-B165727F3292DB7247122BFBA14F99FD98493268223DC9BA560793EA134A727D
-C6E1E402F5FA58725873AF6BD9F94CBC5C36D7398F030267C12A4105F76491B6
-E3EEF7DACBAD36D027BF8BE38B5840CCA6C92817CAA070DB3611D3B618A7F35A
-E645938DE75A3CA5CD85A91D83C1D5F9AC6A425E4997FD71E8C39A536B025DA4
-7B1E21DEFE08AEC2A01E1101418C5554D94D40AA96780F9E24400657E032328E
-FDC4D603AA6EB76EA44AFF18E50B02C7A4DC50535AEEEE62FF9C8ACF872A6868
-F6EA9E0833166DB521FD08A173E9D1BABF0B3B6D3C3BEC9AA5F018BB9169D4C4
-B1EEF1DA37F8603EB5D9D0F67633582D3ADF56896F14D034D3EC941E46282457
-31D45DB30E5149562DD4E53BF08DB10F521A0F9092317C68658967245A092D51
-4B7C27092ACCA2E5DEA381E725C9568D6213F3DA191FBFE29805FDCE33B43EFC
-CF5A9D7ACCFAAC57D7C35F518C290A57939F2A613B3EC7D1D41BC0C6B1A3E4EF
-8A9023D0349564624FD5D19BEC671D47B83EED16927CD9EEDD6A712A7EDFA4E8
-53252A494055E541B480340E88
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%%EndFont
-TeXDict begin 39158280 55380996 1000 600 600 (Manual.dvi)
- at start /Fa 131[39 2[39 4[39 39 39 39 39 39 39 39 39 2[39
-39 39 1[39 39 39 39 39 12[39 39 2[39 3[39 2[39 1[39 39
-39 39 39 39 39 2[39 1[39 1[39 39 39 39 39 39 39 39 39
-1[39 39 39 39 1[39 39 39 39 40[{ TeX09fbbfacEncoding ReEncodeFont }50
-74.7198 /CMTT9 rf /Fb 138[48 1[48 48 1[48 48 48 48 3[48
-3[48 48 48 48 52[48 45[{ TeXb6a4d7c7Encoding ReEncodeFont }13
-90.9091 /CMITT10 rf /Fc 133[44 44 44 44 44 44 44 44 44
-44 44 44 44 44 44 2[44 44 44 44 44 44 44 44 44 7[44 1[44
-44 44 44 44 44 1[44 44 44 44 44 44 1[44 44 44 44 44 44
-44 44 44 2[44 44 44 1[44 44 44 44 44 44 44 44 44 44 44
-44 44 44 44 44 44 44 44 1[44 44 1[44 35[{
- TeX09fbbfacEncoding ReEncodeFont }71 83.022 /CMTT10
-rf /Fd 133[48 48 48 48 48 48 48 48 48 48 48 48 48 48
-48 2[48 48 48 48 48 48 48 48 48 3[48 1[48 5[48 48 48
-48 48 48 48 48 4[48 1[48 48 48 48 48 48 48 2[48 48 48
-1[48 1[48 48 48 2[48 48 48 48 1[48 48 1[48 48 48 48 48
-3[48 35[{ TeX09fbbfacEncoding ReEncodeFont }61 90.9091
-/CMTT10 rf /Fe 195[71 60[{ TeXaae443f0Encoding ReEncodeFont }1
-90.9091 /CMMI10 rf /Ff 132[52 33[79 1[108 1[80 73 58
-78 1[71 79 82 99 63 2[40 1[82 66 69 80 76 74 79 11[52
-2[52 1[52 3[29 44[{ TeXf7b6d320Encoding ReEncodeFont }24
-90.9091 /CMBX10 rf /Fg 135[42 2[49 30 37 38 42 46 46
-51 74 23 1[28 28 46 42 28 42 46 42 42 46 14[66 3[68 82
-2[48 7[64 68 6[28 11[28 33[51 12[{ TeX74afc74cEncoding ReEncodeFont }30
-90.9091 /CMTI10 rf /Fh 214[91 7[91 11[71 5[45 15[{
- TeXbbad153fEncoding ReEncodeFont }4 90.9091 /CMSY10
-rf /Fi 134[59 2[59 62 44 44 46 1[62 56 62 93 31 59 1[31
-62 56 34 51 62 50 62 54 9[116 1[86 78 62 84 2[84 88 106
-3[42 1[88 70 74 86 81 80 85 1[53 9[56 56 56 56 56 1[56
-31 37 6[87 25[62 65 11[{ TeXf7b6d320Encoding ReEncodeFont }49
-99.6264 /CMBX12 rf /Fj 131[91 45 40 48 48 66 48 51 35
-36 36 48 51 45 51 76 25 48 28 25 51 45 28 40 51 40 51
-45 25 3[45 1[56 68 68 93 68 68 66 51 67 71 62 71 68 83
-57 71 47 33 68 71 59 62 69 66 64 68 71 43 43 71 25 25
-25 45 45 45 45 45 45 45 45 45 45 45 25 30 25 71 45 35
-35 25 71 76 45 76 45 19[76 51 51 53 11[{
- TeXf7b6d320Encoding ReEncodeFont }91 90.9091 /CMR10
-rf /Fk 139[35 4[54 9[48 22[81 19[32 58[{
- TeX74afc74cEncoding ReEncodeFont }5 90.9091 /CMBXTI10
-rf /Fl 134[71 71 2[75 52 53 55 71 75 67 75 112 37 2[37
-75 67 41 61 75 60 75 65 12[94 75 100 1[92 101 1[128 3[50
-2[85 88 103 97 96 102 8[67 67 67 67 67 67 67 67 1[67
-1[45 45[{ TeXf7b6d320Encoding ReEncodeFont }44 119.552
-/CMBX12 rf /Fm 133[43 51 1[70 51 54 38 38 38 2[49 54
-1[27 2[27 54 49 30 43 54 43 54 49 11[73 70 54 3[76 2[61
-6[66 1[70 1[73 76 13[49 49 49 1[27 1[27 44[{
- TeXf7b6d320Encoding ReEncodeFont }34 99.6264 /CMR12
-rf /Fn 137[70 73 51 52 51 70 73 66 73 111 36 2[36 1[66
-40 58 73 58 1[66 14[98 3[99 12[99 6[36 6[66 66 66 2[36
-4[51 51 40[{ TeXf7b6d320Encoding ReEncodeFont }28 143.462
-/CMR17 rf /Fo 139[47 57 4[79 10[65 1[72 13[79 102 3[104
-8[95 3[104 6[43 12[50 45[{ TeX74afc74cEncoding ReEncodeFont }12
-143.462 /CMTI12 rf /Fp 138[90 1[64 66 3[90 1[45 6[74
-3[78 11[124 7[153 77[{ TeXf7b6d320Encoding ReEncodeFont }9
-143.462 /CMBX12 rf end
%%EndProlog
%%BeginSetup
%%Feature: *Resolution 600dpi
TeXDict begin
-%%PaperSize: A4
- end
+
%%EndSetup
%%Page: 1 1
-TeXDict begin 1 0 bop 1487 637 a Fp(User)53 b(Man)l(ual)789
-1009 y Fo(tRNAsc)-7 b(an-SE:)52 b Fn(a)43 b(program)f(for)h(impro)l(v)l
-(ed)664 1192 y(transfer)g(RNA)g(detection)h(in)g(genomic)f(sequence)
-1539 1374 y(\(release:)58 b(1.23\))1706 1676 y Fm(T)-8
-b(o)s(dd)33 b(Lo)m(w)m(e)1480 1793 y(Sc)m(ho)s(ol)g(of)f(Engineering)
-1443 1909 y(Univ)m(ersit)m(y)j(of)d(California)1601 2025
-y(San)m(ta)h(Cruz,)h(CA)1553 2141 y(lo)m(w)m(e at so)s(e.ucsc.edu)1657
-2345 y(Octob)s(er)e(2001)148 2688 y Fl(1)135 b(In)l(tro)t(duction)148
-2891 y Fk(Note:)48 b Fj(An)30 b(HTML)g(v)m(ersion)h(of)f(this)h(man)m
-(ual)f(can)h(b)s(e)f(found)f(on)h(the)h(w)m(eb)f(at)148
-3004 y(\\h)m(ttp://genome.wustl.edu/lo)m(w)m(e/tRNAsca)q(n-SE-Man)m
-(ual/)q(Man)m(ual)q(.h)m(tml")q(.)148 3242 y Fi(1.1)113
-b(Brief)37 b(Description)148 3413 y Fj(tRNAscan-SE)c(iden)m(ti\014es)g
-(transfer)f(RNA)h(genes)g(in)g(genomic)g(DNA)h(or)e(RNA)h(sequences.)48
-b(It)32 b(com-)148 3526 y(bines)37 b(the)h(sp)s(eci\014cit)m(y)g(of)g
-(the)g(Co)m(v)m(e)g(probabilistic)g(RNA)g(prediction)g(pac)m(k)-5
+1 0 bop 1487 637 a Fp(User)53 b(Man)l(ual)789 1009 y
+Fo(tRNAsc)-7 b(an-SE:)52 b Fn(a)43 b(program)f(for)h(impro)l(v)l(ed)664
+1192 y(transfer)g(RNA)g(detection)i(in)g(genomic)f(sequence)1539
+1374 y(\(release:)59 b(1.23\))1706 1676 y Fm(T)-8 b(o)s(dd)33
+b(Lo)m(w)m(e)1480 1793 y(Sc)m(ho)s(ol)f(of)g(Engineering)1443
+1909 y(Univ)m(ersit)m(y)h(of)f(California)1601 2025 y(San)m(ta)h(Cruz,)
+h(CA)1553 2141 y(lo)m(w)m(e at so)s(e.ucsc.edu)1657 2345
+y(Octob)s(er)e(2001)148 2688 y Fl(1)135 b(In)l(tro)t(duction)148
+2891 y Fk(Note:)48 b Fj(An)30 b(HTML)g(v)m(ersion)g(of)g(this)g(man)m
+(ual)f(can)i(b)s(e)f(found)f(on)h(the)h(w)m(eb)f(at)148
+3004 y(\\h)m(ttp://genome.wustl.edu/lo)m(w)m(e/tRNAscan-SE-Man)m
+(ual/Man)m(ual.h)m(tml".)148 3242 y Fi(1.1)113 b(Brief)36
+b(Description)148 3413 y Fj(tRNAscan-SE)d(iden)m(ti\014es)e(transfer)h
+(RNA)h(genes)g(in)f(genomic)g(DNA)i(or)e(RNA)h(sequences.)48
+b(It)32 b(com-)148 3526 y(bines)k(the)i(sp)s(eci\014cit)m(y)e(of)i(the)
+g(Co)m(v)m(e)g(probabilistic)c(RNA)k(prediction)e(pac)m(k)-5
b(age)39 b(\(Eddy)e(&)g(Durbin,)148 3639 y(1994\))42
-b(with)d(the)h(sp)s(eed)f(and)g(sensitivit)m(y)i(of)f(tRNAscan)g(1.3)h
-(\(Fic)m(han)m(t)h(&)d(Burks,)j(1991\))f(plus)e(an)148
-3752 y(implemen)m(tation)34 b(of)f(an)f(algorithm)h(describ)s(ed)e(b)m
-(y)i(P)m(a)m(v)m(esi)h(and)e(colleagues)i(\(1994\))h(whic)m(h)d(searc)m
-(hes)148 3865 y(for)k(euk)-5 b(ary)m(otic)37 b(p)s(ol)e(I)s(I)s(I)f
-(tRNA)i(promoters)g(\(our)f(implemen)m(tation)i(referred)e(to)h(as)g
+b(with)c(the)i(sp)s(eed)f(and)g(sensitivit)m(y)f(of)i(tRNAscan)g(1.3)h
+(\(Fic)m(han)m(t)g(&)e(Burks,)j(1991\))f(plus)d(an)148
+3752 y(implemen)m(tation)31 b(of)i(an)f(algorithm)f(describ)s(ed)f(b)m
+(y)j(P)m(a)m(v)m(esi)g(and)f(colleagues)g(\(1994\))j(whic)m(h)c(searc)m
+(hes)148 3865 y(for)36 b(euk)-5 b(ary)m(otic)36 b(p)s(ol)e(I)s(I)s(I)g
+(tRNA)i(promoters)g(\(our)f(implemen)m(tation)f(referred)h(to)h(as)g
(Eu\014ndtRNA\).)148 3978 y(tRNAscan)d(and)e(Eu\014ndtRNA)f(are)j(used)
-e(as)h(\014rst-pass)f(pre\014lters)g(to)i(iden)m(tify)f(\\candidate")h
-(tRNA)148 4091 y(regions)g(of)g(the)f(sequence.)47 b(These)32
+e(as)h(\014rst-pass)f(pre\014lters)f(to)j(iden)m(tify)d(\\candidate")i
+(tRNA)148 4091 y(regions)g(of)h(the)f(sequence.)47 b(These)32
b(subsequences)g(are)g(then)g(passed)g(to)h(Co)m(v)m(e)h(for)e(further)
-f(analysis,)148 4204 y(and)25 b(output)g(if)g(Co)m(v)m(e)i(con\014rms)d
-(the)i(initial)g(tRNA)g(prediction.)39 b(In)25 b(this)g(w)m(a)m(y)-8
+f(analysis,)148 4204 y(and)25 b(output)g(if)f(Co)m(v)m(e)j(con\014rms)d
+(the)i(initial)c(tRNA)k(prediction.)37 b(In)25 b(this)f(w)m(a)m(y)-8
b(,)28 b(tRNAscan-SE)e(attains)148 4317 y(the)31 b(b)s(est)f(of)g(b)s
-(oth)g(w)m(orlds:)285 4474 y Fh(\017)46 b Fj(a)30 b(false)h(p)s(ositiv)
-m(e)h(rate)f(of)f(less)h(than)f(one)h(p)s(er)e(15)i(billion)g(n)m
-(ucleotides)h(of)e(random)g(sequence)285 4649 y Fh(\017)46
-b Fj(the)36 b(com)m(bined)g(sensitivities)h(of)f(tRNAscan)h(and)e
-(Eu\014ndtRNA)f(\(detection)k(of)e(99\045)g(of)g(true)376
+(oth)g(w)m(orlds:)285 4474 y Fh(\017)46 b Fj(a)30 b(false)g(p)s(ositiv)
+m(e)g(rate)h(of)f(less)g(than)g(one)h(p)s(er)e(15)i(billion)c(n)m
+(ucleotides)j(of)g(random)g(sequence)285 4649 y Fh(\017)46
+b Fj(the)36 b(com)m(bined)f(sensitivities)e(of)j(tRNAscan)h(and)e
+(Eu\014ndtRNA)f(\(detection)j(of)f(99\045)g(of)g(true)376
4762 y(tRNAs\))285 4938 y Fh(\017)46 b Fj(searc)m(h)29
-b(sp)s(eed)g(1,000)i(to)f(3,000)h(times)f(faster)g(than)f(Co)m(v)m(e)h
-(analysis)g(and)f(30)h(to)g(90)g(times)g(faster)376 5051
-y(than)c(the)i(original)g(tRNAscan)g(1.3)g(\(tRNAscan-SE)g(uses)e(b)s
-(oth)h(a)g(co)s(de-optimized)h(v)m(ersion)g(of)376 5163
-y(tRNAscan)j(1.3)g(whic)m(h)g(giv)m(es)g(a)g(650-fold)h(increase)g(in)e
-(sp)s(eed,)g(and)g(a)h(fast)f(C)g(implemen)m(tation)376
-5276 y(of)g(the)h(P)m(a)m(v)m(esi)h Fg(et)h(al.)41 b
-Fj(algorithm\).)1920 5525 y(1)p eop end
+b(sp)s(eed)g(1,000)i(to)f(3,000)h(times)e(faster)h(than)f(Co)m(v)m(e)h
+(analysis)e(and)h(30)h(to)g(90)g(times)f(faster)376 5051
+y(than)d(the)i(original)d(tRNAscan)j(1.3)g(\(tRNAscan-SE)g(uses)e(b)s
+(oth)h(a)g(co)s(de-optimized)f(v)m(ersion)h(of)376 5163
+y(tRNAscan)k(1.3)g(whic)m(h)f(giv)m(es)g(a)h(650-fold)g(increase)g(in)e
+(sp)s(eed,)h(and)g(a)h(fast)f(C)g(implemen)m(tation)376
+5276 y(of)g(the)h(P)m(a)m(v)m(esi)g Fg(et)i(al.)41 b
+Fj(algorithm\).)1920 5525 y(1)p eop
%%Page: 2 2
-TeXDict begin 2 1 bop 289 273 a Fj(This)34 b(program)g(and)g(results)g
-(of)h(its)f(analysis)h(of)g(a)g(n)m(um)m(b)s(er)e(of)h(genomes)i(ha)m
-(v)m(e)f(b)s(een)f(published)148 386 y(in)c(Lo)m(w)m(e)i(&)e(Eddy)-8
+2 1 bop 289 273 a Fj(This)33 b(program)h(and)g(results)f(of)i(its)e
+(analysis)g(of)i(a)g(n)m(um)m(b)s(er)e(of)h(genomes)i(ha)m(v)m(e)f(b)s
+(een)f(published)148 386 y(in)29 b(Lo)m(w)m(e)j(&)e(Eddy)-8
b(,)30 b Fg(Nucleic)h(A)-5 b(cids)33 b(R)-5 b(ese)g(ar)g(ch)40
b Ff(25)p Fj(:)h(955-964)33 b(\(1997\).)148 629 y Fi(1.2)113
-b(What)37 b(is)h(included)g(in)g(this)g(pac)m(k)-6 b(age?)148
-801 y Fj(This)26 b(distribution)h(includes)f(the)h(PERL)f(script)h
-(tRNAscan-SE,)h(all)f(the)g(\014les)g(necessary)g(to)h(compile)148
-914 y(and)h(run)g(the)h(complete)h(CO)m(VE)e(pac)m(k)-5
-b(age)32 b(\(v)m(ersion)f(2.4.4\),)h(all)f(the)f(\014les)f(necessary)h
-(to)h(compile)g(and)148 1027 y(run)26 b(the)i(mo)s(di\014ed)e(v)m
-(ersion)h(of)h(tRNAscan)g(\(v)m(ersion)g(1.4\),)h(and)e(all)h(the)f
-(\014les)h(needed)e(to)i(compile)h(and)148 1140 y(run)e(Eu\014ndtRNA)g
-(1.0)j(\(the)f(co)m(v)m(e)i(programs,)e(tRNAscan)g(1.4,)h(and)e
-(Eu\014ndtRNA)f(are)i(included)f(for)148 1252 y(use)d(with)g(the)g
-(tRNAscan-SE)g(program,)i(but)d(ma)m(y)h(also)h(b)s(e)f(run)e(as)j
-(stand-alone)g(programs\).)39 b(Instal-)148 1365 y(lation)g(of)e(the)h
-(PERL)e(\(Practical)k(Extraction)f(and)d(Rep)s(ort)h(Language,)k(Larry)
-36 b(W)-8 b(all\))40 b(in)m(terpreter)148 1478 y(pac)m(k)-5
-b(age)33 b(v)m(ersion)e(5.0)g(or)f(later)i(is)e(required)g(to)h(run)e
+b(What)37 b(is)g(included)f(in)h(this)g(pac)m(k)-6 b(age?)148
+801 y Fj(This)25 b(distribution)f(includes)g(the)j(PERL)f(script)g
+(tRNAscan-SE,)i(all)d(the)i(\014les)f(necessary)h(to)h(compile)148
+914 y(and)h(run)g(the)h(complete)g(CO)m(VE)f(pac)m(k)-5
+b(age)32 b(\(v)m(ersion)e(2.4.4\),)i(all)d(the)h(\014les)e(necessary)i
+(to)h(compile)e(and)148 1027 y(run)d(the)i(mo)s(di\014ed)d(v)m(ersion)h
+(of)i(tRNAscan)g(\(v)m(ersion)f(1.4\),)i(and)e(all)f(the)h(\014les)g
+(needed)f(to)i(compile)f(and)148 1140 y(run)g(Eu\014ndtRNA)g(1.0)j
+(\(the)f(co)m(v)m(e)i(programs,)e(tRNAscan)g(1.4,)h(and)e(Eu\014ndtRNA)
+f(are)i(included)d(for)148 1252 y(use)f(with)f(the)h(tRNAscan-SE)g
+(program,)i(but)d(ma)m(y)h(also)g(b)s(e)g(run)e(as)j(stand-alone)f
+(programs\).)39 b(Instal-)148 1365 y(lation)e(of)g(the)h(PERL)e
+(\(Practical)i(Extraction)g(and)e(Rep)s(ort)h(Language,)k(Larry)36
+b(W)-8 b(all\))38 b(in)m(terpreter)148 1478 y(pac)m(k)-5
+b(age)33 b(v)m(ersion)d(5.0)h(or)f(later)h(is)e(required)g(to)i(run)e
(the)h(tRNAscan-SE)h(PERL)f(script.)148 1722 y Fi(1.3)113
-b(Getting)37 b(Started)148 1893 y Fj(The)29 b(follo)m(wing)i
-(instructions)e(for)g(installing)h(the)g(tRNAscan-SE)g(pac)m(k)-5
-b(age)31 b(also)f(app)s(ear)f(in)g(the)g(\\IN-)148 2006
-y(ST)-8 b(ALL")30 b(text)i(\014le:)259 2194 y(1.)47 b(Edit)37
-b(the)i(top)f(of)g(the)g(Mak)m(e\014le.)65 b(Set)38 b(the)g(paths)g
-(and)f(other)h(mak)m(e)h(v)-5 b(ariables)39 b(to)f(suit)g(y)m(our)376
-2307 y(system.)376 2457 y(In)29 b(particular,)i(y)m(ou)g(need)f(to)h
-(sp)s(ecify:)485 2645 y Fh(\017)46 b Fj(where)29 b(executables)j(are)f
+b(Getting)36 b(Started)148 1893 y Fj(The)29 b(follo)m(wing)f
+(instructions)f(for)i(installing)d(the)k(tRNAscan-SE)g(pac)m(k)-5
+b(age)31 b(also)e(app)s(ear)g(in)f(the)h(\\IN-)148 2006
+y(ST)-8 b(ALL")30 b(text)i(\014le:)259 2194 y(1.)47 b(Edit)36
+b(the)j(top)f(of)g(the)g(Mak)m(e\014le.)64 b(Set)38 b(the)g(paths)g
+(and)f(other)h(mak)m(e)h(v)-5 b(ariables)37 b(to)h(suit)f(y)m(our)376
+2307 y(system.)376 2457 y(In)29 b(particular,)g(y)m(ou)i(need)f(to)h
+(sp)s(ecify:)485 2645 y Fh(\017)46 b Fj(where)29 b(executables)i(are)g
(to)g(b)s(e)f(installed)485 2791 y Fh(\017)46 b Fj(where)29
-b(data)j(\014les)e(are)h(to)g(b)s(e)e(installed)485 2937
-y Fh(\017)46 b Fj(where)29 b(P)m(erl)i(is)g(already)g(installed)g(on)f
-(the)h(system)485 3083 y Fh(\017)46 b Fj(what)30 b(the)g(P)m(erl)h
-(executable)h(is)f(called)g(\(i.e.)42 b(\\p)s(erl")31
-b(or)f(\\p)s(erl5"\))485 3229 y Fh(\017)46 b Fj(where)29
-b(temp)s(orary)h(\014les)h(will)f(reside)485 3375 y Fh(\017)46
-b Fj(where)29 b(to)j(install)f(man)f(pages)259 3563 y(2.)47
-b(t)m(yp)s(e)30 b('mak)m(e')i(to)f(build)e(the)i(programs)259
-3751 y(3.)47 b(t)m(yp)s(e)30 b('mak)m(e)i(install')f(to)g(install)h
-(the)e(programs)g(and)g(man)g(pages)376 3901 y Fk(Note:)70
-b Fj(If)42 b(y)m(ou)g(later)h(man)m(ually)f(mo)m(v)m(e)i(the)e(lo)s
-(cation)h(of)f(binaries)g(or)g(data)h(\014les)e(from)h(the)376
-4014 y(directories)23 b(sp)s(eci\014ed)f(in)g(the)h('Mak)m(e\014le',)j
-(y)m(ou)d(need)g(to)g(delete)h(the)e(tRNAscan-SE)h(executable,)376
-4127 y(up)s(date)29 b(the)i(lo)s(cations)h(sp)s(eci\014ed)d(in)h(the)h
-(Mak)m(e\014le,)h(and)e('mak)m(e)i(install')f(again.)259
+b(data)j(\014les)d(are)i(to)g(b)s(e)e(installed)485 2937
+y Fh(\017)46 b Fj(where)29 b(P)m(erl)h(is)g(already)g(installed)e(on)i
+(the)h(system)485 3083 y Fh(\017)46 b Fj(what)30 b(the)g(P)m(erl)g
+(executable)h(is)f(called)f(\(i.e.)41 b(\\p)s(erl")30
+b(or)g(\\p)s(erl5"\))485 3229 y Fh(\017)46 b Fj(where)29
+b(temp)s(orary)h(\014les)g(will)d(reside)485 3375 y Fh(\017)46
+b Fj(where)29 b(to)j(install)c(man)i(pages)259 3563 y(2.)47
+b(t)m(yp)s(e)30 b('mak)m(e')i(to)f(build)c(the)k(programs)259
+3751 y(3.)47 b(t)m(yp)s(e)30 b('mak)m(e)i(install')c(to)j(install)e
+(the)h(programs)g(and)g(man)g(pages)376 3901 y Fk(Note:)70
+b Fj(If)42 b(y)m(ou)g(later)g(man)m(ually)e(mo)m(v)m(e)k(the)e(lo)s
+(cation)f(of)h(binaries)e(or)i(data)h(\014les)d(from)i(the)376
+4014 y(directories)21 b(sp)s(eci\014ed)g(in)g(the)i('Mak)m(e\014le',)i
+(y)m(ou)e(need)g(to)g(delete)g(the)f(tRNAscan-SE)h(executable,)376
+4127 y(up)s(date)29 b(the)i(lo)s(cations)f(sp)s(eci\014ed)e(in)h(the)i
+(Mak)m(e\014le,)g(and)f('mak)m(e)i(install')c(again.)259
4314 y(4.)47 b(t)m(yp)s(e)31 b('mak)m(e)h(testrun')f(to)h(run)d
-(tRNAscan-SE)j(on)f(a)g(sample)g(sequence;)i(if)e(the)g(program)g(runs)
-376 4427 y(with)f(no)g(error)g(messages,)i(tRNAscan-SE)e(has)g(b)s(een)
-g(installed)h(correctly)259 4615 y(5.)47 b(t)m(yp)s(e)30
-b('mak)m(e)i(clean')f(to)g(clean)h(up.)289 4802 y(tRNAscan-SE)h(is)f
-(kno)m(wn)f(to)h(build)f(cleanly)i(on)f(a)g(n)m(um)m(b)s(er)f(of)h
-(di\013eren)m(t)g(UNIX)g(platforms)g(and)148 4915 y(OS's,)e(including)g
-(SGI)g(\(IRIX\),)h(Sun)e(\(Solaris\),)j(DEC)e(Alpha)g(\(OSF/1\),)i(and)
-e(In)m(tel)h(x86)g(\(Lin)m(ux\).)289 5141 y Fk(Note:)43
-b Fj(A)20 b(small)h(P)m(erl)g(script)f(\(c)m(hec)m(kv)m(ersion.pl\))j
-(will)e(run)d(in)i(the)h(pro)s(cess)f(of)g('mak)m(e'ing)i(tRNAscan-)148
-5254 y(SE.)45 b(If)g(y)m(ou)g(ha)m(v)m(e)h(sp)s(eci\014ed)f(an)g(in)m
-(v)-5 b(alid)45 b(lo)s(cation)i(or)e(v)m(ersion)h(of)f(P)m(erl)h(\()p
-Fe(<)p Fj(5.0\))g(in)f(the)g(Mak)m(e\014le)1920 5525
-y(2)p eop end
+(tRNAscan-SE)j(on)f(a)g(sample)f(sequence;)j(if)d(the)h(program)g(runs)
+376 4427 y(with)e(no)h(error)g(messages,)i(tRNAscan-SE)e(has)g(b)s(een)
+g(installed)e(correctly)259 4615 y(5.)47 b(t)m(yp)s(e)30
+b('mak)m(e)i(clean')e(to)h(clean)g(up.)289 4802 y(tRNAscan-SE)i(is)e
+(kno)m(wn)g(to)h(build)d(cleanly)i(on)h(a)g(n)m(um)m(b)s(er)f(of)h
+(di\013eren)m(t)f(UNIX)h(platforms)f(and)148 4915 y(OS's,)f(including)d
+(SGI)j(\(IRIX\),)h(Sun)e(\(Solaris\),)h(DEC)g(Alpha)f(\(OSF/1\),)j(and)
+e(In)m(tel)g(x86)h(\(Lin)m(ux\).)289 5141 y Fk(Note:)43
+b Fj(A)20 b(small)f(P)m(erl)h(script)f(\(c)m(hec)m(kv)m(ersion.pl\))i
+(will)d(run)g(in)h(the)i(pro)s(cess)f(of)g('mak)m(e'ing)h(tRNAscan-)148
+5254 y(SE.)45 b(If)g(y)m(ou)g(ha)m(v)m(e)h(sp)s(eci\014ed)e(an)h(in)m
+(v)-5 b(alid)42 b(lo)s(cation)j(or)g(v)m(ersion)g(of)g(P)m(erl)g(\()p
+Fe(<)p Fj(5.0\))h(in)e(the)h(Mak)m(e\014le)1920 5525
+y(2)p eop
%%Page: 3 3
-TeXDict begin 3 2 bop 148 273 a Fj(PERLDIR)31 b(v)-5
-b(ariable,)31 b(the)g(mak)m(e)h(will)f(fail.)42 b(If)30
-b(y)m(ou)h(plan)f(to)h(install)h(a)f(correct)g(v)m(ersion)h(of)e(P)m
-(erl)h Fg(after)148 386 y Fj(installing)k(the)f(tRNAscan-SE)g(pac)m(k)
--5 b(age,)37 b(y)m(ou)d(ma)m(y)h(short-circut)f(this)g(c)m(hec)m(k)h(b)
-m(y)f(commen)m(ting)h(out)148 499 y(the)c(line)g(in)f(the)g(mak)m
-(e\014le)i(con)m(taining)g('c)m(hec)m(kv)m(ersion.pl'.)289
-724 y(Once)39 b(installed,)j(the)d(user)f(ma)m(y)h(wish)f(to)i(w)m(ork)
-f(through)f(sev)m(eral)i(of)f(the)f(examples)i(included)148
-837 y(\(Section)d(6)e(of)g(this)g(do)s(cumen)m(t\))h(to)g(get)g(a)f
-(quic)m(k)h(feel)g(for)f(the)g(program's)g(op)s(eration)h(and)e(some)i
-(of)148 950 y(the)26 b(most)g(commonly)g(used)f(command)h(line)g
-(options.)39 b(A)26 b(description)g(of)f(the)h(default)g(run)e(mo)s(de)
-i(and)148 1063 y(output)33 b(app)s(ears)f(in)g(Section)h(4,)h(and)e(a)h
-(description)g(of)g(eac)m(h)h(of)f(the)g(program)f(options)h(is)g
-(included)148 1176 y(in)d(Section)i(5)e(of)h(this)f(do)s(cumen)m(t.)148
+3 2 bop 148 273 a Fj(PERLDIR)31 b(v)-5 b(ariable,)29
+b(the)i(mak)m(e)h(will)c(fail.)40 b(If)30 b(y)m(ou)h(plan)e(to)i
+(install)e(a)i(correct)g(v)m(ersion)g(of)f(P)m(erl)g
+Fg(after)148 386 y Fj(installing)h(the)j(tRNAscan-SE)g(pac)m(k)-5
+b(age,)37 b(y)m(ou)d(ma)m(y)h(short-circut)e(this)g(c)m(hec)m(k)i(b)m
+(y)f(commen)m(ting)g(out)148 499 y(the)d(line)e(in)g(the)h(mak)m
+(e\014le)h(con)m(taining)f('c)m(hec)m(kv)m(ersion.pl'.)289
+724 y(Once)39 b(installed,)g(the)g(user)f(ma)m(y)h(wish)e(to)j(w)m(ork)
+f(through)f(sev)m(eral)h(of)g(the)f(examples)h(included)148
+837 y(\(Section)d(6)f(of)g(this)f(do)s(cumen)m(t\))i(to)g(get)g(a)f
+(quic)m(k)g(feel)g(for)g(the)g(program's)g(op)s(eration)g(and)f(some)i
+(of)148 950 y(the)26 b(most)g(commonly)f(used)g(command)h(line)e
+(options.)38 b(A)26 b(description)e(of)h(the)h(default)f(run)f(mo)s(de)
+i(and)148 1063 y(output)33 b(app)s(ears)f(in)f(Section)h(4,)i(and)e(a)h
+(description)e(of)i(eac)m(h)h(of)f(the)g(program)f(options)g(is)g
+(included)148 1176 y(in)d(Section)i(5)f(of)h(this)e(do)s(cumen)m(t.)148
1420 y Fi(1.4)113 b(In)m(tended)38 b(Use)148 1591 y Fj(tRNAscan-SE)32
-b(w)m(as)f(designed)g(to)h(mak)m(e)g(rapid,)f(sensitiv)m(e)h(searc)m
-(hes)g(of)f(genomic)i(sequence)e(feasible)148 1704 y(using)38
-b(the)f(selectivit)m(y)k(of)d(the)g(Co)m(v)m(e)h(analysis)f(pac)m(k)-5
-b(age.)65 b(W)-8 b(e)39 b(ha)m(v)m(e)g(optimized)f(searc)m(h)h
-(sensitivit)m(y)148 1817 y(with)34 b(euk)-5 b(ary)m(ote)35
-b(cytoplasmic)h(&)d(eubacterial)j(sequences,)f(but)e(it)i(ma)m(y)f(b)s
-(e)g(applied)f(more)h(broadly)148 1930 y(with)c(a)h(sligh)m(t)h
-(reduction)e(in)g(sensitivit)m(y)-8 b(.)148 2173 y Fi(1.5)113
+b(w)m(as)f(designed)f(to)i(mak)m(e)g(rapid,)e(sensitiv)m(e)g(searc)m
+(hes)i(of)f(genomic)h(sequence)f(feasible)148 1704 y(using)37
+b(the)g(selectivit)m(y)h(of)g(the)g(Co)m(v)m(e)h(analysis)d(pac)m(k)-5
+b(age.)65 b(W)-8 b(e)39 b(ha)m(v)m(e)g(optimized)d(searc)m(h)j
+(sensitivit)m(y)148 1817 y(with)33 b(euk)-5 b(ary)m(ote)35
+b(cytoplasmic)f(&)f(eubacterial)h(sequences,)h(but)e(it)h(ma)m(y)g(b)s
+(e)g(applied)d(more)j(broadly)148 1930 y(with)29 b(a)i(sligh)m(t)f
+(reduction)f(in)g(sensitivit)m(y)-8 b(.)148 2173 y Fi(1.5)113
b(W)-9 b(eb)37 b(Resources)148 2345 y Fj(F)-8 b(or)36
-b(small-scale)i(users)c(and)h(those)h(who)e(are)i(unable)f(to)h
-(install)g(tRNAscan-SE)f(on)h(a)f(lo)s(cal)i(UNIX)148
-2458 y(platform,)45 b(a)e(w)m(eb-based)e(v)m(ersion)i(of)f(the)g
-(program)f(is)h(a)m(v)-5 b(ailable)44 b(for)e(on-line)h(tRNA)f
-(analysis)g(at)148 2571 y(\\h)m
-(ttp://genome.wustl.edu/eddy/tRNAscan-SE/".)48 b(All)31
-b(of)h(the)f(most)h(frequen)m(tly)f(used)g(options)148
-2684 y(are)c(a)m(v)-5 b(ailable)29 b(in)e(the)g(w)m(eb-based)f(v)m
-(ersion.)40 b(Links)26 b(to)i(the)f(most)g(recen)m(t)g(release)h(of)f
-(the)g(program)g(and)148 2797 y(the)k(tRNAscan-SE)g(Genomic)g(tRNA)g
-(Database)h(are)f(also)g(a)m(v)-5 b(ailable)33 b(from)d(this)g(page.)
+b(small-scale)f(users)f(and)h(those)h(who)e(are)i(unable)e(to)i
+(install)d(tRNAscan-SE)i(on)h(a)f(lo)s(cal)g(UNIX)148
+2458 y(platform,)44 b(a)f(w)m(eb-based)e(v)m(ersion)h(of)g(the)g
+(program)f(is)g(a)m(v)-5 b(ailable)41 b(for)h(on-line)f(tRNA)h
+(analysis)e(at)148 2571 y(\\h)m
+(ttp://genome.wustl.edu/eddy/tRNAscan-SE/".)47 b(All)29
+b(of)j(the)f(most)h(frequen)m(tly)e(used)h(options)148
+2684 y(are)c(a)m(v)-5 b(ailable)26 b(in)g(the)h(w)m(eb-based)f(v)m
+(ersion.)39 b(Links)25 b(to)j(the)f(most)g(recen)m(t)g(release)g(of)g
+(the)g(program)g(and)148 2797 y(the)k(tRNAscan-SE)g(Genomic)f(tRNA)h
+(Database)h(are)f(also)f(a)m(v)-5 b(ailable)30 b(from)g(this)f(page.)
148 3083 y Fl(2)135 b(Metho)t(ds)148 3286 y Fj(tRNAscan-SE)34
-b(do)s(es)f(no)g(tRNA)h(detection)h(itself,)g(but)d(instead)i(com)m
-(bines)g(the)f(strengths)g(of)h(three)148 3399 y(indep)s(enden)m(t)41
-b(tRNA)h(prediction)f(programs)g(b)m(y)h(negotiating)i(the)d(\015o)m(w)
-h(of)g(information)f(b)s(et)m(w)m(een)148 3512 y(them,)h(p)s(erforming)
-37 b(a)j(limited)f(amoun)m(t)h(of)f(p)s(ost-pro)s(cessing,)i(and)d
-(outputting)h(the)g(results.)67 b(The)148 3625 y(program)39
-b(w)m(orks)g(in)g(three)g(main)g(phases.)66 b(In)39 b(the)g(\014rst)f
-(stage,)43 b(it)d(runs)d(t)m(w)m(o)k(indep)s(enden)m(t)c(tRNA)148
-3738 y(detection)c(programs)e(on)g(the)h(input)e(DNA)i(sequence.)44
-b(These)31 b(relativ)m(ely)j(fast,)e(\014rst-pass)e(detection)148
-3851 y(programs)f(include)f(a)h(mo)s(di\014ed,)g(optimized)g(v)m
-(ersion)h(of)f(tRNAscan)g(1.3)h(\(1\),)g(and)f(Eu\014ndtRNA,)e(an)148
-3963 y(implemen)m(tation)32 b(of)f(another)f(tRNA)h(searc)m(h)g
-(algorithm)h(previously)e(describ)s(ed)f(\(3\).)289 4076
-y(tRNAscan)39 b(1.3)f(detects)g(tRNAs)g(b)m(y)f(initially)i(lo)s(oking)
-f(for)f(short,)i(w)m(ell)g(conserv)m(ed)e(in)m(tragenic)148
-4189 y(promoter)32 b(sequences)h(\(A)f(&)g(B)g(b)s(o)m(xes)g(in)g(euk)
--5 b(ary)m(otes\))33 b(found)e(in)h(the)g(TPC)f(and)g(D)i(arm)e
-(regions)i(of)148 4302 y(protot)m(ypic)i(tRNAs.)50 b(Once)33
-b(a)h(sp)s(eci\014c)f(n)m(um)m(b)s(er)f(of)i(n)m(ucleotides)g(in)f(the)
-h(sequence)g(matc)m(h)g(the)f(con-)148 4415 y(sensus)d(promoter)g
-(\(de\014ned)g(b)m(y)g(an)h(arbitrary)f(score)h(threshold\),)g(the)g
+b(do)s(es)f(no)g(tRNA)h(detection)g(itself,)f(but)f(instead)h(com)m
+(bines)g(the)g(strengths)g(of)h(three)148 3399 y(indep)s(enden)m(t)40
+b(tRNA)i(prediction)d(programs)i(b)m(y)h(negotiating)g(the)f(\015o)m(w)
+h(of)g(information)d(b)s(et)m(w)m(een)148 3512 y(them,)j(p)s(erforming)
+36 b(a)k(limited)c(amoun)m(t)k(of)f(p)s(ost-pro)s(cessing,)h(and)e
+(outputting)g(the)h(results.)66 b(The)148 3625 y(program)39
+b(w)m(orks)g(in)f(three)h(main)f(phases.)66 b(In)39 b(the)g(\014rst)f
+(stage,)43 b(it)c(runs)e(t)m(w)m(o)k(indep)s(enden)m(t)36
+b(tRNA)148 3738 y(detection)c(programs)f(on)g(the)h(input)d(DNA)j
+(sequence.)44 b(These)31 b(relativ)m(ely)g(fast,)h(\014rst-pass)e
+(detection)148 3851 y(programs)f(include)d(a)j(mo)s(di\014ed,)f
+(optimized)f(v)m(ersion)i(of)g(tRNAscan)g(1.3)h(\(1\),)g(and)f
+(Eu\014ndtRNA,)e(an)148 3963 y(implemen)m(tation)i(of)i(another)f(tRNA)
+h(searc)m(h)g(algorithm)f(previously)e(describ)s(ed)g(\(3\).)289
+4076 y(tRNAscan)39 b(1.3)f(detects)g(tRNAs)g(b)m(y)f(initially)d(lo)s
+(oking)i(for)h(short,)i(w)m(ell)e(conserv)m(ed)g(in)m(tragenic)148
+4189 y(promoter)32 b(sequences)h(\(A)f(&)g(B)g(b)s(o)m(xes)g(in)f(euk)
+-5 b(ary)m(otes\))33 b(found)e(in)g(the)h(TPC)f(and)g(D)i(arm)e
+(regions)h(of)148 4302 y(protot)m(ypic)i(tRNAs.)50 b(Once)33
+b(a)h(sp)s(eci\014c)e(n)m(um)m(b)s(er)g(of)i(n)m(ucleotides)e(in)g(the)
+i(sequence)g(matc)m(h)g(the)f(con-)148 4415 y(sensus)d(promoter)g
+(\(de\014ned)g(b)m(y)g(an)h(arbitrary)e(score)i(threshold\),)f(the)h
(program)f(then)g(progressiv)m(ely)148 4528 y(attempts)i(to)e(iden)m
-(tify)h(the)g(v)-5 b(arious)30 b(stem-lo)s(op)h(structures)e(found)g
-(in)h(the)h(tRNA)f(\\clo)m(v)m(er)j(leaf)7 b(".)42 b(As)148
-4641 y(eac)m(h)c(arm)e(is)h(iden)m(ti\014ed)f(b)m(y)h(the)g(presence)f
-(of)h(base-pairing)g(in)f(the)h(stem,)h(correct)g(lo)s(op)f(size,)i
-(and)148 4754 y(sev)m(eral)31 b(in)m(v)-5 b(arian)m(t)30
-b(and)f(semi-in)m(v)-5 b(arian)m(t)31 b(bases,)f(a)g(\\general)g
-(score")h(coun)m(ter)f(is)f(incremen)m(ted.)41 b(If)29
-b(the)148 4867 y(\014nal)d(score)g(exceeds)h(an)e(empirically)i
-(determined)e(threshold,)h(the)g(tRNA)h(lo)s(cation,)h(an)m(tico)s
-(don,)g(and)148 4980 y(t)m(yp)s(e)j(are)g(sa)m(v)m(ed.)289
-5093 y(Eu\014ndtRNA,)42 b(on)g(the)h(other)g(hand,)i(only)e(searc)m
-(hes)h(for)e(linear)h(sequence)h(signals.)78 b(A)43 b(step-)148
-5205 y(wise)31 b(algorithm)h(uses)e(newly)h(dev)m(elop)s(ed)g(log-o)s
-(dds)g(score)g(matrices)h(to)f(\014rst)f(iden)m(tify)h(A)g(and)f(B)h(b)
-s(o)m(x)1920 5525 y(3)p eop end
+(tify)f(the)i(v)-5 b(arious)29 b(stem-lo)s(op)h(structures)f(found)g
+(in)g(the)i(tRNA)f(\\clo)m(v)m(er)i(leaf)7 b(".)41 b(As)148
+4641 y(eac)m(h)d(arm)e(is)g(iden)m(ti\014ed)e(b)m(y)j(the)g(presence)f
+(of)h(base-pairing)e(in)g(the)i(stem,)h(correct)g(lo)s(op)e(size,)i
+(and)148 4754 y(sev)m(eral)30 b(in)m(v)-5 b(arian)m(t)28
+b(and)h(semi-in)m(v)-5 b(arian)m(t)28 b(bases,)i(a)g(\\general)f
+(score")i(coun)m(ter)f(is)e(incremen)m(ted.)40 b(If)29
+b(the)148 4867 y(\014nal)c(score)h(exceeds)h(an)e(empirically)e
+(determined)h(threshold,)h(the)h(tRNA)h(lo)s(cation,)f(an)m(tico)s
+(don,)h(and)148 4980 y(t)m(yp)s(e)k(are)g(sa)m(v)m(ed.)289
+5093 y(Eu\014ndtRNA,)42 b(on)g(the)h(other)g(hand,)i(only)d(searc)m
+(hes)i(for)e(linear)f(sequence)j(signals.)76 b(A)43 b(step-)148
+5205 y(wise)30 b(algorithm)g(uses)g(newly)g(dev)m(elop)s(ed)g(log-o)s
+(dds)g(score)h(matrices)g(to)g(\014rst)f(iden)m(tify)f(A)i(and)f(B)h(b)
+s(o)m(x)1920 5525 y(3)p eop
%%Page: 4 4
-TeXDict begin 4 3 bop 148 273 a Fj(promoter)37 b(elemen)m(ts)h(that)f
-(exceed)g(an)g(empirically)g(determined)f(cuto\013.)60
-b(The)36 b(scores)h(for)f(these)h(A)148 386 y(and)30
-b(B)i(b)s(o)m(xes)e(are)i(then)e(added)g(to)i(a)f(log)h(o)s(dds)d
-(score)j(for)e(the)h(n)m(ucleotide)h(distance)g(b)s(et)m(w)m(een)f(the)
-g(A)148 499 y(and)d(B)h(b)s(o)m(xes)f(to)h(pro)s(duce)e(an)i(in)m
-(termediate)g(score.)41 b(Finally)-8 b(,)31 b(a)d(log)i(o)s(dds)d
-(score)i(for)f(the)g(distance)h(to)148 612 y(the)c(nearest)f(do)m
-(wnstream)g(p)s(oly-T)g(p)s(ol)g(I)s(I)s(I)e(termination)j(signal)g(is)
-f(added)g(to)g(the)h(in)m(termediate)g(score)148 724
-y(to)37 b(obtain)g(a)f(\014nal)g(score.)58 b(If)36 b(the)g(\014nal)g
-(score)h(is)f(ab)s(o)m(v)m(e)h(a)g(\014nal)e(score)i(cuto\013,)i(the)d
-(tRNA)h(iden)m(tit)m(y)148 837 y(and)j(lo)s(cation)h(is)f(sa)m(v)m(ed.)
-71 b(tRNAscan-SE)40 b(uses)g(a)g(less)g(selectiv)m(e)j(v)m(ersion)d(of)
-h(this)e(algorithm)i(that)148 950 y(do)s(es)d(not)h(lo)s(ok)f(for)g(p)s
-(ol)g(I)s(I)s(I)f(termination)i(signals,)i(th)m(us)d(uses)f(the)i(in)m
-(termediate)h(score)e(as)h(a)f(\014nal)148 1063 y(cuto\013.)49
-b(Also,)34 b(the)f(in)m(termediate)i(score)e(cuto\013)h(is)f(lo)s
-(osened)g(sligh)m(tly)h(relativ)m(e)h(to)e(the)g(in)m(termediate)148
-1176 y(cuto\013)c(describ)s(ed)e(in)h(the)g(original)h(algorithm)h
-(\(3\).)41 b(These)27 b(mo)s(di\014cations)i(increase)g(the)f
-(algorithm's)148 1289 y(sensitivit)m(y)44 b(but)e(greatly)i(reduce)e
-(Eu\014ndtRNA's)f(selectivit)m(y)-8 b(.)80 b(This)41
-b(do)s(es)h(not)h(reduce)f(the)g(\014nal)148 1402 y(selectivit)m(y)35
-b(of)d(tRNAscan-SE)g(since)g(a)g(secondary)g(\014lter)f(\(Co)m(v)m(e\))
-j(is)e(b)s(eing)f(used)g(to)h(eliminate)h(false)148 1515
-y(p)s(ositiv)m(es.)77 b(The)42 b(sensitivit)m(y)i(of)e(Eu\014ndtRNA)f
-(is)h(roughly)g(comparable)h(to)g(tRNAscan)g(1.3,)k(but)148
-1628 y(it)37 b(app)s(ears)e(to)i(b)s(e)f(complemen)m(tary)h(in)f(that)g
-(Eu\014ndtRNA)f(tends)h(to)g(iden)m(tify)h(tRNAs)f(missed)g(b)m(y)148
-1741 y(tRNAscan)j(1.3)g(and)f(vice)h(v)m(ersa)f(\(3\).)65
-b(tRNAscan-SE)39 b(tak)m(es)g(adv)-5 b(an)m(tage)40 b(of)e(this)g
-(fact,)j(and)d(sa)m(v)m(es)148 1854 y(results)32 b(from)f(b)s(oth)h
-(tRNAscan)g(1.3)h(and)e(Eu\014ndtRNA,)g(then)h(merges)g(them)g(in)m(to)
-h(one)f(list)g(of)g(non-)148 1967 y(redundan)m(t)d(\\candidate")j(tRNA)
-f(iden)m(ti\014cations.)289 2079 y(In)24 b(the)g(second)h(stage,)i
-(tRNAscan-SE)d(extracts)i(the)e(DNA)h(subsequences)f(iden)m(ti\014ed)g
-(as)g(p)s(ossible)148 2192 y(tRNAs)e(and)f(passes)g(only)g(these)h
-(segmen)m(ts)g(to)g(an)f(RNA)h(searc)m(h)g(program)f(in)g(the)g(Co)m(v)
-m(e)i(program)e(suite)148 2305 y(\(co)m(v)m(els\))28
-b(for)d(analysis.)40 b(Co)m(v)m(e)26 b(programs)f(lo)s(ok)h(for)f
-(tRNAs)g(in)g(a)h(v)m(ery)f(di\013eren)m(t)h(w)m(a)m(y)-8
-b(.)40 b(A)25 b(probabilistic)148 2418 y(mo)s(del)33
-b(for)h(tRNA)f(has)h(b)s(een)e(dev)m(elop)s(ed)i(b)m(y)f(aligning)h
-(kno)m(wn)f(tRNAs)h(and)f(giving)h(a)g(base-sp)s(eci\014c)148
-2531 y(probabilit)m(y)28 b(score)f(to)h(ev)m(ery)g(n)m(ucleotide)g(in)f
-(the)g(tRNA)h(mo)s(del.)39 b(Also,)29 b(Co)m(v)m(e)f(uses)f(a)g(sp)s
-(ecial)h(metho)s(d)148 2644 y(for)37 b(capturing)h(secondary)f(RNA)h
-(structure)f(information)g(using)g(a)h(t)m(yp)s(e)f(of)h(language)h
-(referred)d(to)148 2757 y(as)30 b(a)g(sto)s(c)m(hastic)h(con)m
-(text-free)h(grammar)e(\(SCF)m(G\).)g(Co)m(v)m(e)h(applies)f(this)f
-(probabilistic)h(mo)s(del)g(to)g(the)148 2870 y(en)m(tire)g(windo)m(w)m
-(ed)e(sequence,)h(and)f(pro)s(duces)f(a)i(probabilit)m(y)g(score)g
-(that)g(the)g(sequence)f(matc)m(hes)i(the)148 2983 y(tRNA)35
-b(mo)s(del.)51 b(If)33 b(the)i(score)f(exceeds)h(20.0)g(bits,)g(the)f
-(tRNA)h(is)f(considered)g(a)g(true)g(tRNA)g(\(based)148
-3096 y(on)d(empirical)g(studies)f(in)g(ref.)40 b(2\).)289
-3209 y(In)24 b(the)g(\014nal)g(phase,)h(tRNAscan-SE)f(tak)m(es)i(those)
-e(tRNAs)h(con\014rmed)e(as)h(suc)m(h)g(and)f(runs)g(another)148
-3321 y(Co)m(v)m(e)28 b(program)d(\(co)m(v)m(es\))k(that)e(displa)m(ys)f
-(RNA)g(secondary)g(structure.)39 b(The)25 b(tRNA)i(t)m(yp)s(e)f(is)g
-(predicted)148 3434 y(b)m(y)37 b(iden)m(tifying)g(the)g(an)m(tico)s
-(don)g(within)f(the)h(structure)f(output.)59 b(In)m(trons)37
-b(are)g(also)g(automatically)148 3547 y(iden)m(ti\014ed)45
-b(from)f(the)g(structure)g(output)g(as)g(runs)f(of)h(\014v)m(e)h(or)f
-(more)h(consecutiv)m(e)h(non-consensus)148 3660 y(n)m(ucleotides)32
-b(within)e(the)g(an)m(tico)s(don)i(lo)s(op.)289 3773
-y(tRNAscan-SE)j(uses)e(heuristics)h(to)g(try)g(to)h(distinguish)e
-(pseudogenes)g(from)h(true)f(tRNAs,)i(pri-)148 3886 y(marily)i(on)g
-(lac)m(k)h(of)f(tRNA-lik)m(e)i(secondary)d(structure.)60
-b(A)36 b(second)h(tRNA)g(co)m(v)-5 b(ariance)39 b(mo)s(del)e(w)m(as)148
-3999 y(created)i(from)f(the)g(original)h(1415-tRNA)i(alignmen)m(t,)g
-(under)36 b(the)j(constrain)m(t)g(that)f(no)g(secondary)148
-4112 y(structure)c(is)g(conserv)m(ed)g(\(this)h(mo)s(del)f(is)g
-(e\013ectiv)m(ely)j(just)c(a)h(sequence)h(pro\014le,)g(or)f(hidden)e
-(Mark)m(o)m(v)148 4225 y(mo)s(del\).)39 b(By)24 b(subtracting)h(a)f
-(tRNA's)h(similarit)m(y)g(score)g(to)f(the)h(primary)e(structure-only)h
-(mo)s(del)g(from)148 4338 y(that)39 b(using)e(the)h(complete)i(tRNA)e
-(mo)s(del,)i(a)e(secondary)g(structure-only)g(score)g(is)g(obtained.)64
-b(W)-8 b(e)148 4451 y(ha)m(v)m(e)41 b(observ)m(ed)e(that)g(tRNAs)h
-(with)f(lo)m(w)g(scores)h(for)f(either)g(comp)s(onen)m(t)h(of)f(the)g
-(total)i(score)f(w)m(ere)148 4563 y(often)e(pseudogenes.)61
-b(Th)m(us,)38 b(tRNAs)f(are)h(mark)m(ed)f(as)h(lik)m(ely)g(pseudogenes)
-f(if)g(they)h(ha)m(v)m(e)g(either)g(a)148 4676 y(score)30
-b(of)f(less)h(than)f(10)h(bits)f(for)g(the)g(primary)g(sequence)g(comp)
-s(onen)m(t)h(of)f(the)g(total)i(score,)g(or)e(a)g(score)148
-4789 y(of)f(less)h(than)e(5)i(bits)f(for)f(the)i(secondary)f(structure)
-f(comp)s(onen)m(t)h(of)g(the)h(total)g(score.)41 b(Seleno)s(cysteine)
-148 4902 y(tRNAs)24 b(are)g(not)g(c)m(hec)m(k)m(ed)i(b)m(y)e(these)g
-(rules)f(since)h(they)g(ha)m(v)m(e)h(at)m(ypical)g(primary)e(and)g
-(secondary)h(struc-)148 5015 y(ture.)39 b(Also,)26 b(use)f(of)f(the)h
-(-O)f(option)h(\(searc)m(h)h(for)e(organellar)i(tRNAs\))f(disables)g
-(pseudogene)f(c)m(hec)m(king)148 5128 y(since)31 b(these)g(criteria)h
-(are)e(geared)i(to)m(w)m(ards)f(detecting)h(cytoplasmic)g(pseudogenes)e
-(\(some)h(true)f(non-)148 5241 y(euk)-5 b(ary)m(otic)30
-b(tRNA)e(are)h(mark)m(ed)f(as)g(pseudogenes)f(b)m(y)h(this)g
-(analysis\).)41 b(Final)28 b(tRNA)h(predictions)f(are)1920
-5525 y(4)p eop end
+4 3 bop 148 273 a Fj(promoter)37 b(elemen)m(ts)g(that)g(exceed)g(an)g
+(empirically)c(determined)i(cuto\013.)60 b(The)36 b(scores)h(for)f
+(these)h(A)148 386 y(and)30 b(B)i(b)s(o)m(xes)e(are)i(then)e(added)g
+(to)i(a)f(log)g(o)s(dds)e(score)j(for)e(the)h(n)m(ucleotide)f(distance)
+h(b)s(et)m(w)m(een)g(the)g(A)148 499 y(and)d(B)h(b)s(o)m(xes)f(to)h
+(pro)s(duce)e(an)i(in)m(termediate)e(score.)41 b(Finally)-8
+b(,)28 b(a)g(log)h(o)s(dds)e(score)i(for)f(the)g(distance)g(to)148
+612 y(the)d(nearest)f(do)m(wnstream)g(p)s(oly-T)f(p)s(ol)g(I)s(I)s(I)f
+(termination)h(signal)g(is)g(added)h(to)g(the)h(in)m(termediate)e
+(score)148 724 y(to)37 b(obtain)f(a)g(\014nal)f(score.)58
+b(If)36 b(the)g(\014nal)f(score)i(is)e(ab)s(o)m(v)m(e)i(a)g(\014nal)d
+(score)j(cuto\013,)i(the)d(tRNA)h(iden)m(tit)m(y)148
+837 y(and)j(lo)s(cation)f(is)g(sa)m(v)m(ed.)71 b(tRNAscan-SE)40
+b(uses)g(a)g(less)f(selectiv)m(e)i(v)m(ersion)e(of)i(this)d(algorithm)h
+(that)148 950 y(do)s(es)f(not)h(lo)s(ok)e(for)h(p)s(ol)f(I)s(I)s(I)g
+(termination)g(signals,)i(th)m(us)f(uses)f(the)i(in)m(termediate)f
+(score)g(as)h(a)f(\014nal)148 1063 y(cuto\013.)49 b(Also,)33
+b(the)g(in)m(termediate)g(score)g(cuto\013)h(is)e(lo)s(osened)g(sligh)m
+(tly)f(relativ)m(e)i(to)g(the)g(in)m(termediate)148 1176
+y(cuto\013)c(describ)s(ed)d(in)h(the)h(original)e(algorithm)i(\(3\).)41
+b(These)27 b(mo)s(di\014cations)g(increase)h(the)g(algorithm's)148
+1289 y(sensitivit)m(y)41 b(but)h(greatly)h(reduce)f(Eu\014ndtRNA's)f
+(selectivit)m(y)-8 b(.)77 b(This)40 b(do)s(es)i(not)h(reduce)f(the)g
+(\014nal)148 1402 y(selectivit)m(y)32 b(of)g(tRNAscan-SE)g(since)f(a)h
+(secondary)g(\014lter)e(\(Co)m(v)m(e\))k(is)d(b)s(eing)f(used)h(to)h
+(eliminate)e(false)148 1515 y(p)s(ositiv)m(es.)75 b(The)42
+b(sensitivit)m(y)f(of)h(Eu\014ndtRNA)f(is)g(roughly)g(comparable)h(to)h
+(tRNAscan)g(1.3,)k(but)148 1628 y(it)36 b(app)s(ears)f(to)i(b)s(e)f
+(complemen)m(tary)g(in)f(that)h(Eu\014ndtRNA)f(tends)h(to)g(iden)m
+(tify)f(tRNAs)h(missed)f(b)m(y)148 1741 y(tRNAscan)k(1.3)g(and)f(vice)g
+(v)m(ersa)g(\(3\).)65 b(tRNAscan-SE)39 b(tak)m(es)g(adv)-5
+b(an)m(tage)40 b(of)e(this)f(fact,)k(and)d(sa)m(v)m(es)148
+1854 y(results)31 b(from)g(b)s(oth)h(tRNAscan)g(1.3)h(and)e
+(Eu\014ndtRNA,)g(then)h(merges)g(them)g(in)m(to)g(one)g(list)e(of)i
+(non-)148 1967 y(redundan)m(t)d(\\candidate")i(tRNA)g(iden)m
+(ti\014cations.)289 2079 y(In)24 b(the)g(second)h(stage,)i(tRNAscan-SE)
+d(extracts)i(the)e(DNA)h(subsequences)f(iden)m(ti\014ed)e(as)i(p)s
+(ossible)148 2192 y(tRNAs)e(and)f(passes)g(only)f(these)i(segmen)m(ts)g
+(to)g(an)f(RNA)h(searc)m(h)g(program)f(in)f(the)h(Co)m(v)m(e)i(program)
+e(suite)148 2305 y(\(co)m(v)m(els\))27 b(for)e(analysis.)38
+b(Co)m(v)m(e)26 b(programs)f(lo)s(ok)g(for)g(tRNAs)g(in)f(a)i(v)m(ery)f
+(di\013eren)m(t)g(w)m(a)m(y)-8 b(.)40 b(A)25 b(probabilistic)148
+2418 y(mo)s(del)32 b(for)i(tRNA)f(has)h(b)s(een)e(dev)m(elop)s(ed)h(b)m
+(y)g(aligning)e(kno)m(wn)i(tRNAs)h(and)f(giving)f(a)i(base-sp)s
+(eci\014c)148 2531 y(probabilit)m(y)25 b(score)i(to)h(ev)m(ery)g(n)m
+(ucleotide)e(in)g(the)h(tRNA)h(mo)s(del.)38 b(Also,)28
+b(Co)m(v)m(e)g(uses)f(a)g(sp)s(ecial)f(metho)s(d)148
+2644 y(for)37 b(capturing)g(secondary)g(RNA)h(structure)f(information)e
+(using)h(a)i(t)m(yp)s(e)f(of)h(language)g(referred)e(to)148
+2757 y(as)30 b(a)g(sto)s(c)m(hastic)g(con)m(text-free)i(grammar)e
+(\(SCF)m(G\).)g(Co)m(v)m(e)h(applies)d(this)g(probabilistic)e(mo)s(del)
+j(to)h(the)148 2870 y(en)m(tire)f(windo)m(w)m(ed)e(sequence,)i(and)f
+(pro)s(duces)f(a)i(probabilit)m(y)d(score)j(that)g(the)g(sequence)f
+(matc)m(hes)i(the)148 2983 y(tRNA)35 b(mo)s(del.)50 b(If)33
+b(the)i(score)f(exceeds)h(20.0)g(bits,)f(the)g(tRNA)h(is)e(considered)g
+(a)h(true)g(tRNA)g(\(based)148 3096 y(on)d(empirical)d(studies)h(in)g
+(ref.)40 b(2\).)289 3209 y(In)24 b(the)g(\014nal)f(phase,)i
+(tRNAscan-SE)f(tak)m(es)i(those)e(tRNAs)h(con\014rmed)e(as)h(suc)m(h)g
+(and)f(runs)g(another)148 3321 y(Co)m(v)m(e)28 b(program)d(\(co)m(v)m
+(es\))k(that)e(displa)m(ys)d(RNA)i(secondary)g(structure.)39
+b(The)25 b(tRNA)i(t)m(yp)s(e)f(is)f(predicted)148 3434
+y(b)m(y)37 b(iden)m(tifying)d(the)j(an)m(tico)s(don)f(within)e(the)j
+(structure)f(output.)59 b(In)m(trons)37 b(are)g(also)f(automatically)
+148 3547 y(iden)m(ti\014ed)43 b(from)h(the)g(structure)g(output)g(as)g
+(runs)f(of)h(\014v)m(e)h(or)f(more)h(consecutiv)m(e)g(non-consensus)148
+3660 y(n)m(ucleotides)30 b(within)e(the)i(an)m(tico)s(don)h(lo)s(op.)
+289 3773 y(tRNAscan-SE)k(uses)e(heuristics)f(to)i(try)g(to)h
+(distinguish)30 b(pseudogenes)j(from)h(true)f(tRNAs,)i(pri-)148
+3886 y(marily)g(on)i(lac)m(k)g(of)g(tRNA-lik)m(e)g(secondary)f
+(structure.)60 b(A)36 b(second)h(tRNA)g(co)m(v)-5 b(ariance)38
+b(mo)s(del)e(w)m(as)148 3999 y(created)j(from)f(the)g(original)e
+(1415-tRNA)41 b(alignmen)m(t,)e(under)d(the)j(constrain)m(t)f(that)g
+(no)g(secondary)148 4112 y(structure)c(is)f(conserv)m(ed)h(\(this)g(mo)
+s(del)f(is)g(e\013ectiv)m(ely)i(just)e(a)h(sequence)h(pro\014le,)f(or)g
+(hidden)d(Mark)m(o)m(v)148 4225 y(mo)s(del\).)38 b(By)24
+b(subtracting)g(a)g(tRNA's)h(similarit)m(y)c(score)k(to)f(the)h
+(primary)d(structure-only)h(mo)s(del)g(from)148 4338
+y(that)39 b(using)d(the)i(complete)h(tRNA)f(mo)s(del,)h(a)f(secondary)g
+(structure-only)f(score)h(is)f(obtained.)63 b(W)-8 b(e)148
+4451 y(ha)m(v)m(e)41 b(observ)m(ed)e(that)g(tRNAs)h(with)e(lo)m(w)g
+(scores)i(for)f(either)f(comp)s(onen)m(t)i(of)f(the)g(total)h(score)g
+(w)m(ere)148 4563 y(often)e(pseudogenes.)61 b(Th)m(us,)38
+b(tRNAs)f(are)h(mark)m(ed)f(as)h(lik)m(ely)d(pseudogenes)i(if)f(they)i
+(ha)m(v)m(e)g(either)f(a)148 4676 y(score)30 b(of)f(less)g(than)g(10)h
+(bits)e(for)h(the)g(primary)f(sequence)h(comp)s(onen)m(t)h(of)f(the)g
+(total)h(score,)h(or)e(a)g(score)148 4789 y(of)f(less)g(than)f(5)i
+(bits)e(for)g(the)i(secondary)f(structure)f(comp)s(onen)m(t)h(of)g(the)
+h(total)f(score.)41 b(Seleno)s(cysteine)148 4902 y(tRNAs)24
+b(are)g(not)g(c)m(hec)m(k)m(ed)i(b)m(y)e(these)g(rules)e(since)h(they)h
+(ha)m(v)m(e)h(at)m(ypical)e(primary)f(and)h(secondary)h(struc-)148
+5015 y(ture.)39 b(Also,)25 b(use)g(of)f(the)h(-O)f(option)g(\(searc)m
+(h)i(for)e(organellar)g(tRNAs\))h(disables)e(pseudogene)h(c)m(hec)m
+(king)148 5128 y(since)30 b(these)h(criteria)f(are)g(geared)i(to)m(w)m
+(ards)f(detecting)g(cytoplasmic)f(pseudogenes)g(\(some)h(true)f(non-)
+148 5241 y(euk)-5 b(ary)m(otic)29 b(tRNA)f(are)h(mark)m(ed)f(as)g
+(pseudogenes)f(b)m(y)h(this)f(analysis\).)39 b(Final)26
+b(tRNA)j(predictions)d(are)1920 5525 y(4)p eop
%%Page: 5 5
-TeXDict begin 5 4 bop 148 273 a Fj(then)30 b(sa)m(v)m(ed)i(in)e
-(tabular,)h(A)m(CeDB,)h(or)e(secondary)h(structure)e(output)h(format.)
-289 386 y(F)-8 b(or)39 b(more)e(details)i(on)e(the)h(program)f
-(algorithm)i(&)e(implemen)m(tation,)k(see)d(the)g(Nucleic)h(Acids)148
+5 4 bop 148 273 a Fj(then)30 b(sa)m(v)m(ed)i(in)d(tabular,)h(A)m(CeDB,)
+i(or)e(secondary)h(structure)e(output)h(format.)289 386
+y(F)-8 b(or)39 b(more)e(details)g(on)g(the)h(program)f(algorithm)g(&)g
+(implemen)m(tation,)h(see)g(the)g(Nucleic)f(Acids)148
499 y(Researc)m(h)32 b(pap)s(er)d(\(Lo)m(w)m(e)j(&)e(Eddy)-8
b(,)30 b(1997\).)148 785 y Fl(3)135 b(P)l(erformance)46
b(/)f(Requiremen)l(ts)148 988 y Fj(P)m(erformance)33
-b(will)f(ob)m(viously)g(v)-5 b(ary)31 b(dep)s(ending)g(on)g(the)h(mac)m
-(hine)g(arc)m(hitecture,)i(memory)-8 b(,)33 b(and)e(OS)148
-1101 y(e\016ciency)-8 b(.)73 b(The)40 b(examples)i(included)e(in)g
-(this)g(do)s(cumen)m(t)h(w)m(ere)g(run)e(on)i(a)g(Silicon)g(Graphics)f
-(In-)148 1214 y(digo2)i(R4400-200)j(running)39 b(IRIX)i(5.3,)k(with)c
-(o)m(v)m(er)h(32Mb)g(of)f(memory)-8 b(.)73 b(tRNAscan-SE)42
-b(runs)d(at)148 1327 y(appro)m(ximately)32 b(20,000)h(to)e(45,000)i
-(bp/sec)d(in)g(its)h(default)g(op)s(eration)f(mo)s(de)g(on)h(this)f
+b(will)c(ob)m(viously)h(v)-5 b(ary)31 b(dep)s(ending)f(on)h(the)h(mac)m
+(hine)f(arc)m(hitecture,)i(memory)-8 b(,)33 b(and)e(OS)148
+1101 y(e\016ciency)-8 b(.)72 b(The)40 b(examples)h(included)d(in)h
+(this)g(do)s(cumen)m(t)i(w)m(ere)g(run)e(on)i(a)g(Silicon)d(Graphics)h
+(In-)148 1214 y(digo2)i(R4400-200)k(running)38 b(IRIX)j(5.3,)k(with)40
+b(o)m(v)m(er)i(32Mb)g(of)f(memory)-8 b(.)73 b(tRNAscan-SE)42
+b(runs)d(at)148 1327 y(appro)m(ximately)30 b(20,000)j(to)e(45,000)i
+(bp/sec)d(in)f(its)h(default)g(op)s(eration)f(mo)s(de)h(on)h(this)e
(mac)m(hine.)148 1613 y Fl(4)135 b(Default)46 b(Program)g(Op)t(eration)
-148 1819 y Fi(4.1)113 b(In)m(v)m(oking)38 b(tRNAscan-SE)148
-1991 y Fj(The)31 b(program)h(is)f(in)m(v)m(ok)m(ed)i(b)m(y)e(giving)i
-(it)f(a)g(series)g(of)f(optional)i(command)e(line)h(parameters,)g(then)
-g(a)148 2104 y(list)27 b(of)f(one)g(or)g(more)g(sequence)g(\014les)g
-(written)g(in)f(the)h(F)-10 b(AST)i(A)26 b(format)h(\(see)f(app)s
-(endix)f(A)h(for)f(example)148 2217 y(of)31 b(F)-10 b(AST)i(A)30
+148 1819 y Fi(4.1)113 b(In)m(v)m(oking)37 b(tRNAscan-SE)148
+1991 y Fj(The)31 b(program)h(is)e(in)m(v)m(ok)m(ed)i(b)m(y)f(giving)g
+(it)g(a)h(series)f(of)g(optional)g(command)g(line)f(parameters,)i(then)
+g(a)148 2104 y(list)25 b(of)h(one)g(or)g(more)g(sequence)g(\014les)f
+(written)g(in)f(the)i(F)-10 b(AST)i(A)26 b(format)h(\(see)f(app)s
+(endix)e(A)i(for)f(example)148 2217 y(of)31 b(F)-10 b(AST)i(A)30
b(format\):)337 2443 y Fd(tRNAscan-SE)45 b([-options])g(FASTA)p
-1681 2443 29 4 v 33 w(file\(s\))289 2669 y Fj(By)40 b(default,)h(the)e
-(header)g(credits)h(and)e(selected)i(command-line)g(options)f(are)h
-(prin)m(ted)e(to)i(the)148 2781 y(screen)45 b(via)h(standard)e(error,)
-49 b(follo)m(w)m(ed)e(b)m(y)e(the)g(\014nal)g(results)f(of)i(the)f
-(tRNA)g(searc)m(h)h(written)f(to)148 2894 y(standard)36
-b(output)g(in)g(a)h(tabular)f(format)h(\(see)h(b)s(elo)m(w\).)59
-b(By)37 b(default,)h(tRNAscan-SE)f(searc)m(hes)g(for)148
-3007 y(euk)-5 b(ary)m(otic)36 b(cytoplasmic)f(tRNAs.)52
-b(T)-8 b(o)35 b(searc)m(h)f(for)g(prok)-5 b(ary)m(otic,)36
-b(arc)m(haeal,)h(or)d(organellar)h(tRNAs,)148 3120 y(use)e(searc)m(h)h
-(mo)s(de)f(options)h(-P)-8 b(,)34 b(-A,)g(-O,)g(rep)s(ectiv)m(ely)-8
-b(.)51 b(If)33 b(the)h(sequences)f(are)h(from)f(more)h(than)f(one)148
-3233 y(ph)m(ylogenetic)f(domain,)e(the)f(general)i(tRNA)f(mo)s(del)f
-(\(option)i(-G\))f(ma)m(y)g(b)s(e)f(used)g(with)g(minimal)h(loss)148
-3346 y(of)43 b(sensitivit)m(y)h(and)e(selectivit)m(y)j(\(the)e
-(publication)g(describing)f(tRNAscan-SE)h(used)e(the)i(general)148
-3459 y(tRNA)31 b(mo)s(del)f(exclusiv)m(ely)-8 b(,)33
+1681 2443 29 4 v 33 w(file\(s\))289 2669 y Fj(By)40 b(default,)g(the)f
+(header)g(credits)g(and)f(selected)h(command-line)f(options)g(are)i
+(prin)m(ted)d(to)j(the)148 2781 y(screen)45 b(via)g(standard)f(error,)
+49 b(follo)m(w)m(ed)c(b)m(y)g(the)g(\014nal)f(results)f(of)j(the)f
+(tRNA)g(searc)m(h)h(written)e(to)148 2894 y(standard)36
+b(output)g(in)f(a)i(tabular)e(format)i(\(see)h(b)s(elo)m(w\).)58
+b(By)37 b(default,)g(tRNAscan-SE)g(searc)m(hes)g(for)148
+3007 y(euk)-5 b(ary)m(otic)35 b(cytoplasmic)e(tRNAs.)52
+b(T)-8 b(o)35 b(searc)m(h)f(for)g(prok)-5 b(ary)m(otic,)35
+b(arc)m(haeal,)h(or)e(organellar)f(tRNAs,)148 3120 y(use)g(searc)m(h)h
+(mo)s(de)f(options)g(-P)-8 b(,)34 b(-A,)g(-O,)g(rep)s(ectiv)m(ely)-8
+b(.)49 b(If)33 b(the)h(sequences)f(are)h(from)f(more)h(than)f(one)148
+3233 y(ph)m(ylogenetic)d(domain,)f(the)g(general)h(tRNA)g(mo)s(del)e
+(\(option)i(-G\))g(ma)m(y)g(b)s(e)f(used)g(with)f(minimal)f(loss)148
+3346 y(of)43 b(sensitivit)m(y)e(and)h(selectivit)m(y)g(\(the)h
+(publication)d(describing)g(tRNAscan-SE)j(used)e(the)i(general)148
+3459 y(tRNA)31 b(mo)s(del)e(exclusiv)m(ely)-8 b(,)30
b(ref.)41 b(4\).)148 3658 y Fc(Sequence)694 b(tRNA)42
b(Bounds)216 b(tRNA)172 b(Anti)h(Intron)41 b(Bounds)129
b(Cove)148 3758 y(Name)522 b(tRNA)42 b(#)86 b(Begin)129
@@ -3712,181 +2203,180 @@ b(2)304 b(19480)129 b(19561)g(Ser)216 b(AGA)h(0)305 b(0)g(80.44)148
b(GAA)h(0)305 b(0)g(80.32)148 4256 y(CELF22B7)346 b(4)304
b(26992)129 b(26920)g(Phe)216 b(GAA)h(0)305 b(0)g(80.32)148
4356 y(CELF22B7)346 b(5)304 b(23765)129 b(23694)g(Pro)216
-b(CGG)h(0)305 b(0)g(75.76)289 4568 y Fj(Eac)m(h)42 b(new)f(tRNA)g(in)g
-(a)h(sequence)f(is)g(consecutiv)m(ely)i(n)m(um)m(b)s(ered)d(in)h(the)g
-('tRNA)h(#')f(column.)148 4681 y('tRNA)33 b(Bounds')f(sp)s(ecify)g(the)
-g(starting)h(\(5'\))h(and)e(ending)f(\(3'\))j(n)m(ucleotide)g(b)s
-(ounds)c(for)i(the)g(tRNA.)148 4794 y(tRNAs)j(found)d(on)i(the)g(rev)m
-(erse)h(\(lo)m(w)m(er\))h(strand)d(are)i(indicated)f(b)m(y)g(ha)m(ving)
-h(the)f(Begin)h(\(5'\))g(b)s(ound)148 4907 y(greater)d(than)e(the)h
-(End)e(\(3'\))i(b)s(ound)e(\(see)i(tRNAs)g(#4)f(&)g(#5)h(in)f(output)g
-(ab)s(o)m(v)m(e\).)289 5020 y(The)40 b('tRNA)h(T)m(yp)s(e')f(is)g(the)g
-(predicted)g(amino)g(acid)h(c)m(harged)f(to)h(the)f(tRNA)h(molecule)g
-(based)148 5133 y(on)k(the)f(predicted)g('An)m(tico)s(don')i(\(written)
-f(5')g Fh(!)f Fj(3'\))h(displa)m(y)m(ed)g(in)f(the)h(next)f(column.)83
-b(tRNAs)148 5246 y(that)33 b(\014t)e(criteria)i(for)e(p)s(oten)m(tial)j
-(pseudogenes)d(\(p)s(o)s(or)g(primary)g(or)g(secondary)h(structure,)g
-(discussed)1920 5525 y(5)p eop end
+b(CGG)h(0)305 b(0)g(75.76)289 4568 y Fj(Eac)m(h)42 b(new)f(tRNA)g(in)f
+(a)i(sequence)f(is)f(consecutiv)m(ely)h(n)m(um)m(b)s(ered)f(in)g(the)h
+('tRNA)h(#')f(column.)148 4681 y('tRNA)33 b(Bounds')f(sp)s(ecify)f(the)
+h(starting)g(\(5'\))i(and)e(ending)e(\(3'\))k(n)m(ucleotide)e(b)s
+(ounds)e(for)i(the)g(tRNA.)148 4794 y(tRNAs)j(found)d(on)i(the)g(rev)m
+(erse)h(\(lo)m(w)m(er\))g(strand)e(are)i(indicated)d(b)m(y)i(ha)m(ving)
+g(the)g(Begin)g(\(5'\))h(b)s(ound)148 4907 y(greater)d(than)e(the)h
+(End)e(\(3'\))i(b)s(ound)e(\(see)i(tRNAs)g(#4)f(&)g(#5)h(in)e(output)h
+(ab)s(o)m(v)m(e\).)289 5020 y(The)40 b('tRNA)h(T)m(yp)s(e')f(is)f(the)h
+(predicted)f(amino)g(acid)h(c)m(harged)g(to)h(the)f(tRNA)h(molecule)e
+(based)148 5133 y(on)45 b(the)f(predicted)f('An)m(tico)s(don')i
+(\(written)f(5')h Fh(!)f Fj(3'\))h(displa)m(y)m(ed)e(in)g(the)i(next)f
+(column.)82 b(tRNAs)148 5246 y(that)33 b(\014t)e(criteria)g(for)g(p)s
+(oten)m(tial)h(pseudogenes)f(\(p)s(o)s(or)g(primary)f(or)h(secondary)h
+(structure,)g(discussed)1920 5525 y(5)p eop
%%Page: 6 6
-TeXDict begin 6 5 bop 148 273 a Fj(in)41 b(Metho)s(ds\),)j(will)e(b)s
-(e)e(mark)m(ed)i(with)e(\\Pseudo")i(in)f(the)g('tRNA)h(T)m(yp)s(e')f
-(column.)73 b(If)40 b(there)i(is)f(a)148 386 y(predicted)e(in)m(tron)h
-(in)e(the)i(tRNA,)g(the)f(next)g(t)m(w)m(o)i(columns)e(indicate)h(the)f
-(n)m(ucleotide)i(b)s(ounds.)65 b(If)148 499 y(there)45
-b(is)f(no)g(predicted)f(in)m(tron,)48 b(b)s(oth)c(of)g(these)g(columns)
-g(con)m(tain)h(zero.)83 b(The)43 b(\014nal)h(column)g(is)148
-612 y(the)35 b(Co)m(v)m(e)h(score)f(for)f(the)h(tRNA)g(in)f(bits.)52
-b(Note)36 b(that)f(this)g(score)g(will)f(v)-5 b(ary)35
-b(somewhat)g(dep)s(ending)148 724 y(on)41 b(the)f(particular)h(tRNA)f
-(co)m(v)-5 b(ariance)43 b(mo)s(del)d(used)g(in)g(the)g(analysis)h
-(\(the)g(searc)m(h)g(mo)s(de)f(selects)148 837 y(whic)m(h)28
-b(tRNA)g(co)m(v)-5 b(ariance)30 b(mo)s(del)e(will)g(b)s(e)f(used:)38
-b(euk)-5 b(ary)m(ote-sp)s(eci\014c,)31 b(prok)-5 b(ary)m(ote-sp)s
-(eci\014c,)30 b(arc)m(hae-)148 950 y(sp)s(eci\014c,)g(or)f(general\).)
-42 b(tRNAscan-SE)30 b(coun)m(ts)f(an)m(y)h(sequence)g(that)g(attains)g
-(a)g(score)g(of)f Fh(\025)g Fj(20.0)i(bits)148 1063 y(as)g(a)g(tRNA)g
-(\(based)f(on)g(empirical)h(studies)g(conducted)f(b)m(y)g(Eddy)f(&)h
-(Durbin)f(in)h(ref)h(#2\).)148 1307 y Fi(4.2)113 b(T)-9
-b(emp)s(orary)38 b(\014les)148 1478 y Fj(In)27 b(the)h(course)f(of)h
-(program)f(execution,)i(sev)m(eral)g(temp)s(orary)e(\014les)g(are)h
-(written)f(to)i(and)d(deleted)j(from)148 1591 y(the)23
-b(`TEMPDIR')g(directory)f(sp)s(eci\014ed)g(in)g(the)h(Mak)m(e\014le)h
-(on)e(installing)i(the)e(program.)38 b(Alternativ)m(ely)-8
-b(,)148 1704 y(the)26 b(en)m(vironmen)m(t)g(v)-5 b(ariable)27
-b(`TMPDIR')f(can)g(b)s(e)f(set)h(to)h(another)f(directory)g(whic)m(h)f
-(will)h(o)m(v)m(erride)h(the)148 1817 y(temp)s(orary)j(directory)h(sp)s
-(eci\014ed)f(in)g(the)g(Mak)m(e\014le.)289 1930 y(F)-8
-b(or)32 b(the)g(a)m(v)m(erage)h(user,)e(/tmp)g(should)f(w)m(ork)i
-(\014ne)e(as)i(the)f(temp)g(\014le)g(directory)-8 b(.)44
+6 5 bop 148 273 a Fj(in)40 b(Metho)s(ds\),)k(will)39
+b(b)s(e)h(mark)m(ed)i(with)d(\\Pseudo")j(in)e(the)h('tRNA)h(T)m(yp)s
+(e')f(column.)72 b(If)40 b(there)i(is)e(a)148 386 y(predicted)e(in)m
+(tron)h(in)e(the)j(tRNA,)g(the)f(next)g(t)m(w)m(o)i(columns)d(indicate)
+g(the)h(n)m(ucleotide)g(b)s(ounds.)65 b(If)148 499 y(there)45
+b(is)e(no)h(predicted)e(in)m(tron,)47 b(b)s(oth)d(of)g(these)g(columns)
+f(con)m(tain)h(zero.)83 b(The)43 b(\014nal)g(column)g(is)148
+612 y(the)35 b(Co)m(v)m(e)h(score)f(for)f(the)h(tRNA)g(in)e(bits.)51
+b(Note)36 b(that)f(this)f(score)h(will)c(v)-5 b(ary)35
+b(somewhat)g(dep)s(ending)148 724 y(on)41 b(the)f(particular)f(tRNA)h
+(co)m(v)-5 b(ariance)42 b(mo)s(del)d(used)h(in)f(the)h(analysis)f
+(\(the)i(searc)m(h)g(mo)s(de)f(selects)148 837 y(whic)m(h)27
+b(tRNA)h(co)m(v)-5 b(ariance)29 b(mo)s(del)e(will)e(b)s(e)i(used:)38
+b(euk)-5 b(ary)m(ote-sp)s(eci\014c,)30 b(prok)-5 b(ary)m(ote-sp)s
+(eci\014c,)29 b(arc)m(hae-)148 950 y(sp)s(eci\014c,)g(or)g(general\).)
+41 b(tRNAscan-SE)30 b(coun)m(ts)f(an)m(y)h(sequence)g(that)g(attains)f
+(a)h(score)g(of)f Fh(\025)g Fj(20.0)i(bits)148 1063 y(as)g(a)g(tRNA)g
+(\(based)f(on)g(empirical)e(studies)i(conducted)g(b)m(y)g(Eddy)f(&)h
+(Durbin)e(in)h(ref)i(#2\).)148 1307 y Fi(4.2)113 b(T)-9
+b(emp)s(orary)37 b(\014les)148 1478 y Fj(In)27 b(the)h(course)f(of)h
+(program)f(execution,)h(sev)m(eral)g(temp)s(orary)f(\014les)f(are)i
+(written)e(to)j(and)d(deleted)i(from)148 1591 y(the)23
+b(`TEMPDIR')g(directory)e(sp)s(eci\014ed)g(in)g(the)i(Mak)m(e\014le)g
+(on)f(installing)e(the)i(program.)38 b(Alternativ)m(ely)-8
+b(,)148 1704 y(the)26 b(en)m(vironmen)m(t)f(v)-5 b(ariable)25
+b(`TMPDIR')h(can)g(b)s(e)f(set)h(to)h(another)f(directory)f(whic)m(h)f
+(will)f(o)m(v)m(erride)j(the)148 1817 y(temp)s(orary)k(directory)g(sp)s
+(eci\014ed)f(in)g(the)h(Mak)m(e\014le.)289 1930 y(F)-8
+b(or)32 b(the)g(a)m(v)m(erage)h(user,)e(/tmp)g(should)e(w)m(ork)j
+(\014ne)e(as)i(the)f(temp)g(\014le)f(directory)-8 b(.)43
b(F)-8 b(or)32 b(sequencing)148 2043 y(cen)m(ters)e(or)f(users)g
-(scanning)g(v)m(ery)g(large)h(individual)f(sequences)g(\()p
+(scanning)f(v)m(ery)h(large)g(individual)c(sequences)k(\()p
Fh(\025)g Fj(1MBp\),)i(or)e(man)m(y)g(sequences)g(at)148
-2156 y(once)37 b(\()p Fh(\025)f Fj(4)h(instances)f(of)h(tRNAscan-SE)f
-(at)h(once\),)i(it)e(migh)m(t)g(b)s(e)e(advisable)i(to)g(use)e
-(/usr/tmp)h(or)148 2269 y(some)31 b(other)g(temp)s(orary)f(directory)h
-(that)g(has)f(su\016cien)m(t)g(free)h(disk)f(space)h(\(at)g(least)h
-(10MB)g(free\).)289 2382 y Fg(Note:)42 b Fj(If)20 b(m)m(ultiple)i(F)-10
-b(AST)i(A)22 b(\014les)f(are)h(sp)s(eci\014ed)f(on)g(the)g(command)g
-(line,)j(tRNAscan-SE)e(creates)h(a)148 2494 y(temp)s(orary)i(\014le)h
-Fd(tscan)p Fb(process-id-number)p Fd(.)o(mseq)19 b Fj(in)25
-b(whic)m(h)g(all)h(sequence)g(\014les)f(are)h(concatenated)148
-2607 y(together)j(for)e(ease)h(of)g(pro)s(cessing.)39
-b(Because)29 b(of)e(this,)h(the)f(temp)s(orary)g(directory)h(m)m(ust)f
-(ha)m(v)m(e)h(enough)148 2720 y(ro)s(om)h(to)g(temp)s(orarily)g(sa)m(v)
-m(e)h(a)f(cop)m(y)g(of)g(all)h(the)f(sequence)g(\014les)f(\(at)i
+2156 y(once)37 b(\()p Fh(\025)f Fj(4)h(instances)e(of)i(tRNAscan-SE)f
+(at)h(once\),)i(it)d(migh)m(t)g(b)s(e)f(advisable)g(to)i(use)e
+(/usr/tmp)h(or)148 2269 y(some)31 b(other)g(temp)s(orary)f(directory)g
+(that)h(has)f(su\016cien)m(t)f(free)i(disk)e(space)i(\(at)g(least)g
+(10MB)h(free\).)289 2382 y Fg(Note:)42 b Fj(If)20 b(m)m(ultiple)f(F)-10
+b(AST)i(A)22 b(\014les)e(are)i(sp)s(eci\014ed)e(on)h(the)g(command)g
+(line,)h(tRNAscan-SE)g(creates)h(a)148 2494 y(temp)s(orary)i(\014le)g
+Fd(tscan)p Fb(process-id-number)p Fd(.)o(mseq)19 b Fj(in)24
+b(whic)m(h)g(all)g(sequence)i(\014les)e(are)i(concatenated)148
+2607 y(together)j(for)e(ease)h(of)g(pro)s(cessing.)38
+b(Because)29 b(of)e(this,)g(the)g(temp)s(orary)g(directory)g(m)m(ust)g
+(ha)m(v)m(e)h(enough)148 2720 y(ro)s(om)h(to)g(temp)s(orarily)e(sa)m(v)
+m(e)j(a)f(cop)m(y)g(of)g(all)f(the)h(sequence)g(\014les)e(\(at)j
(once\))g(that)f(ha)m(v)m(e)h(b)s(een)e(sp)s(eci\014ed)148
-2833 y(on)38 b(the)f(command)g(line)h(|)f(this)g(ma)m(y)h(b)s(e)f(a)g
-(problem)g(for)g(\\p)s(o)m(w)m(er)h(users")f(who)g(ma)m(y)h(conceiv)-5
-b(ably)148 2946 y(scan)25 b(an)g(en)m(tire)h(directory)f(of)g(cosmids)g
-(totalling)i(man)m(y)e(MBp)g(of)g(sequence.)39 b(In)24
-b(these)i(cases,)h(I)d(w)m(ould)148 3059 y(advise)h(the)f(user)g(to)h
-(either)g(run)d(a)j(smaller)g(set)f(of)h(sequences)f(at)h(once,)i(or)d
-(mak)m(e)h(sure)f(the)g(TEMPDIR)148 3172 y(can)31 b(handle)f(the)g
-(large)i('.mseq')f(temp)s(orary)f(\014le.)1920 5525 y(6)p
-eop end
+2833 y(on)38 b(the)f(command)g(line)f(|)h(this)f(ma)m(y)i(b)s(e)f(a)g
+(problem)f(for)h(\\p)s(o)m(w)m(er)h(users")f(who)g(ma)m(y)h(conceiv)-5
+b(ably)148 2946 y(scan)25 b(an)g(en)m(tire)g(directory)f(of)h(cosmids)f
+(totalling)g(man)m(y)h(MBp)g(of)g(sequence.)39 b(In)24
+b(these)i(cases,)h(I)d(w)m(ould)148 3059 y(advise)g(the)g(user)g(to)h
+(either)f(run)e(a)j(smaller)e(set)h(of)h(sequences)f(at)h(once,)i(or)d
+(mak)m(e)h(sure)f(the)g(TEMPDIR)148 3172 y(can)31 b(handle)e(the)h
+(large)h('.mseq')g(temp)s(orary)f(\014le.)1920 5525 y(6)p
+eop
%%Page: 7 7
-TeXDict begin 7 6 bop 148 273 a Fl(5)135 b(Command-line)46
-b(Options)148 479 y Fi(5.1)113 b(Searc)m(h)38 b(Mo)s(de)g(Options)148
-651 y Fj(By)33 b(default,)h(the)f(euk)-5 b(ary)m(otic)34
-b(tRNA)f(mo)s(del)g(is)f(used)g(for)g(tRNA)i(analysis.)48
-b(T)-8 b(o)33 b(select)h(an)e(alternate)148 764 y(tRNA)37
-b(mo)s(del)f(for)g(sequences)g(from)g(other)g(sources)g(\(other)h(ph)m
-(ylogenetic)h(domains)e(or)g(mito)s(c)m(hon-)148 877
-y(dria/c)m(hloroplasts\),)d(use)d(one)h(of)f(the)h(follo)m(wing)h
-(options:)235 1083 y(-B)47 b(:)40 b(searc)m(h)31 b(for)f(bacterial)i
-(tRNAs)376 1232 y(This)e(option)h(selects)i(the)e(bacterial)h(co)m(v)-5
-b(ariace)34 b(mo)s(del)d(for)g(tRNA)g(analysis,)h(and)f(lo)s(osens)g
-(the)376 1345 y(searc)m(h)i(parameters)f(for)g(Eu\014ndtRNA)f(to)i
-(impro)m(v)m(e)h(detection)f(of)g(bacterial)h(tRNAs.)47
-b(Use)33 b(of)376 1458 y(this)d(mo)s(de)f(with)h(bacterial)i(sequences)
-e(will)h(also)g(impro)m(v)m(e)g(b)s(ounds)d(prediction)i(of)h(the)f(3')
-h(end)376 1571 y(\(the)g(terminal)f(CAA)h(triplet\).)232
-1756 y(-A)46 b(:)40 b(searc)m(h)31 b(for)f(arc)m(haeal)j(tRNAs)376
-1905 y(This)g(option)h(selects)h(an)f(arc)m(haeal-sp)s(eci\014c)h(co)m
-(v)-5 b(ariance)36 b(mo)s(del)e(for)f(tRNA)i(analysis,)g(as)f(w)m(ell)
-376 2018 y(as)c(sligh)m(tly)i(lo)s(osening)f(the)f(Eu\014ndtRNA)f
+7 6 bop 148 273 a Fl(5)135 b(Command-line)46 b(Options)148
+479 y Fi(5.1)113 b(Searc)m(h)38 b(Mo)s(de)g(Options)148
+651 y Fj(By)33 b(default,)g(the)g(euk)-5 b(ary)m(otic)33
+b(tRNA)g(mo)s(del)f(is)f(used)h(for)g(tRNA)i(analysis.)46
+b(T)-8 b(o)33 b(select)g(an)f(alternate)148 764 y(tRNA)37
+b(mo)s(del)e(for)h(sequences)g(from)g(other)g(sources)g(\(other)h(ph)m
+(ylogenetic)f(domains)f(or)h(mito)s(c)m(hon-)148 877
+y(dria/c)m(hloroplasts\),)30 b(use)g(one)h(of)f(the)h(follo)m(wing)e
+(options:)235 1083 y(-B)47 b(:)40 b(searc)m(h)31 b(for)f(bacterial)g
+(tRNAs)376 1232 y(This)f(option)h(selects)i(the)f(bacterial)f(co)m(v)-5
+b(ariace)33 b(mo)s(del)d(for)h(tRNA)g(analysis,)f(and)h(lo)s(osens)f
+(the)376 1345 y(searc)m(h)j(parameters)f(for)g(Eu\014ndtRNA)f(to)i
+(impro)m(v)m(e)g(detection)f(of)h(bacterial)f(tRNAs.)47
+b(Use)33 b(of)376 1458 y(this)c(mo)s(de)g(with)g(bacterial)h(sequences)
+g(will)e(also)i(impro)m(v)m(e)g(b)s(ounds)e(prediction)g(of)j(the)f(3')
+h(end)376 1571 y(\(the)g(terminal)d(CAA)j(triplet\).)232
+1756 y(-A)46 b(:)40 b(searc)m(h)31 b(for)f(arc)m(haeal)i(tRNAs)376
+1905 y(This)g(option)h(selects)h(an)g(arc)m(haeal-sp)s(eci\014c)f(co)m
+(v)-5 b(ariance)35 b(mo)s(del)e(for)g(tRNA)i(analysis,)e(as)h(w)m(ell)
+376 2018 y(as)c(sligh)m(tly)f(lo)s(osening)g(the)h(Eu\014ndtRNA)f
(searc)m(h)i(cuto\013s.)229 2204 y(-O)46 b(:)40 b(searc)m(h)31
-b(for)f(organellar)i(\(mito)s(c)m(hondrial/c)m(hloroplast\))i(tRNAs)376
-2353 y(This)j(parameter)h(b)m(ypasses)g(the)g(fast)g(\014rst-pass)f
-(scanners)g(that)i(are)f(p)s(o)s(or)f(at)h(detecting)i(or-)376
-2466 y(ganellar)30 b(tRNAs)g(and)e(runs)g(Co)m(v)m(e)i(analysis)g(only)
--8 b(.)41 b(Since)29 b(true)g(organellar)i(tRNAs)e(ha)m(v)m(e)i(b)s
+b(for)f(organellar)g(\(mito)s(c)m(hondrial/c)m(hloroplast\))f(tRNAs)376
+2353 y(This)36 b(parameter)i(b)m(ypasses)g(the)g(fast)g(\014rst-pass)f
+(scanners)g(that)i(are)f(p)s(o)s(or)f(at)h(detecting)h(or-)376
+2466 y(ganellar)28 b(tRNAs)i(and)e(runs)g(Co)m(v)m(e)i(analysis)e(only)
+-8 b(.)40 b(Since)28 b(true)h(organellar)g(tRNAs)g(ha)m(v)m(e)i(b)s
(een)376 2579 y(found)g(to)i(ha)m(v)m(e)h(Co)m(v)m(e)g(scores)f(b)s(et)
-m(w)m(een)g(15)g(and)f(20)h(bits,)g(the)g(searc)m(h)g(cuto\013)g(is)g
-(lo)m(w)m(ered)h(from)376 2692 y(20)41 b(to)f(15)h(bits.)70
-b(Also,)44 b(pseudogene)c(c)m(hec)m(king)i(is)e(disabled)g(since)g(it)h
-(is)f(only)g(applicable)h(to)376 2804 y(euk)-5 b(ary)m(otic)36
-b(cytoplasmic)h(tRNA)f(pseudogenes.)55 b(Since)35 b(Co)m(v)m(e-only)i
-(mo)s(de)d(is)h(used,)h(searc)m(hes)376 2917 y(will)30
-b(b)s(e)g(v)m(ery)h(slo)m(w)g(\(see)g(-C)f(option)h(b)s(elo)m(w\))g
-(relativ)m(e)i(to)e(the)f(default)h(mo)s(de.)228 3103
-y(-G)47 b(:)40 b(use)30 b(general)i(tRNA)f(mo)s(del)376
-3252 y(This)h(option)i(selects)h(the)f(original)h(tRNA)f(co)m(v)-5
-b(ariance)35 b(mo)s(del)f(that)g(w)m(as)g(trained)f(on)h(tRNAs)376
-3365 y(from)22 b(all)i(three)f(ph)m(ylogenetic)h(domains)f(\(arc)m
-(haea,)j(bacteria,)g(&)d(euk)-5 b(ary)m(a\).)39 b(This)22
-b(mo)s(de)h(can)g(b)s(e)376 3478 y(used)g(when)g(analyzing)j(a)f(mixed)
-f(collection)j(of)d(sequences)h(from)f(more)g(than)h(one)f(ph)m
-(ylogenetic)376 3591 y(domain,)36 b(with)e(only)h(sligh)m(t)h(loss)g
-(of)f(sensitivit)m(y)h(and)e(selectivit)m(y)-8 b(.)58
-b(The)35 b(original)h(publication)376 3704 y(describing)27
-b(this)g(program)g(and)g(tRNAscan-SE)h(v)m(ersion)g(1.0)g(used)f(this)g
-(general)h(tRNA)g(mo)s(del)376 3817 y(exclusiv)m(ely)-8
-b(.)42 b(If)29 b(y)m(ou)h(wish)f(to)i(compare)f(scores)g(to)h(those)f
-(found)e(in)i(the)g(pap)s(er)e(or)i(scans)g(using)376
-3930 y(v1.0,)42 b(use)c(this)g(option.)66 b(Use)39 b(of)g(this)f
-(option)h(is)g(compatible)h(with)e(all)h(other)g(searc)m(h)g(mo)s(de)
-376 4042 y(options)30 b(describ)s(ed)g(in)g(this)g(section.)234
-4228 y(-C)46 b(:)40 b(searc)m(h)31 b(using)f(Co)m(v)m(e)i(analysis)f
-(only)376 4377 y(Directs)42 b(tRNAscan-SE)f(to)g(analyze)h(sequences)f
-(using)f(Co)m(v)m(e)i(analysis)g(only)-8 b(.)72 b(This)40
-b(option)376 4490 y(allo)m(ws)30 b(a)g(sligh)m(tly)h(more)e(sensitiv)m
-(e)i(searc)m(h)f(than)f(the)h(default)f(tRNAscan)h(+)f(Eu\014ndtRNA)f
-Fh(\))376 4603 y Fj(Co)m(v)m(e)35 b(mo)s(de,)f(but)f(is)h(m)m(uc)m(h)g
-(slo)m(w)m(er)h(\(b)m(y)f(appro)m(x.)50 b(250)36 b(to)e(3,000)i
-(fold\).)51 b(Output)33 b(format)h(and)376 4716 y(other)c(program)g
-(defaults)h(are)g(otherwise)f(iden)m(tical)j(to)e(the)f(normal)h
-(analysis.)232 4901 y(-H)46 b(:)53 b(sho)m(w)37 b(b)s(oth)f(primary)g
-(&)g(secondary)h(structure)f(score)i(comp)s(onen)m(ts)f(to)g(co)m(v)-5
-b(ariance)39 b(mo)s(del)376 5014 y(bit)30 b(scores)376
-5163 y(This)21 b(option)i(displa)m(ys)g(the)f(breakdo)m(wn)g(of)h(the)f
+m(w)m(een)g(15)g(and)f(20)h(bits,)f(the)h(searc)m(h)g(cuto\013)g(is)f
+(lo)m(w)m(ered)h(from)376 2692 y(20)41 b(to)f(15)h(bits.)69
+b(Also,)43 b(pseudogene)d(c)m(hec)m(king)h(is)e(disabled)f(since)h(it)h
+(is)f(only)g(applicable)f(to)376 2804 y(euk)-5 b(ary)m(otic)35
+b(cytoplasmic)g(tRNA)h(pseudogenes.)55 b(Since)34 b(Co)m(v)m(e-only)i
+(mo)s(de)e(is)g(used,)i(searc)m(hes)376 2917 y(will)27
+b(b)s(e)j(v)m(ery)h(slo)m(w)f(\(see)h(-C)f(option)g(b)s(elo)m(w\))g
+(relativ)m(e)h(to)g(the)f(default)g(mo)s(de.)228 3103
+y(-G)47 b(:)40 b(use)30 b(general)h(tRNA)g(mo)s(del)376
+3252 y(This)g(option)i(selects)h(the)g(original)e(tRNA)i(co)m(v)-5
+b(ariance)34 b(mo)s(del)f(that)h(w)m(as)g(trained)e(on)i(tRNAs)376
+3365 y(from)22 b(all)g(three)h(ph)m(ylogenetic)f(domains)g(\(arc)m
+(haea,)k(bacteria,)f(&)e(euk)-5 b(ary)m(a\).)39 b(This)21
+b(mo)s(de)i(can)g(b)s(e)376 3478 y(used)g(when)g(analyzing)h(a)h(mixed)
+e(collection)h(of)g(sequences)h(from)f(more)g(than)h(one)f(ph)m
+(ylogenetic)376 3591 y(domain,)35 b(with)e(only)h(sligh)m(t)g(loss)h
+(of)g(sensitivit)m(y)e(and)h(selectivit)m(y)-8 b(.)55
+b(The)35 b(original)e(publication)376 3704 y(describing)25
+b(this)h(program)h(and)g(tRNAscan-SE)h(v)m(ersion)f(1.0)h(used)f(this)f
+(general)h(tRNA)h(mo)s(del)376 3817 y(exclusiv)m(ely)-8
+b(.)39 b(If)29 b(y)m(ou)h(wish)e(to)j(compare)f(scores)g(to)h(those)f
+(found)e(in)h(the)h(pap)s(er)e(or)i(scans)g(using)376
+3930 y(v1.0,)42 b(use)c(this)f(option.)65 b(Use)39 b(of)g(this)e
+(option)h(is)g(compatible)g(with)f(all)g(other)i(searc)m(h)g(mo)s(de)
+376 4042 y(options)29 b(describ)s(ed)g(in)g(this)g(section.)234
+4228 y(-C)46 b(:)40 b(searc)m(h)31 b(using)e(Co)m(v)m(e)j(analysis)d
+(only)376 4377 y(Directs)41 b(tRNAscan-SE)g(to)g(analyze)g(sequences)g
+(using)e(Co)m(v)m(e)j(analysis)e(only)-8 b(.)71 b(This)39
+b(option)376 4490 y(allo)m(ws)28 b(a)i(sligh)m(tly)e(more)h(sensitiv)m
+(e)g(searc)m(h)h(than)f(the)h(default)e(tRNAscan)i(+)f(Eu\014ndtRNA)f
+Fh(\))376 4603 y Fj(Co)m(v)m(e)35 b(mo)s(de,)f(but)f(is)g(m)m(uc)m(h)h
+(slo)m(w)m(er)g(\(b)m(y)g(appro)m(x.)50 b(250)36 b(to)e(3,000)i
+(fold\).)50 b(Output)33 b(format)h(and)376 4716 y(other)c(program)g
+(defaults)g(are)h(otherwise)e(iden)m(tical)h(to)h(the)f(normal)g
+(analysis.)232 4901 y(-H)46 b(:)53 b(sho)m(w)37 b(b)s(oth)f(primary)f
+(&)h(secondary)h(structure)f(score)i(comp)s(onen)m(ts)f(to)g(co)m(v)-5
+b(ariance)38 b(mo)s(del)376 5014 y(bit)29 b(scores)376
+5163 y(This)20 b(option)i(displa)m(ys)f(the)h(breakdo)m(wn)g(of)h(the)f
(t)m(w)m(o)i(comp)s(onen)m(ts)f(of)f(the)h(co)m(v)-5
-b(ariance)25 b(mo)s(del)d(bit)376 5276 y(score.)41 b(Since)29
-b(tRNA)h(pseudogenes)g(often)g(ha)m(v)m(e)g(one)g(v)m(ery)g(lo)m(w)g
-(comp)s(onen)m(t)g(\(go)s(o)s(d)g(secondary)1920 5525
-y(7)p eop end
+b(ariance)24 b(mo)s(del)d(bit)376 5276 y(score.)41 b(Since)28
+b(tRNA)i(pseudogenes)g(often)g(ha)m(v)m(e)g(one)g(v)m(ery)g(lo)m(w)f
+(comp)s(onen)m(t)h(\(go)s(o)s(d)g(secondary)1920 5525
+y(7)p eop
%%Page: 8 8
-TeXDict begin 8 7 bop 376 273 a Fj(structure)35 b(but)h(p)s(o)s(or)g
-(primary)f(sequence)i(similarit)m(y)h(to)f(the)f(tRNA)h(mo)s(del,)h(or)
-e(vice)i(v)m(ersa\),)376 386 y(this)d(information)h(ma)m(y)g(b)s(e)f
-(useful)g(in)g(deciding)h(whether)f(a)g(lo)m(w-scoring)j(tRNA)e(is)f
-(lik)m(ely)i(to)376 499 y(b)s(e)d(a)h(pseudogene.)53
-b(The)34 b(heuristic)h(pseudogene)f(detection)i(\014lter)f(uses)f(this)
-g(information)h(to)376 612 y(\015ag)f(p)s(ossible)f(pseudogenes)h({)h
-(use)e(this)h(option)h(to)f(see)h(wh)m(y)e(a)i(hit)f(is)g(mark)m(ed)g
-(as)g(a)g(p)s(ossible)376 724 y(pseudogene.)51 b(It)35
-b(ma)m(y)f(b)s(e)g(helpful)f(to)i(examine)f(score)h(breakdo)m(wns)f
-(from)f(kno)m(wn)h(tRNAs)g(in)376 837 y(the)c(organism)h(of)f(in)m
-(terest)i(to)f(get)g(a)g(frame)g(of)f(reference.)230
-1025 y(-D)47 b(:)40 b(disable)31 b(pseudogene)f(c)m(hec)m(king)376
-1175 y(Man)m(ually)22 b(disable)g(c)m(hec)m(king)h(tRNAs)e(for)g(p)s(o)
-s(or)g(primary)f(or)i(secondary)f(structure)g(scores)h(often)376
-1288 y(indicativ)m(e)31 b(of)f(euk)-5 b(ary)m(otic)32
-b(pseudogenes.)40 b(This)29 b(will)i(sligh)m(tly)g(sp)s(eed)e(the)h
-(program)g(&)f(ma)m(y)i(b)s(e)376 1401 y(necessary)i(for)h(non-euk)-5
-b(ary)m(otic)34 b(sequences)g(that)g(are)g(\015agged)g(as)g(p)s
-(ossible)f(pseudogenes)g(but)376 1514 y(are)d(kno)m(wn)g(to)h(b)s(e)f
-(functional)h(tRNAs.)148 1757 y Fi(5.2)113 b(Output)37
+8 7 bop 376 273 a Fj(structure)35 b(but)h(p)s(o)s(or)g(primary)e
+(sequence)j(similarit)m(y)d(to)j(the)f(tRNA)h(mo)s(del,)g(or)f(vice)h
+(v)m(ersa\),)376 386 y(this)d(information)g(ma)m(y)i(b)s(e)f(useful)f
+(in)g(deciding)g(whether)h(a)g(lo)m(w-scoring)h(tRNA)g(is)e(lik)m(ely)g
+(to)376 499 y(b)s(e)g(a)h(pseudogene.)53 b(The)34 b(heuristic)f
+(pseudogene)h(detection)h(\014lter)f(uses)g(this)f(information)g(to)376
+612 y(\015ag)h(p)s(ossible)d(pseudogenes)j({)h(use)e(this)g(option)h
+(to)g(see)h(wh)m(y)e(a)i(hit)e(is)g(mark)m(ed)h(as)g(a)g(p)s(ossible)
+376 724 y(pseudogene.)51 b(It)35 b(ma)m(y)f(b)s(e)g(helpful)d(to)k
+(examine)e(score)i(breakdo)m(wns)f(from)f(kno)m(wn)h(tRNAs)g(in)376
+837 y(the)c(organism)g(of)g(in)m(terest)h(to)g(get)g(a)g(frame)g(of)f
+(reference.)230 1025 y(-D)47 b(:)40 b(disable)29 b(pseudogene)h(c)m
+(hec)m(king)376 1175 y(Man)m(ually)20 b(disable)g(c)m(hec)m(king)i
+(tRNAs)f(for)g(p)s(o)s(or)g(primary)e(or)j(secondary)f(structure)g
+(scores)h(often)376 1288 y(indicativ)m(e)28 b(of)i(euk)-5
+b(ary)m(otic)31 b(pseudogenes.)40 b(This)28 b(will)g(sligh)m(tly)g(sp)s
+(eed)h(the)h(program)g(&)f(ma)m(y)i(b)s(e)376 1401 y(necessary)i(for)h
+(non-euk)-5 b(ary)m(otic)33 b(sequences)h(that)g(are)g(\015agged)g(as)g
+(p)s(ossible)d(pseudogenes)i(but)376 1514 y(are)d(kno)m(wn)g(to)h(b)s
+(e)f(functional)f(tRNAs.)148 1757 y Fi(5.2)113 b(Output)37
b(Options)101 1929 y Fj(-o)31 b Fg(\014le)53 b Fj(:)40
-b(sa)m(v)m(e)32 b(\014nal)e(results)g(in)g Fg(\014le)376
-2079 y Fj(Sp)s(eci\014y)f(this)h(option)h(to)g(write)g(results)f(to)h
+b(sa)m(v)m(e)32 b(\014nal)d(results)g(in)g Fg(\014le)376
+2079 y Fj(Sp)s(eci\014y)f(this)h(option)h(to)h(write)f(results)f(to)i
Fg(\014le)37 b Fj(rather)31 b(than)f(standard)f(output.)119
-2267 y(-f)h Fg(\014le)53 b Fj(:)40 b(sa)m(v)m(e)32 b(results)e(and)g
+2267 y(-f)h Fg(\014le)53 b Fj(:)40 b(sa)m(v)m(e)32 b(results)d(and)h
(Co)m(v)m(e)i(tRNA)f(secondary)f(structures)g(to)h Fg(\014le)376
-2396 y Fj(This)36 b(option)h(sa)m(v)m(es)h(results)f(and)f(secondary)h
-(structure)f(information)h(\(as)h(predicted)e(b)m(y)h(the)376
-2487 y(co)m(v)m(es)24 b(program\))f(in)f Fg(\014le)p
-Fj(.)38 b(Use)23 b(\\$")h(in)e(place)h(of)g Fg(\014le)30
+2396 y Fj(This)k(option)h(sa)m(v)m(es)i(results)e(and)g(secondary)h
+(structure)f(information)f(\(as)j(predicted)d(b)m(y)i(the)376
+2487 y(co)m(v)m(es)24 b(program\))f(in)e Fg(\014le)p
+Fj(.)38 b(Use)23 b(\\$")h(in)d(place)h(of)h Fg(\014le)30
b Fj(to)23 b(send)f(to)h(standard)f(output.)37 b(An)22
b(example)376 2578 y(of)30 b(the)h(output)f(format)g(for)h(one)f(tRNA)h
(app)s(ears)f(b)s(elo)m(w:)376 2782 y Fa(CELF22B7.trna4)42
@@ -3904,103 +2394,102 @@ b(+---------------++-----+)689 3512 y(|)314 b(D-stem/loop)278
b(Anticodon)472 b(TPC)40 b(stem/loop)159 b(|)689 3604
y(|)1060 b(stem/loop)1100 b(|)689 3695 y(+--------------------------)q
(-----)q(----)q(----)q(-----)q(----)q(-----)q(----)q(----)q(---+)1631
-3786 y(Isoacceptor)42 b(stem)376 4103 y Fj(The)24 b(\014rst)g(line)h
-(con)m(tains)h(the)f(sequence)h(name,)g(trna#,)g(tRNA)f(b)s(ounds)e
-(\(in)i(paren)m(theses\),)i(and)376 4216 y(length)34
-b(of)g(the)g(tRNA.)g(The)g(next)g(line)g(con)m(tains)h(the)f
-(isoacceptor)i(tRNA)e(T)m(yp)s(e,)g(An)m(tico)s(don)376
-4328 y(\(with)41 b(tRNA-relativ)m(e)j(and)d(sequence-absolute)h(b)s
-(ounds\),)h(and)d(the)i(Co)m(v)m(e)g(Score.)74 b(This)40
-b(is)376 4441 y(iden)m(tical)e(information)e(as)h(w)m(ould)f(b)s(e)f
-(seen)i(in)f(the)g(tabular)g(output)g(format,)i(excluding)f(the)376
-4554 y(an)m(tico)s(don)k(b)s(ounds.)71 b(The)40 b(next)h(line)g(con)m
-(tains)i(hash)d(marks)g(ev)m(ery)i(5)f(and)g(10)g(bp)f(to)i(ease)376
-4667 y(p)s(osition)32 b(iden)m(ti\014cation)i(in)f(the)f(tRNA)h
-(sequence)g(that)g(app)s(ears)f(on)h(the)f(follo)m(wing)i(line.)48
-b(On)376 4780 y(the)35 b(sequence)h(line,)h(n)m(ucleotides)g(matc)m
-(hing)g(the)e(\\consensus")h(tRNA)g(mo)s(del)f(used)g(in)g(Co)m(v)m(e)
-376 4893 y(analysis)f(app)s(ear)g(in)f(upp)s(er)f(case,)37
-b(while)d(in)m(trons)g(and)f(other)i(n)m(ucleotides)g(in)f(non-conserv)
-m(ed)376 5006 y(p)s(ositions)28 b(are)h(prin)m(ted)g(in)f(lo)m(w)m
-(er-case)j(letters.)42 b(The)28 b(last)h(line)g(con)m(tains)h
-(predicted)f(secondary)376 5119 y(structure)43 b(folding)h(of)f(the)h
-(tRNA,)h(with)e(nested)h(')p Fd(>)p Fj(')g(and)f(')p
-Fd(<)p Fj(')h(sym)m(b)s(ols)f(represen)m(ting)h(base)376
-5232 y(pairings.)c(The)30 b(v)-5 b(arious)30 b(tRNA)h(features)g(are)g
-(lab)s(elled)g(in)f(this)g(example.)1920 5525 y(8)p eop
-end
+3786 y(Isoacceptor)42 b(stem)376 4103 y Fj(The)24 b(\014rst)g(line)f
+(con)m(tains)i(the)g(sequence)h(name,)g(trna#,)g(tRNA)f(b)s(ounds)e
+(\(in)h(paren)m(theses\),)j(and)376 4216 y(length)33
+b(of)h(the)g(tRNA.)g(The)g(next)g(line)e(con)m(tains)i(the)g
+(isoacceptor)h(tRNA)f(T)m(yp)s(e,)g(An)m(tico)s(don)376
+4328 y(\(with)40 b(tRNA-relativ)m(e)i(and)f(sequence-absolute)g(b)s
+(ounds\),)i(and)d(the)i(Co)m(v)m(e)g(Score.)74 b(This)39
+b(is)376 4441 y(iden)m(tical)c(information)f(as)j(w)m(ould)e(b)s(e)g
+(seen)i(in)e(the)h(tabular)f(output)h(format,)i(excluding)d(the)376
+4554 y(an)m(tico)s(don)40 b(b)s(ounds.)71 b(The)40 b(next)h(line)e(con)
+m(tains)j(hash)e(marks)g(ev)m(ery)i(5)f(and)g(10)g(bp)f(to)i(ease)376
+4667 y(p)s(osition)30 b(iden)m(ti\014cation)h(in)h(the)g(tRNA)h
+(sequence)g(that)g(app)s(ears)f(on)h(the)f(follo)m(wing)f(line.)46
+b(On)376 4780 y(the)35 b(sequence)h(line,)f(n)m(ucleotides)g(matc)m
+(hing)h(the)f(\\consensus")h(tRNA)g(mo)s(del)e(used)h(in)f(Co)m(v)m(e)
+376 4893 y(analysis)e(app)s(ear)i(in)e(upp)s(er)g(case,)37
+b(while)32 b(in)m(trons)h(and)g(other)i(n)m(ucleotides)e(in)g
+(non-conserv)m(ed)376 5006 y(p)s(ositions)26 b(are)j(prin)m(ted)f(in)f
+(lo)m(w)m(er-case)j(letters.)41 b(The)28 b(last)g(line)f(con)m(tains)i
+(predicted)f(secondary)376 5119 y(structure)43 b(folding)f(of)h(the)h
+(tRNA,)h(with)d(nested)i(')p Fd(>)p Fj(')g(and)f(')p
+Fd(<)p Fj(')h(sym)m(b)s(ols)e(represen)m(ting)h(base)376
+5232 y(pairings.)38 b(The)30 b(v)-5 b(arious)29 b(tRNA)i(features)g
+(are)g(lab)s(elled)d(in)h(this)g(example.)1920 5525 y(8)p
+eop
%%Page: 9 9
-TeXDict begin 9 8 bop 254 273 a Fj(-a)47 b(:)40 b(output)30
-b(results)g(in)g(A)m(CeDB)i(output)e(format)376 423 y(This)42
-b(option)i(allo)m(ws)h(results)f(to)g(b)s(e)f(written)g(in)h(A)m(CeDB)h
-(format)f(instead)f(of)h(the)g(default)376 536 y(tabular)30
-b(output)g(format.)71 724 y(-m)g Fg(\014le)53 b Fj(:)40
-b(sa)m(v)m(e)32 b(statistics)h(summary)c(for)h(run)376
-874 y(This)c(option)i(directs)f(tRNAscan-SE)h(to)g(write)g(a)f(brief)g
-(summary)f(to)i Fg(\014le)34 b Fj(whic)m(h)27 b(con)m(tains)i(the)376
-987 y(run)34 b(options)i(selected)i(as)e(w)m(ell)h(as)f(statistics)i
-(on)e(the)g(n)m(um)m(b)s(er)f(of)h(tRNAs)g(detected)h(at)g(eac)m(h)376
+9 8 bop 254 273 a Fj(-a)47 b(:)40 b(output)30 b(results)f(in)g(A)m
+(CeDB)j(output)e(format)376 423 y(This)41 b(option)i(allo)m(ws)g
+(results)g(to)h(b)s(e)f(written)f(in)h(A)m(CeDB)i(format)f(instead)e
+(of)i(the)g(default)376 536 y(tabular)29 b(output)h(format.)71
+724 y(-m)g Fg(\014le)53 b Fj(:)40 b(sa)m(v)m(e)32 b(statistics)f
+(summary)e(for)h(run)376 874 y(This)25 b(option)i(directs)f
+(tRNAscan-SE)i(to)g(write)f(a)g(brief)f(summary)g(to)i
+Fg(\014le)34 b Fj(whic)m(h)26 b(con)m(tains)i(the)376
+987 y(run)34 b(options)h(selected)i(as)f(w)m(ell)f(as)h(statistics)g
+(on)g(the)g(n)m(um)m(b)s(er)f(of)h(tRNAs)g(detected)h(at)g(eac)m(h)376
1100 y(phase)28 b(of)i(the)f(searc)m(h,)h(searc)m(h)g(sp)s(eed,)f(and)f
-(other)h(statistics)i(\(examples)f(on)f(follo)m(wing)i(pages\).)1920
-5525 y(9)p eop end
+(other)h(statistics)g(\(examples)g(on)g(follo)m(wing)f(pages\).)1920
+5525 y(9)p eop
%%Page: 10 10
-TeXDict begin 10 9 bop 376 273 a Fj(F)-8 b(ollo)m(wing)42
-b(is)d(a)i(description)e(of)h(eac)m(h)h(of)f(these)g(statistics,)k
-(follo)m(w)m(ed)e(b)m(y)d(an)h(example)g(stats)376 372
-y(summary)29 b(\014le)h(created)i(from)e(scanning)g(the)g(C.)h(elegans)
-g(cosmid)g(F59C12:)376 584 y Fc(tRNAscan-SE)39 b(run)j(results)f(\(on)h
-(host)g(<computer)e(name>\))376 684 y(Started:)g(<time)h(&)j(date)d
-(tRNAscan-SE)f(began>)376 883 y(<Parameters)f(used)j(for)g(search)f
-(printed)g(here>)376 1082 y(First-pass)e(\(tRNAscan/Eufind)o(tRN)o(A\))
-e(Stats:)376 1182 y(---------------)o(---)o(--)o(--)o(---)o(--)o(---)o
-(--)o(---)o(--)o(--)376 1282 y(Sequences)i(read:)391
-b(<total)41 b(#)i(of)g(FASTA)e(sequences)f(read>)376
-1381 y(Seqs)i(w/at)f(least)h(1)h(hit:)86 b(<total)41
-b(sequences)f(with)i(at)g(least)g(one)g(tRNA)g(predicted>)376
-1481 y(Bases)f(read:)565 b(<total)41 b(nucleotides)e(in)k(all)f
-(sequences)e(searched)g(\(both)i(strands\)>)376 1580
-y(Bases)f(in)i(tRNAs:)390 b(<total)41 b(nucleotides)e(in)k(tRNAs)e
-(predicted>)376 1680 y(tRNAs)g(predicted:)345 b(<#)42
-b(tRNAs)g(predicted)e(from)i(first-pass)d(search)i(program\(s\)>)376
-1780 y(Av.)h(tRNA)g(length:)346 b(<average)40 b(tRNA)i(length>)376
-1879 y(Script)f(CPU)h(time:)347 b(<CPU)42 b(time)g(spent)f(by)i
-(tRNAscan-SE)1465 1979 y(reading)e(seqs,)g(setting)g(up)i(run)f(&)h
-(writing)e(results>)376 2079 y(Scan)h(CPU)g(time:)434
-b(<CPU)42 b(time)g(spent)f(by)i(tRNAscan/Eufindt)o(RN)o(A)38
-b(finding)i(tRNAs>)376 2178 y(Scan)i(speed:)564 b(<Averaged)40
-b(tRNAscan+Eufind)o(tR)o(NA)d(search)k(speed>)376 2377
-y(First)g(pass)h(search\(es\))d(ended:)j(<time)f(&)i(date)f
-(tRNAscan/EufindtR)o(NA)37 b(searches)1683 2477 y(finished,)j(Cove)i
-(analysis)e(begins>)376 2676 y(Cove)i(Stats:)376 2776
-y(-----------)376 2876 y(Candidate)d(tRNAs)j(read:)172
-b(<number)41 b(of)i(tRNAs)e(detected)f(by)j(tRNAscan/EufindtR)o(NA)1509
-2975 y(that)f(were)g(passed)f(to)i(Cove)e(for)i(verification>)376
-3075 y(Cove-confirmed)37 b(tRNAs:)172 b(<number)41 b(of)i(tRNAs)e
-(positively)f(confirmed)g(by)i(Cove>)376 3174 y(Bases)f(scanned)g(by)i
-(covels:)d(<total)h(nucleotides)e(in)k(all)f(tRNAs)g(searched)e(by)1509
-3274 y(Cove)i(\(covels-SE)d(program\))h(analysis>)376
-3374 y(\045)j(seq)f(scanned)f(by)i(covels:)d(<percent)h(of)h(total)g
-(nucleotides)d(in)k(input)1509 3473 y(sequences)d(that)i(were)g
-(analyzed)e(by)j(Cove>)376 3573 y(Script)e(CPU)h(time:)390
-b(<CPU)42 b(time)g(spent)g(by)g(tRNAscan-SE)d(reading)1509
-3673 y(seqs,)i(setting)g(up)i(runs)f(&)h(writing)e(results>)376
-3772 y(Cove)h(CPU)g(time:)477 b(<CPU)42 b(time)g(spent)g(by)g(Cove)g
-(analysis)f(programs>)376 3872 y(Scan)h(speed:)607 b(<Average)41
-b(Cove)g(search)h(speed>)376 4071 y(Cove)g(analysis)e(of)j(tRNAs)e
-(ended:)g(<time)h(&)h(date)f(Cove)g(analysis)1727 4171
-y(and)g(tRNAscan-SE)d(completed>)376 4270 y(Summary)376
-4370 y(--------)376 4470 y(Confirmed)g(tRNAs:)216 b(<total)41
-b(tRNAs)h(predicted)d(by)k(tRNAscan-SE>)376 4569 y(Overall)d(scan)i
-(speed:)85 b(<Average)40 b(search)h(speed)h(for)g(tRNAscan-SE>)1897
-5525 y Fj(10)p eop end
+10 9 bop 376 273 a Fj(F)-8 b(ollo)m(wing)39 b(is)f(a)j(description)c
+(of)j(eac)m(h)h(of)f(these)g(statistics,)i(follo)m(w)m(ed)e(b)m(y)f(an)
+h(example)f(stats)376 372 y(summary)29 b(\014le)g(created)j(from)e
+(scanning)f(the)h(C.)h(elegans)f(cosmid)g(F59C12:)376
+584 y Fc(tRNAscan-SE)39 b(run)j(results)f(\(on)h(host)g(<computer)e
+(name>\))376 684 y(Started:)g(<time)h(&)j(date)d(tRNAscan-SE)f(began>)
+376 883 y(<Parameters)f(used)j(for)g(search)f(printed)g(here>)376
+1082 y(First-pass)e(\(tRNAscan/Eufind)o(tRN)o(A\))e(Stats:)376
+1182 y(---------------)o(---)o(--)o(--)o(---)o(--)o(---)o(--)o(---)o
+(--)o(--)376 1282 y(Sequences)i(read:)391 b(<total)41
+b(#)i(of)g(FASTA)e(sequences)f(read>)376 1381 y(Seqs)i(w/at)f(least)h
+(1)h(hit:)86 b(<total)41 b(sequences)f(with)i(at)g(least)g(one)g(tRNA)g
+(predicted>)376 1481 y(Bases)f(read:)565 b(<total)41
+b(nucleotides)e(in)k(all)f(sequences)e(searched)g(\(both)i(strands\)>)
+376 1580 y(Bases)f(in)i(tRNAs:)390 b(<total)41 b(nucleotides)e(in)k
+(tRNAs)e(predicted>)376 1680 y(tRNAs)g(predicted:)345
+b(<#)42 b(tRNAs)g(predicted)e(from)i(first-pass)d(search)i
+(program\(s\)>)376 1780 y(Av.)h(tRNA)g(length:)346 b(<average)40
+b(tRNA)i(length>)376 1879 y(Script)f(CPU)h(time:)347
+b(<CPU)42 b(time)g(spent)f(by)i(tRNAscan-SE)1465 1979
+y(reading)e(seqs,)g(setting)g(up)i(run)f(&)h(writing)e(results>)376
+2079 y(Scan)h(CPU)g(time:)434 b(<CPU)42 b(time)g(spent)f(by)i
+(tRNAscan/Eufindt)o(RN)o(A)38 b(finding)i(tRNAs>)376
+2178 y(Scan)i(speed:)564 b(<Averaged)40 b(tRNAscan+Eufind)o(tR)o(NA)d
+(search)k(speed>)376 2377 y(First)g(pass)h(search\(es\))d(ended:)j
+(<time)f(&)i(date)f(tRNAscan/EufindtR)o(NA)37 b(searches)1683
+2477 y(finished,)j(Cove)i(analysis)e(begins>)376 2676
+y(Cove)i(Stats:)376 2776 y(-----------)376 2876 y(Candidate)d(tRNAs)j
+(read:)172 b(<number)41 b(of)i(tRNAs)e(detected)f(by)j
+(tRNAscan/EufindtR)o(NA)1509 2975 y(that)f(were)g(passed)f(to)i(Cove)e
+(for)i(verification>)376 3075 y(Cove-confirmed)37 b(tRNAs:)172
+b(<number)41 b(of)i(tRNAs)e(positively)f(confirmed)g(by)i(Cove>)376
+3174 y(Bases)f(scanned)g(by)i(covels:)d(<total)h(nucleotides)e(in)k
+(all)f(tRNAs)g(searched)e(by)1509 3274 y(Cove)i(\(covels-SE)d
+(program\))h(analysis>)376 3374 y(\045)j(seq)f(scanned)f(by)i(covels:)d
+(<percent)h(of)h(total)g(nucleotides)d(in)k(input)1509
+3473 y(sequences)d(that)i(were)g(analyzed)e(by)j(Cove>)376
+3573 y(Script)e(CPU)h(time:)390 b(<CPU)42 b(time)g(spent)g(by)g
+(tRNAscan-SE)d(reading)1509 3673 y(seqs,)i(setting)g(up)i(runs)f(&)h
+(writing)e(results>)376 3772 y(Cove)h(CPU)g(time:)477
+b(<CPU)42 b(time)g(spent)g(by)g(Cove)g(analysis)f(programs>)376
+3872 y(Scan)h(speed:)607 b(<Average)41 b(Cove)g(search)h(speed>)376
+4071 y(Cove)g(analysis)e(of)j(tRNAs)e(ended:)g(<time)h(&)h(date)f(Cove)
+g(analysis)1727 4171 y(and)g(tRNAscan-SE)d(completed>)376
+4270 y(Summary)376 4370 y(--------)376 4470 y(Confirmed)g(tRNAs:)216
+b(<total)41 b(tRNAs)h(predicted)d(by)k(tRNAscan-SE>)376
+4569 y(Overall)d(scan)i(speed:)85 b(<Average)40 b(search)h(speed)h(for)
+g(tRNAscan-SE>)1897 5525 y Fj(10)p eop
%%Page: 11 11
-TeXDict begin 11 10 bop 376 273 a Fj(An)35 b(example)h(stats)h(summary)
-d(\014le)i(using)f(the)h(default)g(searc)m(h)g(options)g(on)f(cosmid)h
-(F59C12)376 372 y(follo)m(ws:)376 684 y Fc(tRNAscan-SE)j(run)j(results)
-f(\(on)h(host)g(wol\))376 783 y(Started:)e(Wed)i(Feb)86
-b(5)43 b(15:02:30)e(CST)h(1997)376 983 y(---------------)o(---)o(--)o
-(--)o(---)o(--)o(---)o(--)o(---)o(--)o(--)o(---)o(--)o(---)o(--)o(--)o
-(---)o(--)o(---)o(-)376 1082 y(Sequence)e(file\(s\))h(to)h(search:)85
+11 10 bop 376 273 a Fj(An)35 b(example)g(stats)i(summary)d(\014le)h
+(using)f(the)i(default)f(searc)m(h)h(options)f(on)g(cosmid)g(F59C12)376
+372 y(follo)m(ws:)376 684 y Fc(tRNAscan-SE)k(run)j(results)f(\(on)h
+(host)g(wol\))376 783 y(Started:)e(Wed)i(Feb)86 b(5)43
+b(15:02:30)e(CST)h(1997)376 983 y(---------------)o(---)o(--)o(--)o
+(---)o(--)o(---)o(--)o(---)o(--)o(--)o(---)o(--)o(---)o(--)o(--)o(---)o
+(--)o(---)o(-)376 1082 y(Sequence)e(file\(s\))h(to)h(search:)85
b(F59C12.fa)376 1182 y(Results)40 b(written)h(to:)435
b(Standard)40 b(output)376 1282 y(Output)h(format:)651
b(Tabular)376 1381 y(Searching)39 b(with:)609 b(tRNAscan)40
@@ -4031,169 +2520,168 @@ y(Cove)g(analysis)e(of)j(tRNAs)e(ended:)g(Wed)i(Feb)85
b(5)44 b(15:02:43)c(CST)i(1997)376 4569 y(Summary)376
4669 y(--------)376 4768 y(Confirmed)d(tRNAs:)172 b(3)376
4868 y(Overall)40 b(scan)i(speed:)f(6399.1)g(bp/sec)1897
-5525 y Fj(11)p eop end
+5525 y Fj(11)p eop
%%Page: 12 12
-TeXDict begin 12 11 bop 249 273 a Fj(-d)46 b(:)40 b(displa)m(y)31
-b(program)f(progress)g(messages)376 423 y(This)43 b(option)i(directs)g
-(the)g(program)f(to)h(prin)m(t)f(messages)i(indicating)f(the)g
-(progress)f(of)h(the)376 536 y(program)32 b(to)i(standard)e(output.)48
-b(If)33 b(\014nal)f(results)h(are)g(also)h(b)s(eing)f(sen)m(t)g(to)h
-(standard)e(output,)376 649 y(some)25 b(of)h(these)g(messages)g(will)g
-(b)s(e)e(suppressed)g(so)h(as)h(to)g(not)g(in)m(terrupt)e(displa)m(y)i
-(of)f(the)h(results.)121 837 y(-l)31 b Fg(\014le)53 b
-Fj(:)40 b(sa)m(v)m(e)32 b(log)g(of)e(program)g(progress)g(in)g
-Fg(\014le)376 987 y Fj(Iden)m(tical)h(to)g(-d)g(option,)g(but)e(sends)h
-(message)h(to)g Fg(\014le)38 b Fj(instead)30 b(of)h(standard)e(output.)
-376 1100 y Fg(Note:)43 b Fj(the)26 b(-d)f(option)i(o)m(v)m(errides)f
-(the)g(-l)g(option)h(if)e(b)s(oth)g(are)h(sp)s(eci\014ed)g(on)f(the)h
+12 11 bop 249 273 a Fj(-d)46 b(:)40 b(displa)m(y)29 b(program)h
+(progress)g(messages)376 423 y(This)42 b(option)i(directs)g(the)h
+(program)f(to)h(prin)m(t)e(messages)j(indicating)c(the)j(progress)f(of)
+h(the)376 536 y(program)32 b(to)i(standard)e(output.)48
+b(If)33 b(\014nal)e(results)h(are)h(also)g(b)s(eing)f(sen)m(t)h(to)h
+(standard)e(output,)376 649 y(some)25 b(of)h(these)g(messages)g(will)d
+(b)s(e)h(suppressed)g(so)h(as)h(to)g(not)g(in)m(terrupt)d(displa)m(y)h
+(of)h(the)h(results.)121 837 y(-l)k Fg(\014le)53 b Fj(:)40
+b(sa)m(v)m(e)32 b(log)f(of)f(program)g(progress)g(in)f
+Fg(\014le)376 987 y Fj(Iden)m(tical)g(to)i(-d)g(option,)f(but)f(sends)h
+(message)h(to)g Fg(\014le)38 b Fj(instead)29 b(of)i(standard)e(output.)
+376 1100 y Fg(Note:)43 b Fj(the)26 b(-d)f(option)h(o)m(v)m(errides)f
+(the)h(-l)f(option)h(if)e(b)s(oth)h(are)h(sp)s(eci\014ed)f(on)g(the)h
(same)g(command)376 1213 y(line.)252 1400 y(-q)46 b(:)40
-b(quiet)31 b(mo)s(de)f(\(credits)h(&)f(run)f(option)i(selections)h
-(suppressed\))376 1551 y(This)22 b(option)h(suppresses)e(the)i(program)
-f(credits)h(and)g(run)e(option)i(selections)i(normally)e(prin)m(ted)376
-1663 y(to)31 b(standard)e(error)h(at)h(the)g(b)s(eginning)f(of)g(eac)m
-(h)i(run.)249 1851 y(-b)46 b(:)40 b(brief)30 b(output)g(format)h(\(no)f
-(column)h(headers\))376 2001 y(This)25 b(option)h(eliminates)i(column)e
-(headers)g(that)g(app)s(ear)g(b)m(y)g(default)g(when)f(writing)h
-(results)g(in)376 2114 y(tabular)j(output)f(format.)41
-b(Useful)29 b(if)g(results)g(are)h(to)f(b)s(e)g(parsed)f(or)h(sen)m(t)h
+b(quiet)30 b(mo)s(de)g(\(credits)g(&)g(run)f(option)h(selections)g
+(suppressed\))376 1551 y(This)21 b(option)h(suppresses)f(the)i(program)
+f(credits)g(and)h(run)e(option)h(selections)h(normally)e(prin)m(ted)376
+1663 y(to)31 b(standard)e(error)h(at)h(the)g(b)s(eginning)d(of)i(eac)m
+(h)i(run.)249 1851 y(-b)46 b(:)40 b(brief)29 b(output)h(format)h(\(no)f
+(column)g(headers\))376 2001 y(This)24 b(option)h(eliminates)g(column)g
+(headers)h(that)g(app)s(ear)g(b)m(y)g(default)f(when)g(writing)f
+(results)h(in)376 2114 y(tabular)j(output)g(format.)41
+b(Useful)28 b(if)g(results)g(are)i(to)f(b)s(e)g(parsed)f(or)h(sen)m(t)h
(to)g(another)f(program.)232 2302 y(-N)46 b(:)40 b(output)30
-b(corresp)s(onding)g(co)s(dons)g(instead)g(of)h(tRNA)g(an)m(tico)s
-(dons)376 2452 y(This)h(option)j(causes)f(tRNAscan-SE)g(to)g(output)f
-(a)h(tRNA's)h(corresp)s(onding)d(co)s(don)i(in)f(place)376
-2565 y(of)d(its)h(an)m(tico)s(don.)141 2753 y(-?)40 b(#)46
-b(:)40 b(use)30 b(of)h('#')f(sym)m(b)s(ol)h(in)f(sp)s(ecifying)g
-(output)g(\014le)g(names)376 2903 y(The)f('#')i(sym)m(b)s(ol)e(ma)m(y)i
-(b)s(e)f(used)f(as)h(shorthand)f(to)i(sp)s(ecify)f(\\default")h(\014le)
-f(names)h(for)e(output)376 3016 y(\014les.)52 b(The)34
-b(default)h(\014le)f(names)h(are)f(constructed)h(b)m(y)f(using)g(the)h
-(input)e(sequence)i(\014le)g(name,)376 3129 y(follo)m(w)m(ed)d(b)m(y)e
-(an)g(extension)h(sp)s(ecifying)f(the)h(output)f(\014le)g(t)m(yp)s(e)h
+b(corresp)s(onding)f(co)s(dons)h(instead)f(of)i(tRNA)g(an)m(tico)s
+(dons)376 2452 y(This)g(option)j(causes)g(tRNAscan-SE)g(to)g(output)f
+(a)h(tRNA's)h(corresp)s(onding)c(co)s(don)j(in)e(place)376
+2565 y(of)e(its)g(an)m(tico)s(don.)141 2753 y(-?)40 b(#)46
+b(:)40 b(use)30 b(of)h('#')f(sym)m(b)s(ol)g(in)f(sp)s(ecifying)f
+(output)i(\014le)f(names)376 2903 y(The)g('#')i(sym)m(b)s(ol)d(ma)m(y)j
+(b)s(e)f(used)f(as)h(shorthand)f(to)i(sp)s(ecify)e(\\default")h(\014le)
+f(names)i(for)e(output)376 3016 y(\014les.)51 b(The)34
+b(default)g(\014le)f(names)i(are)f(constructed)h(b)m(y)f(using)f(the)i
+(input)d(sequence)j(\014le)f(name,)376 3129 y(follo)m(w)m(ed)c(b)m(y)g
+(an)g(extension)g(sp)s(ecifying)e(the)j(output)f(\014le)f(t)m(yp)s(e)i
Fg(se)-5 b(q\014le.ext)39 b Fj(where)30 b Fg(.ext)39
-b Fj(is:)425 3461 y(Extension)100 b(Pro)s(duced)29 b(b)m(y)i(Option)99
+b Fj(is:)425 3461 y(Extension)99 b(Pro)s(duced)29 b(b)m(y)i(Option)98
b(Description)p 376 3518 3641 4 v 425 3597 a(.out)705
-b(-o)469 b(\014nal)30 b(output)g(results)g(\(tabular)h(or)f(A)m(CeDB)i
+b(-o)469 b(\014nal)29 b(output)h(results)f(\(tabular)h(or)g(A)m(CeDB)i
(format\))425 3710 y(.stats)634 b(-m)453 b(summary)29
-b(statistics)j(\014le)425 3823 y(.log)731 b(-l)479 b(run)29
+b(statistics)h(\014le)425 3823 y(.log)730 b(-l)478 b(run)29
b(progress)h(\014le)425 3935 y(.ss)773 b(-f)477 b(secondary)30
b(structures)g(sa)m(v)m(e)i(\014le)425 4048 y(.fpass.out)489
-b(-r)473 b(formatted,)31 b(tabular)g(output)f(from)g(\014rst-pass)f
+b(-r)473 b(formatted,)31 b(tabular)f(output)g(from)g(\014rst-pass)f
(runs)425 4161 y(.fp)s(os)666 b(-F)462 b(F)-10 b(AST)i(A)30
-b(\014le)h(of)f(tRNAs)h(iden)m(ti\014ed)g(in)f(\014rst-pass)f(scans)
-1830 4274 y(that)i(w)m(ere)g(found)e(to)i(b)s(e)f(false)h(p)s(ositiv)m
-(es)g(b)m(y)f(Co)m(v)m(e)i(analysis)376 4534 y Fg(Note:)478
-4722 y Ff({)46 b Fj(if)28 b(the)g(input)f(sequence)h(\014le)h(name)f
-(has)f(the)i(extensions)f('.fa')h(or)f('.seq',)i(these)f(extensions)576
-4834 y(will)g(b)s(e)f(remo)m(v)m(ed)h(b)s(efore)g(using)f(the)h
-(\014lename)f(as)h(a)g(pre\014x)f(for)g(default)h(\014le)g(names.)40
-b(\(ex-)576 4947 y(ample:)e(input)25 b(\014le)g(name)h('Mygene.seq')h
-(will)f(ha)m(v)m(e)h(the)f(output)f(\014le)g(name)h('Mygene.out')576
-5060 y(if)k('#')g(is)h(used)e(with)i(the)f(-o)h(option\).)1897
-5525 y(12)p eop end
+b(\014le)g(of)g(tRNAs)h(iden)m(ti\014ed)e(in)g(\014rst-pass)g(scans)
+1830 4274 y(that)i(w)m(ere)g(found)e(to)i(b)s(e)f(false)g(p)s(ositiv)m
+(es)f(b)m(y)h(Co)m(v)m(e)i(analysis)376 4534 y Fg(Note:)478
+4722 y Ff({)46 b Fj(if)27 b(the)h(input)e(sequence)i(\014le)g(name)g
+(has)f(the)i(extensions)e('.fa')i(or)f('.seq',)i(these)f(extensions)576
+4834 y(will)d(b)s(e)i(remo)m(v)m(ed)h(b)s(efore)g(using)e(the)i
+(\014lename)e(as)i(a)g(pre\014x)f(for)g(default)g(\014le)g(names.)40
+b(\(ex-)576 4947 y(ample:)d(input)24 b(\014le)g(name)i('Mygene.seq')h
+(will)c(ha)m(v)m(e)k(the)f(output)f(\014le)f(name)i('Mygene.out')576
+5060 y(if)j('#')h(is)g(used)f(with)h(the)g(-o)h(option\).)1897
+5525 y(12)p eop
%%Page: 13 13
-TeXDict begin 13 12 bop 478 273 a Ff({)46 b Fj(if)36
-b(more)g(than)f(one)i(sequence)f(\014le)g(is)g(sp)s(eci\014ed)f(on)h
-(the)g(command)g(line,)i(the)e(\\default")576 386 y(output)30
-b(\014le)i(pre\014x)e(will)h(b)s(e)g(the)g(name)h(of)f(the)g(FIRST)g
-(sequence)g(\014le)h(on)f(the)g(command)576 499 y(line.)38
-b(Use)23 b(the)f(-p)g(option)g(\(describ)s(ed)g(next\))h(to)g(c)m
-(hange)g(this)f(default)g(name)h(to)g(something)576 612
-y(more)29 b(appropriate)g(when)g(sp)s(ecifying)g(more)g(than)g(one)h
-(sequence)f(\014le)h(on)f(the)g(command)576 724 y(line.)38
-912 y(-p)h Fg(lab)-5 b(el)56 b Fj(:)40 b(use)30 b Fg(lab)-5
-b(el)41 b Fj(pre\014x)29 b(for)h(all)i(output)e(\014les)376
-1062 y(This)35 b(option)h(allo)m(ws)h(the)f(user)f(to)h(sp)s(ecify)g
-(the)g(default)g(output)f(\014le)h(pre\014x)f(when)g(using)g(the)376
-1175 y('#')30 b(\014le)h(name)f(sp)s(eci\014cation)h(\(instead)g(of)g
-(using)f(the)g(input)g(sequence)g(\014le)h(name\).)252
-1363 y(-y)46 b(:)40 b(sho)m(w)31 b(origin)f(of)h(\014rst-pass)e(hits)
-376 1513 y(This)23 b(option)i(displa)m(ys)g(whic)m(h)f(of)g(the)h
-(\014rst-pass)f(scanners)g(detected)h(the)g(tRNA)g(b)s(eing)f(output.)
-376 1626 y(\\Ts",)i(\\Eu",)h(or)e(\\Bo")h(will)g(app)s(ear)e(in)h(the)g
-(last)h(column)f(of)g(T)-8 b(abular)25 b(output,)h(indicating)f(that)
-376 1739 y(either)g(tRNAscan)g(1.4,)i(Eu\014ndtRNA,)d(or)g(b)s(oth)g
+13 12 bop 478 273 a Ff({)46 b Fj(if)35 b(more)h(than)f(one)i(sequence)f
+(\014le)f(is)g(sp)s(eci\014ed)f(on)i(the)g(command)g(line,)g(the)g
+(\\default")576 386 y(output)30 b(\014le)h(pre\014x)f(will)e(b)s(e)j
+(the)g(name)h(of)f(the)g(FIRST)g(sequence)g(\014le)g(on)g(the)g
+(command)576 499 y(line.)36 b(Use)23 b(the)f(-p)g(option)f(\(describ)s
+(ed)g(next\))i(to)g(c)m(hange)g(this)e(default)g(name)i(to)g(something)
+576 612 y(more)29 b(appropriate)f(when)h(sp)s(ecifying)e(more)i(than)g
+(one)h(sequence)f(\014le)g(on)g(the)g(command)576 724
+y(line.)38 912 y(-p)h Fg(lab)-5 b(el)56 b Fj(:)40 b(use)30
+b Fg(lab)-5 b(el)41 b Fj(pre\014x)29 b(for)h(all)g(output)g(\014les)376
+1062 y(This)k(option)h(allo)m(ws)g(the)h(user)f(to)h(sp)s(ecify)f(the)h
+(default)f(output)g(\014le)g(pre\014x)g(when)g(using)f(the)376
+1175 y('#')c(\014le)g(name)g(sp)s(eci\014cation)f(\(instead)h(of)h
+(using)e(the)h(input)f(sequence)h(\014le)g(name\).)252
+1363 y(-y)46 b(:)40 b(sho)m(w)31 b(origin)d(of)j(\014rst-pass)e(hits)
+376 1513 y(This)22 b(option)i(displa)m(ys)f(whic)m(h)g(of)h(the)h
+(\014rst-pass)f(scanners)g(detected)h(the)g(tRNA)g(b)s(eing)e(output.)
+376 1626 y(\\Ts",)j(\\Eu",)h(or)e(\\Bo")h(will)d(app)s(ear)h(in)g(the)h
+(last)g(column)f(of)h(T)-8 b(abular)24 b(output,)i(indicating)c(that)
+376 1739 y(either)i(tRNAscan)h(1.4,)i(Eu\014ndtRNA,)d(or)g(b)s(oth)g
(scanners)h(detected)h(the)f(tRNA,)g(resp)s(ectiv)m(ely)-8
-b(.)148 1982 y Fi(5.3)113 b(Sp)s(ecify)38 b(Alternate)f(Cuto\013s)h(/)f
+b(.)148 1982 y Fi(5.3)113 b(Sp)s(ecify)37 b(Alternate)f(Cuto\013s)i(/)f
(Data)h(Files)-2 2154 y Fj(-X)31 b Fg(sc)-5 b(or)g(e)54
b Fj(:)40 b(set)31 b(Co)m(v)m(e)h(cuto\013)f(score)g(for)f(rep)s
-(orting)g(tRNAs)h(\(default=20\))376 2304 y(This)i(option)h(allo)m(ws)h
-(the)f(user)g(to)g(sp)s(ecify)g(a)g(di\013eren)m(t)h(Co)m(v)m(e)g
-(score)f(threshold)g(for)f(rep)s(orting)376 2417 y(tRNAs.)40
-b(It)29 b(is)h(not)f(recommended)g(that)g(no)m(vice)i(users)d(c)m
-(hange)i(this)f(cuto\013,)h(as)g(a)f(lo)m(w)m(er)h(cuto\013)376
-2530 y(score)45 b(will)f(increase)h(the)g(n)m(um)m(b)s(er)e(of)h
-(pseudogenes)h(and)e(other)i(false)g(p)s(ositiv)m(es)g(found)e(b)m(y)
-376 2643 y(tRNAscan-SE)34 b(\(esp)s(ecially)i(when)d(used)g(with)g(the)
-i(\\Co)m(v)m(e)g(only")g(scan)f(mo)s(de\).)51 b(Con)m(v)m(ersely)-8
-b(,)376 2756 y(a)36 b(higher)f(cuto\013)h(than)g(20.0)h(bits)e(will)h
-(lik)m(ely)h(cause)g(true)e(tRNAs)h(to)g(b)s(e)f(missed)h(\(n)m
-(umerous)376 2869 y(\\real")c(tRNAs)g(ha)m(v)m(e)h(b)s(een)d(found)g
+(orting)f(tRNAs)i(\(default=20\))376 2304 y(This)h(option)h(allo)m(ws)g
+(the)h(user)g(to)g(sp)s(ecify)f(a)h(di\013eren)m(t)g(Co)m(v)m(e)h
+(score)f(threshold)f(for)g(rep)s(orting)376 2417 y(tRNAs.)40
+b(It)29 b(is)g(not)g(recommended)g(that)g(no)m(vice)h(users)e(c)m
+(hange)i(this)e(cuto\013,)i(as)g(a)f(lo)m(w)m(er)g(cuto\013)376
+2530 y(score)45 b(will)c(increase)j(the)h(n)m(um)m(b)s(er)e(of)h
+(pseudogenes)h(and)e(other)i(false)f(p)s(ositiv)m(es)f(found)g(b)m(y)
+376 2643 y(tRNAscan-SE)34 b(\(esp)s(ecially)f(when)g(used)g(with)f(the)
+j(\\Co)m(v)m(e)g(only")f(scan)g(mo)s(de\).)51 b(Con)m(v)m(ersely)-8
+b(,)376 2756 y(a)36 b(higher)e(cuto\013)i(than)g(20.0)h(bits)d(will)f
+(lik)m(ely)h(cause)j(true)e(tRNAs)h(to)g(b)s(e)f(missed)g(\(n)m
+(umerous)376 2869 y(\\real")c(tRNAs)h(ha)m(v)m(e)h(b)s(een)d(found)g
(just)h(ab)s(o)m(v)m(e)h(the)g(20.0)g(cuto\013)7 b(\).)45
-b(Kno)m(wledgable)32 b(users)e(ma)m(y)376 2982 y(wish)21
-b(to)i(exp)s(erimen)m(t)g(with)f(this)g(parameter)h(to)g(\014nd)e(un)m
-(usual)g(tRNAs)i(or)g(pseudogenes)f(b)s(ey)m(ond)376
-3095 y(the)30 b(normal)g(range)h(of)g(detection,)h(k)m(eeping)f(the)g
-(preceding)f(ca)m(v)m(eats)j(in)d(mind.)-29 3282 y(-L)h
-Fg(length)53 b Fj(:)40 b(set)31 b(max)g(length)f(of)h(tRNA)g(in)m
-(tron+v)-5 b(ariable)31 b(region)g(\(default=116bp\))376
-3433 y(The)25 b(default)h(maxim)m(um)g(tRNA)h(length)f(for)g
-(tRNAscan-SE)g(is)g(192)h(bp,)f(but)g(this)g(limit)g(can)h(b)s(e)376
-3546 y(increased)22 b(with)f(this)h(option)g(to)h(allo)m(w)g(searc)m
-(hes)f(with)g(no)g(practical)h(limit)g(on)e(tRNA)i(length.)38
+b(Kno)m(wledgable)30 b(users)g(ma)m(y)376 2982 y(wish)20
+b(to)j(exp)s(erimen)m(t)f(with)f(this)g(parameter)i(to)g(\014nd)e(un)m
+(usual)f(tRNAs)j(or)g(pseudogenes)f(b)s(ey)m(ond)376
+3095 y(the)30 b(normal)f(range)i(of)g(detection,)g(k)m(eeping)f(the)h
+(preceding)e(ca)m(v)m(eats)k(in)c(mind.)-29 3282 y(-L)i
+Fg(length)53 b Fj(:)40 b(set)31 b(max)g(length)e(of)i(tRNA)g(in)m
+(tron+v)-5 b(ariable)28 b(region)i(\(default=116bp\))376
+3433 y(The)25 b(default)g(maxim)m(um)g(tRNA)i(length)e(for)h
+(tRNAscan-SE)g(is)f(192)i(bp,)f(but)g(this)f(limit)e(can)k(b)s(e)376
+3546 y(increased)21 b(with)f(this)h(option)g(to)i(allo)m(w)e(searc)m
+(hes)h(with)f(no)h(practical)f(limit)f(on)h(tRNA)i(length.)37
b(In)376 3658 y(the)29 b(\014rst)g(phase)g(of)h(tRNAscan-SE,)g
(Eu\014ndtRNA)e(searc)m(hes)i(for)f(A)h(and)f(B)g(b)s(o)m(xes)h(of)f
-(<length>)376 3771 y(maxim)m(um)20 b(distance)h(apart,)i(and)d(passes)g
-(only)g(the)h(5')g(and)f(3')h(tRNA)g(ends)e(to)j(co)m(v)-5
-b(ariance)22 b(mo)s(del)376 3884 y(analysis)33 b(for)f(con\014rmation)h
-(\(remo)m(ving)h(the)f(bulk)f(of)h(long)g(in)m(terv)m(ening)h
-(sequences\).)49 b(tRNAs)376 3997 y(con)m(taining)40
-b(group)e(I)h(and)g(I)s(I)f(in)m(trons)g(ha)m(v)m(e)j(b)s(een)d
-(detected)i(b)m(y)f(setting)h(this)f(parameter)g(to)376
-4110 y(o)m(v)m(er)27 b(800)h(bp.)39 b(Caution:)f(group)26
-b(I)h(or)f(I)s(I)g(in)m(trons)g(in)g(tRNAs)h(tend)g(to)g(o)s(ccur)f(in)
-g(p)s(ositions)h(other)376 4223 y(than)36 b(the)g(canonical)i(p)s
-(osition)e(of)h(protein-spliced)f(in)m(trons,)i(so)f(tRNAscan-SE)f
-(mispredicts)376 4336 y(the)30 b(in)m(tron)h(b)s(ounds)d(and)i(an)m
-(tico)s(don)h(sequence)g(for)f(these)h(cases.)41 b(tRNA)31
+(<length>)376 3771 y(maxim)m(um)19 b(distance)h(apart,)j(and)d(passes)g
+(only)f(the)i(5')g(and)f(3')h(tRNA)g(ends)e(to)j(co)m(v)-5
+b(ariance)21 b(mo)s(del)376 3884 y(analysis)31 b(for)h(con\014rmation)g
+(\(remo)m(ving)h(the)g(bulk)e(of)i(long)f(in)m(terv)m(ening)g
+(sequences\).)49 b(tRNAs)376 3997 y(con)m(taining)38
+b(group)g(I)h(and)g(I)s(I)f(in)m(trons)f(ha)m(v)m(e)k(b)s(een)d
+(detected)i(b)m(y)f(setting)g(this)f(parameter)h(to)376
+4110 y(o)m(v)m(er)27 b(800)h(bp.)39 b(Caution:)e(group)26
+b(I)h(or)f(I)s(I)g(in)m(trons)f(in)g(tRNAs)i(tend)g(to)g(o)s(ccur)f(in)
+f(p)s(ositions)g(other)376 4223 y(than)36 b(the)g(canonical)g(p)s
+(osition)e(of)j(protein-spliced)c(in)m(trons,)k(so)g(tRNAscan-SE)f
+(mispredicts)376 4336 y(the)30 b(in)m(tron)g(b)s(ounds)e(and)i(an)m
+(tico)s(don)g(sequence)h(for)f(these)h(cases.)41 b(tRNA)31
b(b)s(ound)e(predictions,)376 4449 y(ho)m(w)m(ev)m(er,)j(ha)m(v)m(e)f
-(b)s(een)f(found)f(to)i(b)s(e)f(reliable)h(in)f(these)h(same)g(tRNAs.)
-34 4636 y(-I)f Fg(sc)-5 b(or)g(e)54 b Fj(:)40 b(man)m(ually)31
-b(set)g(\\in)m(termediate")i(cuto\013)e(score)g(for)f(Eu\014ndtRNA)376
-4787 y(This)37 b(score)j(cuto\013)f(a\013ects)h(the)f(sensitivit)m(y)h
-(of)f(the)f(\014rst-pass)g(scanner)h(Eu\014ndtRNA.)e(This)376
-4900 y(parameter)27 b(should)f(not)i(need)f(to)h(b)s(e)e(adjusted)h
-(from)g(its)g(default)h(v)-5 b(alues)27 b(\(v)-5 b(ariable)29
-b(dep)s(ending)376 5013 y(on)39 b(searc)m(h)h(mo)s(de\),)i(but)d(is)h
-(included)e(for)i(users)f(who)g(are)h(familiar)g(with)f(the)h(P)m(a)m
-(v)m(esi)i Fg(et)f(al.)376 5125 y Fj(\(1994\))f(pap)s(er)d(and)g(wish)h
-(to)g(set)h(it)f(man)m(ually)-8 b(.)65 b(See)38 b(Lo)m(w)m(e)h(&)f
-(Eddy)f(\(1997\))j(for)e(details)h(on)376 5238 y(parameter)30
-b(v)-5 b(alues)31 b(used)f(b)m(y)g(tRNAscan-SE)h(dep)s(ending)e(on)h
-(the)h(searc)m(h)g(mo)s(de.)1897 5525 y(13)p eop end
+(b)s(een)f(found)f(to)i(b)s(e)f(reliable)e(in)h(these)i(same)g(tRNAs.)
+34 4636 y(-I)f Fg(sc)-5 b(or)g(e)54 b Fj(:)40 b(man)m(ually)29
+b(set)i(\\in)m(termediate")g(cuto\013)g(score)g(for)f(Eu\014ndtRNA)376
+4787 y(This)36 b(score)k(cuto\013)f(a\013ects)h(the)f(sensitivit)m(y)e
+(of)i(the)f(\014rst-pass)g(scanner)h(Eu\014ndtRNA.)e(This)376
+4900 y(parameter)27 b(should)e(not)j(need)f(to)h(b)s(e)e(adjusted)h
+(from)g(its)f(default)h(v)-5 b(alues)26 b(\(v)-5 b(ariable)27
+b(dep)s(ending)376 5013 y(on)39 b(searc)m(h)h(mo)s(de\),)i(but)d(is)g
+(included)d(for)k(users)f(who)g(are)h(familiar)d(with)h(the)i(P)m(a)m
+(v)m(esi)h Fg(et)g(al.)376 5125 y Fj(\(1994\))f(pap)s(er)d(and)g(wish)g
+(to)h(set)h(it)e(man)m(ually)-8 b(.)63 b(See)38 b(Lo)m(w)m(e)h(&)f
+(Eddy)f(\(1997\))j(for)e(details)f(on)376 5238 y(parameter)30
+b(v)-5 b(alues)30 b(used)g(b)m(y)g(tRNAscan-SE)h(dep)s(ending)d(on)i
+(the)h(searc)m(h)g(mo)s(de.)1897 5525 y(13)p eop
%%Page: 14 14
-TeXDict begin 14 13 bop -72 273 a Fj(-z)31 b Fg(numb)-5
-b(er)56 b Fj(:)40 b(use)30 b Fg(numb)-5 b(er)41 b Fj(n)m(ucleotides)32
-b(padding)d(for)h(\014rst-pass)g(tRNA)h(predictions)376
-423 y(By)d(default,)g(tRNAscan-SE)h(adds)e(7)h(n)m(ucleotides)h(to)g(b)
-s(oth)e(ends)g(of)h(tRNA)g(predictions)g(when)376 536
-y(\014rst-pass)f(tRNA)i(predictions)f(are)g(passed)g(to)h(co)m(v)-5
-b(ariance)30 b(mo)s(del)e(\(CM\))h(analysis.)40 b(CM)28
-b(anal-)376 649 y(ysis)34 b(generally)h(trims)f(these)g(b)s(ounds)e
-(bac)m(k)j(do)m(wn,)g(but)e(on)h(o)s(ccassion,)i(allo)m(ws)g
-(prediction)e(of)376 762 y(an)c(otherwise)h(truncated)f(\014rst-pass)g
+14 13 bop -72 273 a Fj(-z)31 b Fg(numb)-5 b(er)56 b Fj(:)40
+b(use)30 b Fg(numb)-5 b(er)41 b Fj(n)m(ucleotides)30
+b(padding)e(for)i(\014rst-pass)g(tRNA)h(predictions)376
+423 y(By)d(default,)f(tRNAscan-SE)i(adds)e(7)h(n)m(ucleotides)f(to)i(b)
+s(oth)e(ends)g(of)h(tRNA)g(predictions)e(when)376 536
+y(\014rst-pass)h(tRNA)i(predictions)d(are)i(passed)g(to)h(co)m(v)-5
+b(ariance)29 b(mo)s(del)e(\(CM\))i(analysis.)38 b(CM)28
+b(anal-)376 649 y(ysis)33 b(generally)g(trims)g(these)h(b)s(ounds)e
+(bac)m(k)j(do)m(wn,)g(but)e(on)h(o)s(ccassion,)h(allo)m(ws)f
+(prediction)e(of)376 762 y(an)e(otherwise)g(truncated)g(\014rst-pass)g
(tRNA)h(prediction.)101 949 y(-g)g Fg(\014le)53 b Fj(:)40
-b(use)30 b(alternate)i(genetic)g(co)s(des)f(sp)s(eci\014ed)f(in)g
-Fg(\014le)37 b Fj(for)30 b(determining)g(tRNA)h(t)m(yp)s(e)376
-1100 y(By)e(default,)h(tRNAscan-SE)g(uses)f(a)h(standard)f(univ)m
-(ersal)h(co)s(don)f Fh(!)g Fj(amino)h(acid)g(translation)376
-1213 y(table)37 b(that)h(is)f(sp)s(eci\014ed)f(at)i(the)f(end)g(of)g
-(the)g(tRNAscan-SE.src)h(source)f(\014le.)60 b(In)37
-b(man)m(y)g(mi-)376 1326 y(to)s(c)m(hondrial)32 b(and)g(a)h(n)m(um)m(b)
-s(er)d(of)j(other)f(microbial)h(organisms,)g(there)f(are)h(exceptions)g
-(to)g(this)376 1438 y(univ)m(ersal)i(translation)h(co)s(de.)56
-b(This)35 b(option)h(allo)m(ws)g(the)g(user)e(to)i(sp)s(ecify)f
-(exceptions)i(to)f(the)376 1551 y(univ)m(ersal)g(co)s(de.)58
-b(Sev)m(eral)38 b(alternate)f(translation)h(co)s(de)e(\014les)g(are)h
-(included)e(in)h(this)g(pac)m(k)-5 b(age)376 1664 y(for)30
+b(use)30 b(alternate)h(genetic)g(co)s(des)g(sp)s(eci\014ed)e(in)g
+Fg(\014le)37 b Fj(for)30 b(determining)e(tRNA)j(t)m(yp)s(e)376
+1100 y(By)e(default,)g(tRNAscan-SE)h(uses)f(a)h(standard)f(univ)m
+(ersal)f(co)s(don)h Fh(!)g Fj(amino)g(acid)g(translation)376
+1213 y(table)36 b(that)i(is)e(sp)s(eci\014ed)f(at)j(the)f(end)g(of)g
+(the)g(tRNAscan-SE.src)h(source)f(\014le.)59 b(In)37
+b(man)m(y)g(mi-)376 1326 y(to)s(c)m(hondrial)30 b(and)i(a)h(n)m(um)m(b)
+s(er)d(of)j(other)f(microbial)e(organisms,)i(there)g(are)h(exceptions)f
+(to)h(this)376 1438 y(univ)m(ersal)g(translation)h(co)s(de.)56
+b(This)34 b(option)h(allo)m(ws)f(the)i(user)e(to)i(sp)s(ecify)e
+(exceptions)i(to)g(the)376 1551 y(univ)m(ersal)e(co)s(de.)58
+b(Sev)m(eral)37 b(alternate)f(translation)g(co)s(de)g(\014les)f(are)i
+(included)c(in)i(this)g(pac)m(k)-5 b(age)376 1664 y(for)30
b(con)m(v)m(enience:)376 1901 y Fc(gcode.cilnuc)38 b(for)43
b(Ciliates,)c(Dasycladacean,)f(&)43 b(Hexamita)e(nuclear)f(tRNAs)376
2001 y(gcode.echdmito)d(for)43 b(Echinoderm)c(mitochondrial)f(tRNAs)376
@@ -4202,262 +2690,260 @@ b(Ciliates,)c(Dasycladacean,)f(&)43 b(Hexamita)e(nuclear)f(tRNAs)376
b(mitochondrial)h(tRNAs)376 2299 y(gcode.vertmito)e(for)43
b(Vertibrate)c(mitochondrial)f(tRNAs)376 2399 y(gcode.ystmito)81
b(for)43 b(Yeast)e(mitochondrial)d(tRNAs)376 2649 y Fj(The)26
-b(user)h(ma)m(y)g(also)i(create)f(a)g(new)f(alternate)h(translation)h
-(\014le.)39 b(An)27 b(example)h(of)f(an)g(alternate)376
-2762 y(translation)k(co)s(de)g(sp)s(eci\014cation)g(\014le)f(follo)m
+b(user)h(ma)m(y)g(also)h(create)g(a)g(new)f(alternate)g(translation)g
+(\014le.)38 b(An)27 b(example)g(of)g(an)g(alternate)376
+2762 y(translation)i(co)s(de)i(sp)s(eci\014cation)e(\014le)g(follo)m
(ws:)376 2998 y Fc(#)43 b(Vertebrate)c(mitochondrial)f(translation)h
(codes)376 3098 y(#)k(Format:)84 b(<Codon>)41 b(<3-letter)f(AA)i
(abbreviation>)d(<One)i(letter)h(AA)g(abrev>)376 3297
y(TGA)216 b(Trp)43 b(W)376 3397 y(ATA)216 b(Met)43 b(M)376
3497 y(AGR)216 b(Stp)43 b(*)376 3746 y Fj(Commen)m(ts)28
-b(or)g(other)h(information)f(will)h(b)s(e)e(ignored)i(on)f(lines)g
-(preceded)g(b)m(y)g(a)h(p)s(ound)d(sym)m(b)s(ol)376 3859
-y('#'.)52 b(An)m(tico)s(don)35 b(translation)g(co)s(des)g(are)f(sp)s
-(eci\014ed)g(b)m(y)g(placing)h(the)g(three)f(base)h(co)s(don,)g(the)376
-3972 y(three)i(letter)i(amino)e(acid)h(abbreviation,)i(and)c(the)i
-(single)g(letter)g(amino)g(acid)f(abbreviation)376 4085
-y(all)e(on)f(a)g(single)h(line)f(\(eac)m(h)i(separated)e(b)m(y)g(a)h
-(space)f(or)g(tab\).)53 b(Degenerate)36 b(sym)m(b)s(ols)e(suc)m(h)g(as)
-376 4198 y('N',)h('R',)g(and)e('Y')i(ma)m(y)g(also)g(b)s(e)f(used)f
-(for)h(co)s(don)h(sp)s(eci\014cation.)53 b(An)m(y)34
-b(co)s(don)g(not)h(sp)s(eci\014ed)376 4311 y(in)40 b(the)h(alternate)h
-(genetic)g(co)s(de)f(\014le)f(will)h(use)f(the)h(translation)h(in)e
-(the)h(default)f('univ)m(ersal')376 4424 y(genetic)c(co)s(de)g(table)g
-(that)f(o)s(ccurs)g(at)h(the)f(v)m(ery)g(end)g(of)g(the)g
-(tRNAscan-SE.src)h(source)f(co)s(de)376 4537 y(\014le.)41
-b(Changes)31 b(can)f(b)s(e)g(made)h(directly)g(to)h(the)f(default)f
-(translation)i(table,)g(but)e(a)h(new)f('mak)m(e)376
-4650 y(install')h(m)m(ust)f(b)s(e)g(run)f(to)i(install)g(the)g(mo)s
-(di\014ed)e(PERL)h(script.)376 4763 y Fg(Note:)57 b Fj(this)37
-b(option)g(do)s(es)f(not)h(ha)m(v)m(e)h(an)m(y)e(e\013ect)i(when)e
-(using)g(the)h(-T)f(or)g(-E)h(option)g(\(searc)m(h)376
-4876 y(using)h(tRNAscan)h(or)f(Eu\014ndtRNA)f(only\))i(|)g(y)m(ou)f(m)m
-(ust)h(b)s(e)f(running)e(in)j(default)f(or)h(Co)m(v)m(e)376
-4989 y(only)30 b(analysis)h(mo)s(de.)106 5176 y(-c)g
-Fg(\014le)53 b Fj(:)40 b(use)30 b(an)h(alternate)h(co)m(v)-5
-b(ariance)32 b(mo)s(del)f(sp)s(eci\014ed)e(in)h Fg(\014le)1897
-5525 y Fj(14)p eop end
+b(or)g(other)h(information)d(will)g(b)s(e)h(ignored)h(on)g(lines)e
+(preceded)i(b)m(y)g(a)h(p)s(ound)d(sym)m(b)s(ol)376 3859
+y('#'.)52 b(An)m(tico)s(don)34 b(translation)f(co)s(des)i(are)f(sp)s
+(eci\014ed)f(b)m(y)h(placing)f(the)i(three)f(base)h(co)s(don,)g(the)376
+3972 y(three)i(letter)h(amino)e(acid)h(abbreviation,)h(and)e(the)i
+(single)e(letter)h(amino)g(acid)f(abbreviation)376 4085
+y(all)d(on)h(a)g(single)f(line)f(\(eac)m(h)k(separated)e(b)m(y)g(a)h
+(space)f(or)g(tab\).)53 b(Degenerate)36 b(sym)m(b)s(ols)d(suc)m(h)h(as)
+376 4198 y('N',)h('R',)g(and)e('Y')i(ma)m(y)g(also)f(b)s(e)g(used)f
+(for)h(co)s(don)h(sp)s(eci\014cation.)51 b(An)m(y)34
+b(co)s(don)g(not)h(sp)s(eci\014ed)376 4311 y(in)k(the)i(alternate)g
+(genetic)g(co)s(de)g(\014le)e(will)f(use)i(the)h(translation)f(in)f
+(the)i(default)e('univ)m(ersal')376 4424 y(genetic)c(co)s(de)h(table)f
+(that)g(o)s(ccurs)g(at)h(the)f(v)m(ery)g(end)g(of)g(the)g
+(tRNAscan-SE.src)h(source)f(co)s(de)376 4537 y(\014le.)40
+b(Changes)31 b(can)f(b)s(e)g(made)h(directly)e(to)j(the)f(default)e
+(translation)h(table,)h(but)f(a)h(new)f('mak)m(e)376
+4650 y(install')e(m)m(ust)i(b)s(e)g(run)f(to)i(install)d(the)j(mo)s
+(di\014ed)d(PERL)i(script.)376 4763 y Fg(Note:)57 b Fj(this)36
+b(option)g(do)s(es)g(not)h(ha)m(v)m(e)h(an)m(y)e(e\013ect)i(when)e
+(using)f(the)i(-T)f(or)g(-E)h(option)f(\(searc)m(h)376
+4876 y(using)h(tRNAscan)i(or)f(Eu\014ndtRNA)f(only\))h(|)h(y)m(ou)f(m)m
+(ust)h(b)s(e)f(running)d(in)j(default)f(or)i(Co)m(v)m(e)376
+4989 y(only)29 b(analysis)g(mo)s(de.)106 5176 y(-c)i
+Fg(\014le)53 b Fj(:)40 b(use)30 b(an)h(alternate)g(co)m(v)-5
+b(ariance)31 b(mo)s(del)f(sp)s(eci\014ed)e(in)h Fg(\014le)1897
+5525 y Fj(14)p eop
%%Page: 15 15
-TeXDict begin 15 14 bop 376 273 a Fj(F)-8 b(or)42 b(users)f(who)g(ha)m
-(v)m(e)i(dev)m(elop)s(ed)f(their)g(o)m(wn)g(tRNA)g(co)m(v)-5
-b(ariance)44 b(mo)s(dels)e(using)f(the)h(Co)m(v)m(e)376
-386 y(program)37 b(\\co)m(v)m(eb")k(\(see)e(Co)m(v)m(e)g(do)s(cumen)m
-(tation\),)i(this)d(parameter)g(allo)m(ws)i(substitution)d(for)376
-499 y(the)e(default)h(tRNA)g(co)m(v)-5 b(ariance)38 b(mo)s(dels.)55
-b(Ma)m(y)37 b(b)s(e)e(useful)f(for)h(extending)h(Co)m(v)m(e-only)h(mo)s
-(de)376 612 y(detection)32 b(of)e(particularly)h(strange)g(tRNA)g(sp)s
-(ecies)f(suc)m(h)g(as)h(mito)s(c)m(hondrial)g(tRNAs.)148
-855 y Fi(5.4)113 b(Miscellaneous)39 b(Options)249 1027
-y Fj(-h)46 b(:)40 b(prin)m(t)30 b(full)g(list)h(of)g(a)m(v)-5
-b(ailable)33 b(program)d(options)376 1177 y(Prin)m(ts)g(this)g(list)h
-(of)g(program)f(options,)h(eac)m(h)g(with)f(a)h(brief,)f(one-line)i
+15 14 bop 376 273 a Fj(F)-8 b(or)42 b(users)f(who)g(ha)m(v)m(e)i(dev)m
+(elop)s(ed)e(their)g(o)m(wn)h(tRNA)g(co)m(v)-5 b(ariance)43
+b(mo)s(dels)e(using)f(the)i(Co)m(v)m(e)376 386 y(program)37
+b(\\co)m(v)m(eb")k(\(see)e(Co)m(v)m(e)g(do)s(cumen)m(tation\),)h(this)d
+(parameter)h(allo)m(ws)g(substitution)d(for)376 499 y(the)g(default)g
+(tRNA)h(co)m(v)-5 b(ariance)37 b(mo)s(dels.)54 b(Ma)m(y)37
+b(b)s(e)e(useful)e(for)i(extending)g(Co)m(v)m(e-only)h(mo)s(de)376
+612 y(detection)31 b(of)f(particularly)e(strange)j(tRNA)g(sp)s(ecies)e
+(suc)m(h)h(as)h(mito)s(c)m(hondrial)d(tRNAs.)148 855
+y Fi(5.4)113 b(Miscellaneous)36 b(Options)249 1027 y
+Fj(-h)46 b(:)40 b(prin)m(t)29 b(full)f(list)h(of)i(a)m(v)-5
+b(ailable)30 b(program)g(options)376 1177 y(Prin)m(ts)f(this)g(list)g
+(of)i(program)f(options,)g(eac)m(h)h(with)e(a)i(brief,)e(one-line)h
(description.)229 1365 y(-Q)46 b(:)40 b(do)31 b(not)f(prompt)g(user)f
-(b)s(efore)h(o)m(v)m(erwriting)i(pre-existing)f(\014les)376
-1515 y(By)23 b(default,)j(if)d(an)h(output)f(result)h(\014le)f(to)i(b)s
-(e)e(written)g(to)i(already)f(exists,)i(the)d(user)g(is)h(prompted)376
-1628 y(whether)39 b(the)i(\014le)f(should)f(b)s(e)h(o)m(v)m(er-written)
-i(or)e(app)s(ended)e(to.)72 b(Using)40 b(this)g(options)h(forces)376
-1741 y(o)m(v)m(erwriting)35 b(of)g(pre-existing)g(\014les)g(without)f
-(an)h(in)m(teractiv)m(e)i(prompt.)52 b(This)34 b(option)h(ma)m(y)g(b)s
-(e)376 1854 y(handy)29 b(for)h(batc)m(h-pro)s(cessing)h(and)f(running)f
-(tRNAscan-SE)h(in)g(the)h(bac)m(kground.)40 2041 y(-n)g
-Fg(expr)56 b Fj(:)40 b(searc)m(h)31 b(only)g(sequences)f(with)g(names)h
-(matc)m(hing)g Fg(expr)41 b Fj(string)376 2191 y(This)23
-b(option)i(allo)m(ws)h(analysis)g(of)e(selected)i(sequences)f(in)g(a)g
-(sequence)g(\014le)f(con)m(taining)i(m)m(ultiple)376
-2304 y(sequences.)60 b(Only)36 b(those)i(sequences)f(with)f(names)h
-(\(\014rst)f(non-white)h(space)h(w)m(ord)e(after)h(\\)p
-Fd(>)p Fj(")376 2417 y(sym)m(b)s(ol)j(on)h(F)-10 b(AST)i(A)41
-b(name/description)g(line\))h(matc)m(hing)g Fg(expr)51
-b Fj(are)41 b(analyzed.)73 b Fg(expr)51 b Fj(ma)m(y)376
-2530 y(con)m(tain)36 b(*)g(or)f(?)56 b(wildcard)34 b(c)m(haracters,)39
-b(but)34 b(the)i(user)e(should)h(enclose)h(suc)m(h)f(expressions)g(in)
-376 2643 y(single)d(quotes)h(\(for)f(example:)44 b(-n)32
-b('HU?alpha*'\))i(to)f(prev)m(en)m(t)f(the)g(shell)g(from)g(attempting)
-h(to)376 2756 y(expand)c(wildcards)h(in)m(to)h(\014le)g(name)f(matc)m
+(b)s(efore)h(o)m(v)m(erwriting)g(pre-existing)f(\014les)376
+1515 y(By)23 b(default,)i(if)d(an)i(output)f(result)g(\014le)f(to)j(b)s
+(e)e(written)f(to)j(already)e(exists,)i(the)e(user)g(is)g(prompted)376
+1628 y(whether)39 b(the)i(\014le)e(should)f(b)s(e)i(o)m(v)m(er-written)
+h(or)f(app)s(ended)e(to.)72 b(Using)39 b(this)g(options)h(forces)376
+1741 y(o)m(v)m(erwriting)33 b(of)i(pre-existing)e(\014les)h(without)f
+(an)i(in)m(teractiv)m(e)g(prompt.)52 b(This)33 b(option)h(ma)m(y)h(b)s
+(e)376 1854 y(handy)29 b(for)h(batc)m(h-pro)s(cessing)g(and)g(running)e
+(tRNAscan-SE)i(in)f(the)i(bac)m(kground.)40 2041 y(-n)g
+Fg(expr)56 b Fj(:)40 b(searc)m(h)31 b(only)f(sequences)g(with)f(names)i
+(matc)m(hing)f Fg(expr)41 b Fj(string)376 2191 y(This)22
+b(option)i(allo)m(ws)g(analysis)g(of)g(selected)h(sequences)g(in)f(a)h
+(sequence)g(\014le)e(con)m(taining)h(m)m(ultiple)376
+2304 y(sequences.)60 b(Only)35 b(those)j(sequences)f(with)e(names)i
+(\(\014rst)f(non-white)g(space)i(w)m(ord)e(after)h(\\)p
+Fd(>)p Fj(")376 2417 y(sym)m(b)s(ol)i(on)i(F)-10 b(AST)i(A)41
+b(name/description)e(line\))h(matc)m(hing)h Fg(expr)51
+b Fj(are)41 b(analyzed.)72 b Fg(expr)51 b Fj(ma)m(y)376
+2530 y(con)m(tain)35 b(*)h(or)f(?)56 b(wildcard)32 b(c)m(haracters,)39
+b(but)34 b(the)i(user)e(should)g(enclose)h(suc)m(h)g(expressions)f(in)
+376 2643 y(single)c(quotes)j(\(for)f(example:)43 b(-n)32
+b('HU?alpha*'\))h(to)g(prev)m(en)m(t)f(the)g(shell)e(from)i(attempting)
+g(to)376 2756 y(expand)d(wildcards)f(in)m(to)i(\014le)g(name)g(matc)m
(hes.)55 2944 y(-s)h Fg(expr)56 b Fj(:)e(start)38 b(searc)m(h)g(at)g
-(sequence)g(with)f(name)g(matc)m(hing)i Fg(expr)48 b
-Fj(string)37 b(and)g(con)m(tin)m(ue)h(to)g(end)f(of)376
-3057 y(input)29 b(sequence)i(\014le\(s\))376 3207 y(This)f(option)h
-(directs)g(the)h(program)e(to)i(analyze)g(the)f(\014rst)g(sequence)g
-(with)g(a)g(name)g(matc)m(hing)376 3320 y Fg(expr)p Fj(,)23
-b(and)d(ev)m(ery)h(sequence)f(thereafter.)38 b(This)20
-b(ma)m(y)h(b)s(e)e(useful)h(for)g(re-starting)h(crashed/ab)s(orted)376
-3433 y(runs)31 b(at)j(the)f(p)s(oin)m(t)g(where)g(the)g(previous)g(run)
-f(stopp)s(ed.)48 b(\(if)33 b(same)h(names)f(for)g(output)f(\014le\(s\))
-376 3546 y(are)k(used,)g(program)g(will)g(ask)g(if)g(\014les)g(should)e
-(b)s(e)i(o)m(v)m(er-written)h(or)f(app)s(ended)e(to)i(|)g(c)m(ho)s(ose)
-376 3658 y(app)s(end)28 b(and)i(run)f(will)i(successfully)f(b)s(e)g
-(restarted)h(where)f(it)g(left)i(o\013)7 b(\).)148 3902
-y Fi(5.5)113 b(Options)38 b(for)f(testing)g(&)h(sp)s(ecial)h
+(sequence)g(with)e(name)h(matc)m(hing)h Fg(expr)48 b
+Fj(string)36 b(and)h(con)m(tin)m(ue)g(to)h(end)f(of)376
+3057 y(input)28 b(sequence)j(\014le\(s\))376 3207 y(This)e(option)h
+(directs)g(the)i(program)e(to)i(analyze)f(the)g(\014rst)g(sequence)g
+(with)f(a)h(name)g(matc)m(hing)376 3320 y Fg(expr)p Fj(,)23
+b(and)d(ev)m(ery)h(sequence)f(thereafter.)38 b(This)19
+b(ma)m(y)i(b)s(e)e(useful)g(for)h(re-starting)g(crashed/ab)s(orted)376
+3433 y(runs)31 b(at)j(the)f(p)s(oin)m(t)f(where)h(the)g(previous)f(run)
+g(stopp)s(ed.)48 b(\(if)32 b(same)i(names)f(for)g(output)f(\014le\(s\))
+376 3546 y(are)k(used,)g(program)g(will)d(ask)j(if)f(\014les)g(should)e
+(b)s(e)j(o)m(v)m(er-written)g(or)g(app)s(ended)e(to)i(|)g(c)m(ho)s(ose)
+376 3658 y(app)s(end)28 b(and)i(run)f(will)f(successfully)g(b)s(e)i
+(restarted)h(where)f(it)f(left)i(o\013)7 b(\).)148 3902
+y Fi(5.5)113 b(Options)37 b(for)g(testing)f(&)i(sp)s(ecial)f
(applications)234 4074 y Fj(-T)46 b(:)40 b(searc)m(h)31
-b(using)f(tRNAscan)h(only)g(\(defaults)g(to)g(strict)g(searc)m(h)g
-(params\))376 4224 y(Directs)37 b(tRNAscan-SE)g(to)g(use)f(only)h
-(tRNAscan)g(to)g(analyze)g(sequences.)59 b(This)36 b(mo)s(de)g(will)376
-4337 y(cause)26 b(tRNAscan)g(to)g(default)g(to)g(using)f(\\strict")j
-(parameters)e(\(similar)g(to)g(tRNAscan)h(v)m(ersion)376
-4450 y(1.3)46 b(op)s(eration\).)85 b(This)44 b(mo)s(de)g(of)h(op)s
-(eration)h(is)f(sligh)m(tly)h(faster)f(\(ab)s(out)g(3-5)h(times)g
-(faster)376 4563 y(than)29 b(default)g(mo)s(de)g(analysis\),)h(but)f
-(will)g(result)g(in)g(appro)m(ximately)i(0.2)f(to)g(0.6)g(false)g(p)s
+b(using)e(tRNAscan)i(only)f(\(defaults)g(to)h(strict)f(searc)m(h)h
+(params\))376 4224 y(Directs)36 b(tRNAscan-SE)h(to)g(use)f(only)g
+(tRNAscan)h(to)g(analyze)f(sequences.)59 b(This)35 b(mo)s(de)h(will)376
+4337 y(cause)26 b(tRNAscan)g(to)g(default)f(to)h(using)e(\\strict")j
+(parameters)f(\(similar)d(to)j(tRNAscan)h(v)m(ersion)376
+4450 y(1.3)46 b(op)s(eration\).)84 b(This)43 b(mo)s(de)h(of)h(op)s
+(eration)g(is)f(sligh)m(tly)f(faster)i(\(ab)s(out)g(3-5)h(times)f
+(faster)376 4563 y(than)29 b(default)f(mo)s(de)h(analysis\),)f(but)h
+(will)d(result)i(in)g(appro)m(ximately)h(0.2)h(to)g(0.6)g(false)f(p)s
(ositiv)m(e)376 4675 y(tRNAs)45 b(p)s(er)f(Mbp,)j(decreased)f
-(sensitivit)m(y)-8 b(,)50 b(and)44 b(less)h(reliable)h(prediction)f(of)
-g(an)m(tico)s(dons,)376 4788 y(tRNA)31 b(isot)m(yp)s(e,)g(and)f(in)m
-(trons.)-7 4976 y(-t)h Fg(mo)-5 b(de)84 b Fj(:)50 b(explicitly)37
-b(set)f(tRNAscan)h(params,)f(where)f Fg(mo)-5 b(de)44
-b Fj(=)35 b(R)g(or)h(S)f(\(R=relaxed,)i(S=strict)f(tR-)376
+(sensitivit)m(y)-8 b(,)47 b(and)d(less)g(reliable)f(prediction)g(of)i
+(an)m(tico)s(dons,)376 4788 y(tRNA)31 b(isot)m(yp)s(e,)f(and)g(in)m
+(trons.)-7 4976 y(-t)h Fg(mo)-5 b(de)84 b Fj(:)50 b(explicitly)33
+b(set)j(tRNAscan)h(params,)f(where)f Fg(mo)-5 b(de)44
+b Fj(=)35 b(R)g(or)h(S)f(\(R=relaxed,)h(S=strict)f(tR-)376
5089 y(NAscan)30 b(v1.3)i(params\))1897 5525 y(15)p eop
-end
%%Page: 16 16
-TeXDict begin 16 15 bop 376 273 a Fj(This)44 b(option)i(allo)m(ws)h
-(selection)g(of)f(strict)g(or)f(relaxed)h(searc)m(h)g(parameters)g(for)
-f(tRNAscan)376 386 y(analysis.)71 b(By)41 b(default,)j(\\strict")e
-(parameters)f(are)g(used.)70 b(Relaxed)42 b(parameters)e(ma)m(y)i(giv)m
-(e)376 499 y(v)m(ery)30 b(sligh)m(tly)i(increased)f(searc)m(h)g
-(sensitivit)m(y)-8 b(,)32 b(but)e(increase)h(searc)m(h)g(time)g(b)m(y)f
-(20-40)j(fold.)238 686 y(-E)46 b(:)40 b(searc)m(h)31
-b(using)f(Euk)-5 b(ary)m(otic)32 b(tRNA)f(\014nder)d(\(Eu\014ndtRNA\))i
-(only)376 837 y(This)21 b(option)i(runs)e(Eu\014ndtRNA)g(alone)i(to)h
-(searc)m(h)f(for)f(tRNAs.)38 b(Since)23 b(Co)m(v)m(e)h(is)e(not)h(b)s
-(eing)f(used)376 949 y(as)38 b(a)g(secondary)g(\014lter)g(to)g(remo)m
-(v)m(e)i(false)e(p)s(ositiv)m(es,)j(this)d(run)e(mo)s(de)i(defaults)g
-(to)g(\\normal")376 1062 y(parameters)43 b(whic)m(h)g(more)g(closely)i
-(appro)m(ximates)f(the)f(sensitivit)m(y)i(and)e(selectivit)m(y)j(of)d
-(the)376 1175 y(original)d(algorithm)h(describ)s(e)e(b)m(y)g(P)m(a)m(v)
-m(esi)j(and)d(colleagues)j(\(see)f(the)f(next)f(option,)k(-e)d(for)g(a)
-376 1288 y(description)30 b(of)h(the)f(v)-5 b(arious)30
-b(run)f(mo)s(des\).)-12 1476 y(-e)i Fg(mo)-5 b(de)84
-b Fj(:)46 b(explicitly)35 b(set)f(Eu\014ndtRNA)e(params,)i(where)f
-Fg(mo)-5 b(de)42 b Fj(=)33 b(R,)g(N,)h(or)f(S)g(\(relaxed,)j(normal,)e
-(or)376 1589 y(strict\))376 1739 y(This)39 b(option)j(allo)m(ws)f(the)g
-(user)f(to)i(explicitly)g(set)f(the)g(parameters)g(for)f(Eu\014ndtRNA.)
-g(The)376 1852 y(\\relaxed")34 b(mo)s(de)e(is)h(used)g(for)f
-(Eu\014ndtRNA)g(when)g(using)g(tRNAscan-SE)h(in)g(default)g(mo)s(de.)
-376 1965 y(With)40 b(relaxed)g(parameters,)i(tRNAs)e(that)g(lac)m(k)h
-(p)s(ol)e(I)s(I)s(I)f(p)s(oly-T)i(terminators)g(are)g(not)f(p)s(e-)376
-2078 y(nalized,)32 b(increasing)h(searc)m(h)f(sensitivit)m(y)-8
-b(,)34 b(but)c(decreasing)j(selectivit)m(y)-8 b(.)47
-b(When)32 b(Co)m(v)m(e)g(analysis)376 2191 y(is)38 b(b)s(eing)f(used)h
-(as)g(a)h(secondary)f(\014lter)g(for)g(false)h(p)s(ositiv)m(es)g(\(as)f
-(in)g(tRNAscan-SE's)h(default)376 2304 y(mo)s(de\),)30
-b(o)m(v)m(erall)j(selectivit)m(y)g(is)d(not)h(decreased.)376
-2567 y(Using)i(\\normal")i(parameters)e(with)h(Eu\014ndtRNA)d(do)s(es)j
-(incorp)s(orate)g(a)f(log)i(o)s(dds)d(score)i(for)376
-2680 y(the)j(distance)h(b)s(et)m(w)m(een)g(the)g(B)g(b)s(o)m(x)f(and)g
-(the)g(\014rst)g(p)s(oly-T)g(terminator,)j(but)d(do)s(es)g(not)g(dis-)
-376 2793 y(qualify)26 b(tRNAs)g(that)g(do)g(not)g(ha)m(v)m(e)h(a)f
-(terminator)h(signal)f(within)f(60)i(n)m(ucleotides.)40
-b(This)25 b(mo)s(de)376 2905 y(is)30 b(used)g(b)m(y)g(default)g(when)g
-(Co)m(v)m(e)i(analysis)f(is)f(not)h(b)s(eing)f(used)f(as)i(a)g
-(secondary)f(false)h(p)s(ositiv)m(e)376 3018 y(\014lter.)376
-3282 y(Using)25 b(\\strict")h(parameters)g(with)e(Eu\014ndtRNA)f(also)j
-(incorp)s(orates)g(a)f(log)h(o)s(dds)e(score)h(for)g(the)376
-3394 y(distance)31 b(b)s(et)m(w)m(een)h(the)f(B)g(b)s(o)m(x)f(and)h
-(the)g(\014rst)f(p)s(oly-T)g(terminator,)i(but)e Fg(r)-5
+16 15 bop 376 273 a Fj(This)43 b(option)i(allo)m(ws)g(selection)g(of)h
+(strict)f(or)g(relaxed)g(searc)m(h)h(parameters)g(for)f(tRNAscan)376
+386 y(analysis.)69 b(By)41 b(default,)i(\\strict")e(parameters)g(are)g
+(used.)70 b(Relaxed)41 b(parameters)f(ma)m(y)i(giv)m(e)376
+499 y(v)m(ery)30 b(sligh)m(tly)f(increased)h(searc)m(h)h(sensitivit)m
+(y)-8 b(,)29 b(but)h(increase)g(searc)m(h)h(time)f(b)m(y)g(20-40)j
+(fold.)238 686 y(-E)46 b(:)40 b(searc)m(h)31 b(using)e(Euk)-5
+b(ary)m(otic)31 b(tRNA)g(\014nder)d(\(Eu\014ndtRNA\))i(only)376
+837 y(This)20 b(option)i(runs)f(Eu\014ndtRNA)g(alone)h(to)i(searc)m(h)f
+(for)f(tRNAs.)38 b(Since)22 b(Co)m(v)m(e)i(is)d(not)i(b)s(eing)e(used)
+376 949 y(as)38 b(a)g(secondary)g(\014lter)f(to)h(remo)m(v)m(e)i(false)
+d(p)s(ositiv)m(es,)i(this)e(run)f(mo)s(de)i(defaults)f(to)h(\\normal")
+376 1062 y(parameters)43 b(whic)m(h)f(more)h(closely)g(appro)m(ximates)
+g(the)g(sensitivit)m(y)f(and)h(selectivit)m(y)g(of)g(the)376
+1175 y(original)37 b(algorithm)i(describ)s(e)f(b)m(y)h(P)m(a)m(v)m(esi)
+i(and)e(colleagues)h(\(see)h(the)f(next)f(option,)j(-e)e(for)g(a)376
+1288 y(description)28 b(of)j(the)f(v)-5 b(arious)29 b(run)g(mo)s
+(des\).)-12 1476 y(-e)i Fg(mo)-5 b(de)84 b Fj(:)46 b(explicitly)31
+b(set)j(Eu\014ndtRNA)e(params,)i(where)f Fg(mo)-5 b(de)42
+b Fj(=)33 b(R,)g(N,)h(or)f(S)g(\(relaxed,)i(normal,)e(or)376
+1589 y(strict\))376 1739 y(This)38 b(option)j(allo)m(ws)e(the)i(user)f
+(to)i(explicitly)c(set)j(the)g(parameters)g(for)f(Eu\014ndtRNA.)g(The)
+376 1852 y(\\relaxed")33 b(mo)s(de)f(is)g(used)h(for)f(Eu\014ndtRNA)g
+(when)g(using)f(tRNAscan-SE)i(in)f(default)g(mo)s(de.)376
+1965 y(With)39 b(relaxed)g(parameters,)j(tRNAs)e(that)g(lac)m(k)g(p)s
+(ol)e(I)s(I)s(I)g(p)s(oly-T)h(terminators)g(are)h(not)f(p)s(e-)376
+2078 y(nalized,)30 b(increasing)h(searc)m(h)h(sensitivit)m(y)-8
+b(,)31 b(but)f(decreasing)i(selectivit)m(y)-8 b(.)44
+b(When)32 b(Co)m(v)m(e)g(analysis)376 2191 y(is)37 b(b)s(eing)f(used)i
+(as)g(a)h(secondary)f(\014lter)f(for)h(false)g(p)s(ositiv)m(es)f(\(as)h
+(in)f(tRNAscan-SE's)i(default)376 2304 y(mo)s(de\),)30
+b(o)m(v)m(erall)h(selectivit)m(y)f(is)f(not)i(decreased.)376
+2567 y(Using)h(\\normal")i(parameters)f(with)g(Eu\014ndtRNA)e(do)s(es)j
+(incorp)s(orate)f(a)g(log)h(o)s(dds)e(score)i(for)376
+2680 y(the)j(distance)g(b)s(et)m(w)m(een)h(the)g(B)g(b)s(o)m(x)f(and)g
+(the)g(\014rst)g(p)s(oly-T)f(terminator,)j(but)e(do)s(es)g(not)g(dis-)
+376 2793 y(qualify)24 b(tRNAs)i(that)g(do)g(not)g(ha)m(v)m(e)h(a)f
+(terminator)g(signal)e(within)f(60)k(n)m(ucleotides.)38
+b(This)24 b(mo)s(de)376 2905 y(is)29 b(used)h(b)m(y)g(default)f(when)h
+(Co)m(v)m(e)i(analysis)d(is)g(not)i(b)s(eing)e(used)g(as)i(a)g
+(secondary)f(false)g(p)s(ositiv)m(e)376 3018 y(\014lter.)376
+3282 y(Using)24 b(\\strict")h(parameters)h(with)d(Eu\014ndtRNA)g(also)i
+(incorp)s(orates)g(a)g(log)g(o)s(dds)f(score)h(for)g(the)376
+3394 y(distance)30 b(b)s(et)m(w)m(een)i(the)f(B)g(b)s(o)m(x)f(and)h
+(the)g(\014rst)f(p)s(oly-T)f(terminator,)i(but)f Fg(r)-5
b(eje)g(cts)39 b Fj(tRNAs)31 b(that)376 3507 y(do)h(not)g(ha)m(v)m(e)i
-(suc)m(h)d(a)i(signal)g(within)f(60)h(n)m(ucleotides)g(of)g(the)f(end)g
-(of)g(the)g(B)h(b)s(o)m(x.)46 b(This)31 b(mo)s(de)376
-3620 y(most)26 b(closely)i(appro)m(ximates)g(the)f(originally)h
-(published)c(searc)m(h)j(algorithm)h(\(3\);)h(sensitivit)m(y)f(is)376
-3733 y(reduced)i(relativ)m(e)k(to)e(using)f(\\relaxed")i(and)e
-(\\normal")h(mo)s(des,)f(but)g(selectivit)m(y)j(is)e(increased)376
-3846 y(whic)m(h)42 b(is)g(imp)s(ortan)m(t)g(if)h(no)f(secondary)g
-(\014lter,)k(suc)m(h)c(as)g(Co)m(v)m(e)i(analysis,)i(is)c(b)s(eing)g
-(used)f(to)376 3959 y(remo)m(v)m(e)28 b(false)f(p)s(ositiv)m(es.)41
-b(This)25 b(mo)s(de)i(will)g(miss)f(most)h(prok)-5 b(ary)m(otic)28
-b(tRNAs)f(since)h(the)e(p)s(oly-T)376 4072 y(terminator)d(signal)g(is)f
-(a)h(feature)f(sp)s(eci\014c)h(to)g(euk)-5 b(ary)m(otic)24
-b(tRNAs)e(genes)h(\(alw)m(a)m(ys)i(use)d(\\relaxed")376
-4185 y(mo)s(de)30 b(for)g(scanning)g(prok)-5 b(ary)m(otic)32
-b(sequences)e(for)g(tRNAs\).)111 4372 y(-r)g Fg(\014le)53
+(suc)m(h)d(a)i(signal)e(within)f(60)j(n)m(ucleotides)e(of)i(the)f(end)g
+(of)g(the)g(B)h(b)s(o)m(x.)46 b(This)30 b(mo)s(de)376
+3620 y(most)c(closely)g(appro)m(ximates)h(the)g(originally)d(published)
+e(searc)m(h)27 b(algorithm)f(\(3\);)j(sensitivit)m(y)c(is)376
+3733 y(reduced)30 b(relativ)m(e)i(to)g(using)e(\\relaxed")i(and)f
+(\\normal")g(mo)s(des,)g(but)g(selectivit)m(y)g(is)g(increased)376
+3846 y(whic)m(h)41 b(is)g(imp)s(ortan)m(t)g(if)h(no)g(secondary)g
+(\014lter,)j(suc)m(h)d(as)g(Co)m(v)m(e)i(analysis,)g(is)d(b)s(eing)g
+(used)g(to)376 3959 y(remo)m(v)m(e)28 b(false)e(p)s(ositiv)m(es.)39
+b(This)24 b(mo)s(de)j(will)d(miss)h(most)i(prok)-5 b(ary)m(otic)27
+b(tRNAs)g(since)g(the)f(p)s(oly-T)376 4072 y(terminator)c(signal)f(is)g
+(a)i(feature)f(sp)s(eci\014c)g(to)h(euk)-5 b(ary)m(otic)23
+b(tRNAs)f(genes)h(\(alw)m(a)m(ys)h(use)e(\\relaxed")376
+4185 y(mo)s(de)30 b(for)g(scanning)f(prok)-5 b(ary)m(otic)31
+b(sequences)f(for)g(tRNAs\).)111 4372 y(-r)g Fg(\014le)53
b Fj(:)40 b(sa)m(v)m(e)32 b(tRNAscan/Eu\014ndtRNA)e(formatted)h(output)
-f(results)g(in)g Fg(\014le)376 4523 y Fj(Sa)m(v)m(es)43
-b(tabular,)j(formatted)e(output)e(results)g(from)h(tRNAscan)g(and/or)g
-(Eu\014ndtRNA)e(\014rst)376 4636 y(pass)28 b(scans)h(in)f
-Fg(\014le)p Fj(.)40 b(The)28 b(format)h(is)g(similar)g(to)h(the)e
-(\014nal)h(tabular)g(output)f(format,)h(except)h(no)376
-4749 y(Co)m(v)m(e)37 b(score)f(is)g(a)m(v)-5 b(ailable)38
-b(at)f(this)e(p)s(oin)m(t)h(in)g(the)g(searc)m(h)g(\(if)g(Eu\014ndtRNA)
-e(has)i(detected)h(the)376 4861 y(tRNA,)30 b(the)g(negativ)m(e)i(log)e
-(lik)m(eliho)s(o)s(d)h(score)f(is)f(giv)m(en\).)42 b(Also,)31
-b(the)f(sequence)g(ID)f(n)m(um)m(b)s(er)g(and)376 4974
-y(source)e(sequence)g(length)h(app)s(ear)e(in)h(the)g(columns)g(where)f
-(in)m(tron)h(b)s(ounds)e(are)i(sho)m(wn)g(in)f(\014nal)376
-5087 y(output.)48 b(This)33 b(option)g(ma)m(y)h(b)s(e)f(useful)f(for)h
-(examining)h(false)f(p)s(ositiv)m(e)i(tRNAs)e(predicted)g(b)m(y)376
-5200 y(\014rst-pass)c(scans)i(that)g(ha)m(v)m(e)g(b)s(een)f(\014ltered)
-g(out)h(b)m(y)f(Co)m(v)m(e)i(analysis.)1897 5525 y(16)p
-eop end
+f(results)f(in)g Fg(\014le)376 4523 y Fj(Sa)m(v)m(es)43
+b(tabular,)i(formatted)f(output)e(results)f(from)i(tRNAscan)g(and/or)g
+(Eu\014ndtRNA)e(\014rst)376 4636 y(pass)28 b(scans)h(in)e
+Fg(\014le)p Fj(.)40 b(The)28 b(format)h(is)f(similar)e(to)k(the)e
+(\014nal)g(tabular)g(output)g(format,)h(except)h(no)376
+4749 y(Co)m(v)m(e)37 b(score)f(is)f(a)m(v)-5 b(ailable)35
+b(at)i(this)d(p)s(oin)m(t)h(in)g(the)h(searc)m(h)g(\(if)f(Eu\014ndtRNA)
+f(has)i(detected)h(the)376 4861 y(tRNA,)30 b(the)g(negativ)m(e)h(log)e
+(lik)m(eliho)s(o)s(d)e(score)j(is)e(giv)m(en\).)41 b(Also,)30
+b(the)g(sequence)g(ID)f(n)m(um)m(b)s(er)g(and)376 4974
+y(source)e(sequence)g(length)g(app)s(ear)f(in)g(the)h(columns)f(where)g
+(in)m(tron)g(b)s(ounds)f(are)i(sho)m(wn)g(in)e(\014nal)376
+5087 y(output.)48 b(This)32 b(option)g(ma)m(y)i(b)s(e)f(useful)e(for)i
+(examining)f(false)g(p)s(ositiv)m(e)h(tRNAs)g(predicted)f(b)m(y)376
+5200 y(\014rst-pass)d(scans)i(that)g(ha)m(v)m(e)g(b)s(een)f(\014ltered)
+f(out)i(b)m(y)f(Co)m(v)m(e)i(analysis.)1897 5525 y(16)p
+eop
%%Page: 17 17
-TeXDict begin 17 16 bop 96 273 a Fj(-u)30 b Fg(\014le)53
-b Fj(:)48 b(searc)m(h)36 b(with)e(Co)m(v)m(e)i(only)e(those)h
-(sequences)g(&)f(regions)h(delimited)g(in)f Fg(\014le)41
-b Fj(\(tabular)35 b(results)376 386 y(\014le)30 b(format\))376
-536 y(This)g(option)h(allo)m(ws)h(the)f(user)g(to)g(re-generate)i
-(results)e(from)f(regions)i(iden)m(ti\014ed)f(to)g(ha)m(v)m(e)i(tR-)376
-649 y(NAs)f(b)m(y)f(a)i(previous)e(tRNAscan-SE)h(run.)44
-b(Either)32 b(a)g(regular)g(tabular)g(result)g(\014le,)h(or)e(output)
-376 762 y(sa)m(v)m(ed)f(with)f(the)g(-r)g(option)h(ma)m(y)g(b)s(e)f
-(used)f(as)i(the)f(sp)s(eci\014ed)g Fg(\014le)p Fj(.)40
-b(This)28 b(option)i(is)f(particularly)376 875 y(useful)f(for)i
-(generating)h(either)f(secondary)g(structure)f(output)g(\(-f)h
-(option\))h(or)e(A)m(CeDB)i(output)376 988 y(\(-a)f(option\))g(without)
-g(ha)m(ving)g(to)g(re-scan)g(en)m(tire)h(sequences.)40
-b(Alternativ)m(ely)-8 b(,)33 b(if)d(the)f(-r)h(option)376
-1101 y(is)d(used)g(to)h(generate)h(the)e(previous)g(results)g(\014le,)i
-(tRNAscan-SE)e(will)h(pic)m(k)g(up)e(at)i(the)g(stage)h(of)376
-1213 y(Co)m(v)m(e-con\014rmation)c(of)f(tRNAs)h(and)e(output)h(\014nal)
-f(tRNA)i(predicitons)e(as)i(with)e(a)h(normal)g(run.)376
-1477 y Fg(Note:)56 b Fj(the)37 b(-n)e(and)h(-s)g(options)g(will)g(not)h
-(w)m(ork)f(in)f(conjunction)h(with)g(this)g(option.)58
-b(Also,)38 b(if)376 1590 y(consecutiv)m(e)e(sequences)f(ha)m(v)m(e)g
-(iden)m(tical)h(names)f(in)f(the)g(sequence)h(\014le)g(b)s(eing)f
-(scanned,)h(only)376 1702 y(the)30 b(\014rst)g(sequence)h(will)f(b)s(e)
-g(scanned)g(in)g(the)h(regions)f(de\014ned)g(in)g(the)g(-u)g
+17 16 bop 96 273 a Fj(-u)30 b Fg(\014le)53 b Fj(:)48
+b(searc)m(h)36 b(with)d(Co)m(v)m(e)j(only)d(those)i(sequences)g(&)f
+(regions)g(delimited)e(in)h Fg(\014le)41 b Fj(\(tabular)34
+b(results)376 386 y(\014le)29 b(format\))376 536 y(This)g(option)h
+(allo)m(ws)g(the)h(user)g(to)g(re-generate)i(results)d(from)g(regions)h
+(iden)m(ti\014ed)e(to)i(ha)m(v)m(e)i(tR-)376 649 y(NAs)f(b)m(y)f(a)i
+(previous)d(tRNAscan-SE)i(run.)44 b(Either)31 b(a)h(regular)f(tabular)g
+(result)g(\014le,)h(or)f(output)376 762 y(sa)m(v)m(ed)f(with)e(the)h
+(-r)g(option)g(ma)m(y)h(b)s(e)f(used)f(as)i(the)f(sp)s(eci\014ed)f
+Fg(\014le)p Fj(.)40 b(This)27 b(option)i(is)f(particularly)376
+875 y(useful)f(for)j(generating)g(either)f(secondary)h(structure)f
+(output)g(\(-f)h(option\))g(or)f(A)m(CeDB)i(output)376
+988 y(\(-a)f(option\))f(without)g(ha)m(ving)g(to)h(re-scan)g(en)m(tire)
+g(sequences.)40 b(Alternativ)m(ely)-8 b(,)30 b(if)f(the)g(-r)h(option)
+376 1101 y(is)c(used)h(to)h(generate)h(the)e(previous)f(results)g
+(\014le,)i(tRNAscan-SE)f(will)e(pic)m(k)i(up)f(at)i(the)g(stage)h(of)
+376 1213 y(Co)m(v)m(e-con\014rmation)24 b(of)g(tRNAs)h(and)e(output)h
+(\014nal)e(tRNA)j(predicitons)c(as)k(with)d(a)i(normal)f(run.)376
+1477 y Fg(Note:)56 b Fj(the)37 b(-n)e(and)h(-s)g(options)f(will)e(not)k
+(w)m(ork)f(in)e(conjunction)h(with)g(this)g(option.)57
+b(Also,)37 b(if)376 1590 y(consecutiv)m(e)e(sequences)g(ha)m(v)m(e)g
+(iden)m(tical)e(names)i(in)e(the)h(sequence)h(\014le)f(b)s(eing)f
+(scanned,)i(only)376 1702 y(the)30 b(\014rst)g(sequence)h(will)c(b)s(e)
+j(scanned)g(in)f(the)i(regions)e(de\014ned)h(in)f(the)h(-u)g
Fg(\014le)p Fj(.)87 1890 y(-F)h Fg(\014le)53 b Fj(:)39
-b(sa)m(v)m(e)29 b(\014rst-pass)e(candidate)h(tRNAs)g(in)g
+b(sa)m(v)m(e)29 b(\014rst-pass)e(candidate)g(tRNAs)h(in)f
Fg(\014le)34 b Fj(that)28 b(w)m(ere)g(then)g(found)e(to)i(b)s(e)f
-(false)i(p)s(ositiv)m(es)f(b)m(y)376 2003 y(Co)m(v)m(e)j(analysis)376
-2153 y(This)i(option)h(sa)m(v)m(es)h(candidate)g(tRNAs)f(found)f(b)m(y)
-h(either)g(tRNAscan)h(and/or)f(Eu\014ndtRNA)376 2266
-y(that)28 b(w)m(ere)g(then)g(rejected)h(b)m(y)e(Co)m(v)m(e)j(analysis)e
-(as)g(b)s(eing)g(false)g(p)s(ositiv)m(es.)41 b(tRNAs)28
-b(are)g(sa)m(v)m(ed)h(in)376 2379 y(the)h(F)-10 b(AST)i(A)31
-b(sequence)f(format.)63 2567 y(-M)h Fg(\014le)53 b Fj(:)40
-b(sa)m(v)m(e)32 b(all)f(sequences)g(without)f(at)i(least)f(one)g(tRNA)g
-(hit)f(in)g Fg(\014le)376 2717 y Fj(This)37 b(option)h(ma)m(y)g(b)s(e)g
-(used)f(when)g(scanning)g(a)i(collection)h(of)e(kno)m(wn)g(tRNA)g
-(sequences)g(to)376 2830 y(iden)m(tify)g(p)s(ossible)g(false)h(negativ)
-m(es)h(\(incorreclt)m(y)h(missed)c(b)m(y)h(tRNAscan-SE\))i(or)e
-(sequences)376 2943 y(incorrectly)43 b(annotated)h(as)f(tRNAs)g
-(\(correctly)h(passed)e(o)m(v)m(er)i(b)m(y)f(tRNAscan-SE\).)g(Exami-)
-376 3056 y(nation)38 b(of)h(primary)e(&)h(secondary)g(structure)f(co)m
-(v)-5 b(ariance)41 b(mo)s(del)d(scores)h(\(-H)f(option\),)k(and)376
-3169 y(visual)e(insp)s(ection)h(of)g(secondary)g(structures)f(\(use)h
-(-F)g(option\))g(ma)m(y)h(b)s(e)e(helpful)f(resolving)376
-3282 y(iden)m(ti\014cation)32 b(con\015icts.)1897 5525
-y(17)p eop end
+(false)h(p)s(ositiv)m(es)e(b)m(y)376 2003 y(Co)m(v)m(e)31
+b(analysis)376 2153 y(This)h(option)h(sa)m(v)m(es)i(candidate)f(tRNAs)g
+(found)f(b)m(y)h(either)f(tRNAscan)i(and/or)f(Eu\014ndtRNA)376
+2266 y(that)28 b(w)m(ere)g(then)g(rejected)h(b)m(y)e(Co)m(v)m(e)j
+(analysis)c(as)i(b)s(eing)f(false)g(p)s(ositiv)m(es.)39
+b(tRNAs)28 b(are)g(sa)m(v)m(ed)h(in)376 2379 y(the)h(F)-10
+b(AST)i(A)31 b(sequence)f(format.)63 2567 y(-M)h Fg(\014le)53
+b Fj(:)40 b(sa)m(v)m(e)32 b(all)d(sequences)i(without)e(at)j(least)e
+(one)h(tRNA)g(hit)e(in)g Fg(\014le)376 2717 y Fj(This)36
+b(option)h(ma)m(y)h(b)s(e)g(used)f(when)g(scanning)f(a)j(collection)e
+(of)h(kno)m(wn)g(tRNA)g(sequences)g(to)376 2830 y(iden)m(tify)e(p)s
+(ossible)g(false)i(negativ)m(es)h(\(incorreclt)m(y)g(missed)d(b)m(y)i
+(tRNAscan-SE\))i(or)e(sequences)376 2943 y(incorrectly)j(annotated)j
+(as)f(tRNAs)g(\(correctly)g(passed)f(o)m(v)m(er)i(b)m(y)f
+(tRNAscan-SE\).)g(Exami-)376 3056 y(nation)37 b(of)i(primary)d(&)i
+(secondary)g(structure)f(co)m(v)-5 b(ariance)40 b(mo)s(del)d(scores)i
+(\(-H)f(option\),)j(and)376 3169 y(visual)d(insp)s(ection)h(of)i
+(secondary)g(structures)f(\(use)h(-F)g(option\))f(ma)m(y)i(b)s(e)e
+(helpful)d(resolving)376 3282 y(iden)m(ti\014cation)29
+b(con\015icts.)1897 5525 y(17)p eop
%%Page: 18 18
-TeXDict begin 18 17 bop 148 273 a Fl(6)135 b(Examples)148
-476 y Fj(Sev)m(eral)28 b(C.)f(elegans)h(cosmids)e(and)g(a)h(subset)g
-(of)f(the)h(Sprinzl)f(tRNA)h(database)h(\(animal)f(cytoplasmic)148
-589 y(+)k(eubacterial\))h(are)f(used)f(in)g(these)h(examples)g(to)h
-(illustrate)f(v)-5 b(arious)31 b(features)g(of)g(the)f(program;)h(all)
-148 702 y(ha)m(v)m(e)d(b)s(een)d(included)g(in)h(the)g(/Demo)h(sub)s
-(directory)e(so)i(the)f(user)f(ma)m(y)i(also)g(try)f(out)g(these)g
-(examples.)148 815 y(These)41 b(\014les)g(are)g(written)g(in)g(the)g(F)
+18 17 bop 148 273 a Fl(6)135 b(Examples)148 476 y Fj(Sev)m(eral)27
+b(C.)g(elegans)g(cosmids)e(and)h(a)h(subset)g(of)f(the)h(Sprinzl)d
+(tRNA)j(database)h(\(animal)d(cytoplasmic)148 589 y(+)31
+b(eubacterial\))f(are)h(used)f(in)f(these)i(examples)f(to)i(illustrate)
+c(v)-5 b(arious)30 b(features)h(of)g(the)f(program;)h(all)148
+702 y(ha)m(v)m(e)d(b)s(een)d(included)e(in)i(the)h(/Demo)h(sub)s
+(directory)d(so)j(the)f(user)f(ma)m(y)i(also)f(try)g(out)g(these)g
+(examples.)148 815 y(These)41 b(\014les)f(are)h(written)f(in)g(the)h(F)
-10 b(AST)i(A)41 b(sequence)g(format)h(and)e(ha)m(v)m(e)i(the)f(\014le)
-g(extension)h('.fa'.)148 927 y(Run)28 b(times)i(are)f(giv)m(en)i(for)d
-(an)h(R4400-200)k(Indigo)c(SGI,)g(and)f(are)i(appro)m(x.)40
-b(equal)30 b(on)f(a)g(DEC)g(Alpha)148 1040 y(2100/400)34
-b(190MHZ.)239 1251 y Fh(\))46 b Fj(T)-8 b(o)28 b(get)h(a)f(list)g(of)g
-(run)f(options,)i(t)m(yp)s(e)f(the)g(program)f(name)h(without)g(an)m(y)
-g(parameters)g(or)g(input)376 1364 y(sequence)i(\014les)423
-1626 y Fd(>)48 b(tRNAscan-SE)239 1946 y Fh(\))e Fj(Default)31
-b(run)e(mo)s(de,)h(one)h(sequence)g(&)f(no)g(parameters:)423
+f(extension)h('.fa'.)148 927 y(Run)28 b(times)h(are)g(giv)m(en)h(for)e
+(an)h(R4400-200)k(Indigo)28 b(SGI,)h(and)f(are)i(appro)m(x.)40
+b(equal)29 b(on)g(a)g(DEC)g(Alpha)148 1040 y(2100/400)34
+b(190MHZ.)239 1251 y Fh(\))46 b Fj(T)-8 b(o)28 b(get)h(a)f(list)e(of)i
+(run)f(options,)h(t)m(yp)s(e)g(the)g(program)f(name)h(without)f(an)m(y)
+h(parameters)g(or)g(input)376 1364 y(sequence)i(\014les)423
+1626 y Fd(>)48 b(tRNAscan-SE)239 1946 y Fh(\))e Fj(Default)30
+b(run)f(mo)s(de,)h(one)h(sequence)g(&)f(no)g(parameters:)423
2209 y Fd(>)48 b(tRNAscan-SE)c(F22B7.fa)376 2472 y Fj(The)29
-b(follo)m(wing)j(\(selected\))h(run)c(options)i(will)f(b)s(e)g(prin)m
-(ted)g(\014rst:)376 2719 y Fd(-----------------------)o(---)o(----)o
+b(follo)m(wing)g(\(selected\))j(run)d(options)h(will)d(b)s(e)j(prin)m
+(ted)f(\014rst:)376 2719 y Fd(-----------------------)o(---)o(----)o
(----)o(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
2832 y(Sequence)45 b(file\(s\))h(to)h(search:)94 b(F22B7.fa)376
2945 y(Results)45 b(written)h(to:)477 b(Standard)45 b(output)376
@@ -4466,31 +2952,31 @@ b(with:)667 b(tRNAscan)45 b(+)j(EufindtRNA)d(->)i(Cove)376
3284 y(tRNAscan)e(parameters:)427 b(Strict)376 3396 y(EufindtRNA)45
b(parameters:)331 b(Relaxed)45 b(\(Int)i(Cutoff=)f(-32.1\))376
3509 y(-----------------------)o(---)o(----)o(----)o(---)o(----)o(----)
-o(---)o(----)o(----)o(---)o(-)376 3757 y Fj(This)25 b(searc)m(h)j(pro)s
-(duces)d(tabular)i(output)f(results)g(of)h(5)g(tRNAs)g(for)g(the)f
-(40kbp)h(cosmid)g(F22B7.)376 3870 y(T)-8 b(ak)m(es)31
-b(ab)s(out)f(15)h(seconds.)239 4076 y Fh(\))46 b Fj(Sa)m(ving)31
-b(output)f(and)f(run)g(statistics)j(\014les)423 4339
+o(---)o(----)o(----)o(---)o(-)376 3757 y Fj(This)24 b(searc)m(h)k(pro)s
+(duces)d(tabular)h(output)g(results)f(of)i(5)g(tRNAs)g(for)g(the)f
+(40kbp)h(cosmid)f(F22B7.)376 3870 y(T)-8 b(ak)m(es)31
+b(ab)s(out)f(15)h(seconds.)239 4076 y Fh(\))46 b Fj(Sa)m(ving)30
+b(output)g(and)f(run)g(statistics)h(\014les)423 4339
y Fd(>)48 b(tRNAscan-SE)c(-o)k(mytrnas)d(-m)j(mystats)d(C28G1.fa)376
-4602 y Fj(The)29 b(follo)m(wing)j(\(selected\))h(run)c(options)i(will)f
-(b)s(e)g(prin)m(ted)g(\014rst:)376 4825 y Fd(-----------------------)o
+4602 y Fj(The)29 b(follo)m(wing)g(\(selected\))j(run)d(options)h(will)d
+(b)s(e)j(prin)m(ted)f(\014rst:)376 4825 y Fd(-----------------------)o
(---)o(----)o(----)o(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)
376 4938 y(Sequence)45 b(file\(s\))h(to)h(search:)94
b(C28G1.fa)376 5051 y(Results)45 b(written)h(to:)477
b(mytrnas)376 5163 y(Output)46 b(format:)714 b(Tabular)376
5276 y(Searching)45 b(with:)667 b(tRNAscan)45 b(+)j(EufindtRNA)d(->)i
-(Cove)1897 5525 y Fj(18)p eop end
+(Cove)1897 5525 y Fj(18)p eop
%%Page: 19 19
-TeXDict begin 19 18 bop 376 273 a Fd(tRNAscan)45 b(parameters:)427
+19 18 bop 376 273 a Fd(tRNAscan)45 b(parameters:)427
b(Strict)376 386 y(EufindtRNA)45 b(parameters:)331 b(Relaxed)45
b(\(Int)i(Cutoff=)f(-32.1\))376 499 y(Search)g(statistics)f(saved)h
(in:)95 b(mystats)376 612 y(-----------------------)o(---)o(----)o
(----)o(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
-818 y Fj(Default)29 b(searc)m(h)h(mo)s(de,)f(sa)m(v)m(es)h(tabular)f
-(output)f(results)h(for)f(cosmid)h(C28G1)h(in)f(\014le)g('m)m(ytrnas')
-376 931 y(and)g(run)g(statistics)k(in)d(\014le)g('m)m(ystats'.)239
-1132 y Fh(\))46 b Fj(Using)25 b('#')g(as)g(shorthand)f(for)h(default)g
-(output)g(\014le)g(names,)h(sa)m(ving)g(output)e(in)h(A)m(CeDB)i
+818 y Fj(Default)28 b(searc)m(h)i(mo)s(de,)f(sa)m(v)m(es)h(tabular)e
+(output)g(results)g(for)g(cosmid)g(C28G1)i(in)e(\014le)g('m)m(ytrnas')
+376 931 y(and)h(run)g(statistics)i(in)e(\014le)g('m)m(ystats'.)239
+1132 y Fh(\))46 b Fj(Using)24 b('#')h(as)g(shorthand)f(for)h(default)f
+(output)h(\014le)f(names,)i(sa)m(ving)f(output)f(in)g(A)m(CeDB)j
(format)423 1392 y Fd(>)48 b(tRNAscan-SE)c(-a)k(-o#)f(-m#)f(C28G1.fa)
376 1599 y(-----------------------)o(---)o(----)o(----)o(---)o(----)o
(----)o(---)o(----)o(----)o(---)o(-)376 1712 y(Sequence)f(file\(s\))h
@@ -4502,16 +2988,16 @@ b(C28G1.out)376 1937 y(Output)46 b(format:)714 b(ACeDB)376
(-32.1\))376 2389 y(Search)g(statistics)f(saved)h(in:)95
b(C28G1.stats)376 2502 y(-----------------------)o(---)o(----)o(----)o
(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
-2708 y Fj(This)33 b(is)h(the)g(same)g(searc)m(h)g(as)h(the)f
-(immediately)h(preceding)f(example,)h(but)e(\014nal)h(results)g(are)376
-2821 y(sa)m(v)m(ed)40 b(in)f(the)g(\014le)g('C28G1.out')j(and)c(the)i
-(statistics)h(summary)d(is)h(sa)m(v)m(ed)h(in)f('C28G1.stats')376
-2934 y(using)d(the)h('#')h(shorthand)e(for)g(default)i(output)e(\014le)
-i(names.)60 b(Also,)40 b(the)d(results)g(written)g(to)376
-3047 y('C28G1.out')32 b(are)f(in)f(the)h(A)m(CeDB)h(format)e(b)s
-(ecause)h(the)f(-a)h(option)g(w)m(as)g(used.)239 3248
-y Fh(\))46 b Fj(Sa)m(ving)31 b(secondary)f(structure)g(information)376
-3361 y(Changing)g(name)g(of)h(default)f(output)g(\014le)h(name)f
+2708 y Fj(This)32 b(is)h(the)h(same)g(searc)m(h)g(as)h(the)f
+(immediately)e(preceding)h(example,)h(but)f(\014nal)g(results)g(are)376
+2821 y(sa)m(v)m(ed)40 b(in)e(the)h(\014le)f('C28G1.out')k(and)c(the)i
+(statistics)f(summary)f(is)g(sa)m(v)m(ed)i(in)e('C28G1.stats')376
+2934 y(using)d(the)i('#')h(shorthand)e(for)g(default)h(output)f(\014le)
+h(names.)60 b(Also,)39 b(the)e(results)f(written)g(to)376
+3047 y('C28G1.out')c(are)f(in)e(the)i(A)m(CeDB)h(format)e(b)s(ecause)h
+(the)f(-a)h(option)f(w)m(as)h(used.)239 3248 y Fh(\))46
+b Fj(Sa)m(ving)30 b(secondary)g(structure)g(information)376
+3361 y(Changing)f(name)h(of)h(default)e(output)h(\014le)g(name)g
(pre\014x)423 3621 y Fd(>)48 b(tRNAscan-SE)c(-p)k(mycosmid)d(-f#)i(-m#)
g(C28G1.fa)376 3828 y(-----------------------)o(---)o(----)o(----)o
(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
@@ -4525,19 +3011,19 @@ b(parameters:)331 b(Relaxed)45 b(\(Int)i(Cutoff=)f(-32.1\))376
(to:)190 b(mycosmid.ss)376 4844 y(Search)46 b(statistics)f(saved)h(in:)
95 b(mycosmid.stats)376 4957 y(-----------------------)o(---)o(----)o
(----)o(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
-5163 y Fj(This)27 b(searc)m(h)h(sends)f(the)i(tabular)f(results)f(to)i
-(standard)e(output)h(since)g(no)g(-o)h(option)f(w)m(as)h(used.)376
-5276 y(Secondary)22 b(structure)h(information)h(for)f(all)h(tRNAs)f(w)m
-(as)h(sa)m(v)m(ed)g(in)f(\014le)g('m)m(ycosmid.ss')h(and)e(run)1897
-5525 y(19)p eop end
+5163 y Fj(This)26 b(searc)m(h)i(sends)f(the)i(tabular)e(results)f(to)j
+(standard)e(output)h(since)f(no)h(-o)h(option)e(w)m(as)i(used.)376
+5276 y(Secondary)22 b(structure)h(information)f(for)h(all)f(tRNAs)h(w)m
+(as)h(sa)m(v)m(ed)g(in)e(\014le)g('m)m(ycosmid.ss')h(and)f(run)1897
+5525 y(19)p eop
%%Page: 20 20
-TeXDict begin 20 19 bop 376 273 a Fj(stats)35 b(w)m(ere)h(sa)m(v)m(ed)f
-(in)g('m)m(ycosmid.stats')i(since)e(the)g(default)g(\014le)g(name)g
-(pre\014x)f(w)m(as)h(sp)s(eci\014ed)376 386 y(as)30 b('m)m(ycosmid')h
-(using)f(the)h(-p)f(option.)239 593 y Fh(\))46 b Fj(Searc)m(hing)30
-b(only)h(sequences)g(matc)m(hing)g(a)g(sp)s(eci\014ed)e(name)376
-706 y(Searc)m(hing)h(with)h(Prok)-5 b(ary)m(otic)32 b(searc)m(h)f
-(parameters)376 819 y(Viewing)g(progress)f(of)g(the)h(searc)m(h)g
+20 19 bop 376 273 a Fj(stats)35 b(w)m(ere)h(sa)m(v)m(ed)f(in)f('m)m
+(ycosmid.stats')i(since)e(the)h(default)f(\014le)g(name)h(pre\014x)f(w)
+m(as)h(sp)s(eci\014ed)376 386 y(as)30 b('m)m(ycosmid')g(using)f(the)i
+(-p)f(option.)239 593 y Fh(\))46 b Fj(Searc)m(hing)29
+b(only)h(sequences)h(matc)m(hing)f(a)h(sp)s(eci\014ed)d(name)376
+706 y(Searc)m(hing)h(with)h(Prok)-5 b(ary)m(otic)31 b(searc)m(h)g
+(parameters)376 819 y(Viewing)e(progress)h(of)g(the)h(searc)m(h)g
(analysis)423 1082 y Fd(>)48 b(tRNAscan-SE)c(-d)k(-P)f(-o#)g(-n)g
('DE*')f(Sprz-sub.fa)376 1307 y(-----------------------)o(---)o(----)o
(----)o(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
@@ -4549,50 +3035,50 @@ b(with:)667 b(tRNAscan)45 b(+)j(EufindtRNA)d(->)i(Cove)376
1984 y(tRNAscan)e(parameters:)427 b(Strict)376 2097 y(EufindtRNA)45
b(parameters:)331 b(Relaxed)45 b(\(Int)i(Cutoff=)f(-36\))376
2210 y(-----------------------)o(---)o(----)o(----)o(---)o(----)o(----)
-o(---)o(----)o(----)o(---)o(-)376 2435 y Fj(In)24 b(this)h(example,)i
-(the)e(program's)g(progress)g(is)g(displa)m(y)m(ed)g(\(-d)g(option\))h
-(as)f(it)h(searc)m(hes)g(through)376 2548 y(the)43 b(input)f(sequence)h
-(\014le)g(in)f(this)h(example.)79 b(This)42 b(searc)m(h)h(will)h(only)f
-(analyze)h(the)f(39)h(se-)376 2661 y(quences)32 b(in)g(the)g(\014le)g
-(Sprz-sub.fa)f(\(1013)j(total)g(seqs\))f(with)e(names)h(matc)m(hing)i
-(the)e('DE*')h(k)m(ey)376 2774 y(\(ie.)41 b(DE1140,)33
-b(DE1180,)g(DE1200,)f(etc\).)376 3037 y(Since)k(man)m(y)h(of)f(the)h
-(sequences)g(in)f(this)g(searc)m(h)h(are)g(from)f(prok)-5
-b(ary)m(otes,)39 b(the)e(-P)g(parameter)376 3150 y(is)k(used)g(to)h
-(increase)g(searc)m(h)h(sensitivit)m(y)f(to)h(detect)g(prok)-5
-b(ary)m(otic)42 b(tRNAs)g(that)g(matc)m(h)h(the)376 3263
-y(consensus)27 b(A)h(and)g(B)g(b)s(o)m(xes)h(less)f(closely)i(than)d
-(euk)-5 b(ary)m(otic)30 b(tRNAs)f(\(the)g(Eu\014ndtRNA)d(in)m(ter-)376
-3376 y(mediate)h(Cuto\013)e(is)h(set)h(to)f(-36)h(instead)f(of)g(the)g
-(default)g(-32.1;)k(the)c(lo)m(w)m(er)h(the)f(cuto\013,)i(the)e(more)
-376 3489 y(sensitiv)m(e)32 b(the)f(searc)m(h\).)42 b(Also,)32
-b(the)f(prok)-5 b(ary)m(otic)32 b(tRNA)f(mo)s(del)g(is)g(used)f(in)g
-(co)m(v)-5 b(ariance)33 b(mo)s(del)376 3602 y(analysis.)239
-3922 y Fh(\))46 b Fj(Searc)m(h)30 b(for)g(tRNAs)h(using)f(Co)m(v)m(e)i
-(analysis)f(only)423 4185 y Fd(>)48 b(tRNAscan-SE)c(-C)k(-p)f(F22B7cov)
-e(-o#)i(-m#)g(F22B7.fa)376 4410 y(-----------------------)o(---)o(----)
-o(----)o(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
-4523 y(Sequence)e(file\(s\))h(to)h(search:)94 b(F22B7.fa)376
-4636 y(Results)45 b(written)h(to:)477 b(F22B7cov.out)376
-4749 y(Output)46 b(format:)714 b(Tabular)376 4862 y(Searching)45
-b(with:)667 b(Cove)46 b(only)376 4975 y(Search)g(statistics)f(saved)h
-(in:)95 b(F22B7cov.stats)376 5087 y(-----------------------)o(---)o
-(----)o(----)o(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)1897
-5525 y Fj(20)p eop end
+o(---)o(----)o(----)o(---)o(-)376 2435 y Fj(In)24 b(this)g(example,)i
+(the)f(program's)g(progress)g(is)f(displa)m(y)m(ed)f(\(-d)i(option\))g
+(as)g(it)g(searc)m(hes)h(through)376 2548 y(the)43 b(input)e(sequence)i
+(\014le)f(in)f(this)h(example.)78 b(This)41 b(searc)m(h)i(will)e(only)h
+(analyze)h(the)g(39)h(se-)376 2661 y(quences)32 b(in)f(the)h(\014le)f
+(Sprz-sub.fa)g(\(1013)j(total)f(seqs\))g(with)d(names)i(matc)m(hing)h
+(the)f('DE*')h(k)m(ey)376 2774 y(\(ie.)40 b(DE1140,)33
+b(DE1180,)g(DE1200,)f(etc\).)376 3037 y(Since)j(man)m(y)i(of)f(the)h
+(sequences)g(in)e(this)g(searc)m(h)i(are)g(from)f(prok)-5
+b(ary)m(otes,)39 b(the)e(-P)g(parameter)376 3150 y(is)j(used)h(to)h
+(increase)f(searc)m(h)i(sensitivit)m(y)c(to)k(detect)g(prok)-5
+b(ary)m(otic)41 b(tRNAs)h(that)g(matc)m(h)h(the)376 3263
+y(consensus)27 b(A)h(and)g(B)g(b)s(o)m(xes)h(less)e(closely)h(than)f
+(euk)-5 b(ary)m(otic)29 b(tRNAs)g(\(the)g(Eu\014ndtRNA)d(in)m(ter-)376
+3376 y(mediate)g(Cuto\013)f(is)g(set)i(to)f(-36)h(instead)e(of)h(the)g
+(default)f(-32.1;)30 b(the)c(lo)m(w)m(er)g(the)g(cuto\013,)i(the)e
+(more)376 3489 y(sensitiv)m(e)k(the)h(searc)m(h\).)42
+b(Also,)31 b(the)g(prok)-5 b(ary)m(otic)31 b(tRNA)g(mo)s(del)f(is)g
+(used)g(in)f(co)m(v)-5 b(ariance)32 b(mo)s(del)376 3602
+y(analysis.)239 3922 y Fh(\))46 b Fj(Searc)m(h)30 b(for)g(tRNAs)h
+(using)e(Co)m(v)m(e)j(analysis)d(only)423 4185 y Fd(>)48
+b(tRNAscan-SE)c(-C)k(-p)f(F22B7cov)e(-o#)i(-m#)g(F22B7.fa)376
+4410 y(-----------------------)o(---)o(----)o(----)o(---)o(----)o(----)
+o(---)o(----)o(----)o(---)o(-)376 4523 y(Sequence)e(file\(s\))h(to)h
+(search:)94 b(F22B7.fa)376 4636 y(Results)45 b(written)h(to:)477
+b(F22B7cov.out)376 4749 y(Output)46 b(format:)714 b(Tabular)376
+4862 y(Searching)45 b(with:)667 b(Cove)46 b(only)376
+4975 y(Search)g(statistics)f(saved)h(in:)95 b(F22B7cov.stats)376
+5087 y(-----------------------)o(---)o(----)o(----)o(---)o(----)o(----)
+o(---)o(----)o(----)o(---)o(-)1897 5525 y Fj(20)p eop
%%Page: 21 21
-TeXDict begin 21 20 bop 376 273 a Fj(F)-8 b(or)27 b(users)e(with)h(the)
-h(computational)h(resources)f(to)g(spare,)g(sequences)g(can)f(b)s(e)g
-(analyzed)i(using)376 386 y(Co)m(v)m(e)37 b(analysis)g(only)f
-(\(tRNAscan)h(and)e(Eu\014ndtRNA)g(are)h(not)g(used)f(as)i(a)f
-(pre-\014lter\).)58 b(This)376 499 y(option)25 b(is)h(up)e(to)i(3,000)i
-(times)e(slo)m(w)m(er)g(than)g(using)e(the)i(default)g(searc)m(h)g(mo)s
+21 20 bop 376 273 a Fj(F)-8 b(or)27 b(users)e(with)g(the)i
+(computational)f(resources)h(to)g(spare,)g(sequences)g(can)f(b)s(e)g
+(analyzed)h(using)376 386 y(Co)m(v)m(e)37 b(analysis)e(only)g
+(\(tRNAscan)i(and)e(Eu\014ndtRNA)g(are)h(not)g(used)f(as)i(a)f
+(pre-\014lter\).)57 b(This)376 499 y(option)24 b(is)h(up)f(to)i(3,000)i
+(times)d(slo)m(w)m(er)g(than)h(using)d(the)j(default)f(searc)m(h)h(mo)s
(de,)g(but)f(ma)m(y)h(detect)376 612 y(up)j(to)j(1\045)f(of)g(the)g
-(tRNAs)g(missed)f(b)m(y)h(tRNAscan-SE)g(in)g(default)g(run)e(mo)s(de.)
-41 b(This)30 b(example)376 724 y(searc)m(hes)c(the)g(F22B7)i(cosmid)e
-(and)f(\014nds)g(no)g(additional)i(tRNAs)f(o)m(v)m(er)i(default)e
-(tRNAscan-SE)376 837 y(run)j(mo)s(de.)40 b(T)-8 b(ak)m(es)31
+(tRNAs)g(missed)e(b)m(y)i(tRNAscan-SE)g(in)f(default)g(run)f(mo)s(de.)
+41 b(This)29 b(example)376 724 y(searc)m(hes)d(the)g(F22B7)i(cosmid)d
+(and)g(\014nds)g(no)g(additional)f(tRNAs)i(o)m(v)m(er)i(default)d
+(tRNAscan-SE)376 837 y(run)k(mo)s(de.)40 b(T)-8 b(ak)m(es)31
b(ab)s(out)f(sev)m(en)m(t)m(y)j(min)m(utes.)239 1045
-y Fh(\))46 b Fj(Searc)m(h)30 b(using)g(tRNAscan)h(analysis)g(only)423
+y Fh(\))46 b Fj(Searc)m(h)30 b(using)f(tRNAscan)i(analysis)e(only)423
1308 y Fd(>)48 b(tRNAscan-SE)c(-T)k(-p)f(sprinzl.tscan)d(-l#)j(-m#)g
(Sprz-sub.fa)376 1533 y(-----------------------)o(---)o(----)o(----)o
(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
@@ -4604,53 +3090,52 @@ b(Strict)376 2210 y(Search)46 b(log)h(saved)f(in:)429
b(sprinzl.tscan.log)376 2323 y(Search)46 b(statistics)f(saved)h(in:)95
b(sprinzl.tscan.stats)376 2436 y(-----------------------)o(---)o(----)o
(----)o(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
-2661 y Fj(Using)32 b(the)h(-T)f(option)h(appro)m(ximates)g(using)f
-(tRNAscan)h(v1.3)h(only)e(\(less)h(sensitiv)m(e)h(and)e(less)376
-2774 y(selectiv)m(e\).)64 b(The)36 b(-l)i(option)g(sa)m(v)m(es)g(a)g
-(log)g(of)f(the)h(program)f(run)f(in)g('sprinzl.tscan.log'.)64
+2661 y Fj(Using)31 b(the)i(-T)f(option)g(appro)m(ximates)g(using)f
+(tRNAscan)i(v1.3)h(only)d(\(less)h(sensitiv)m(e)g(and)g(less)376
+2774 y(selectiv)m(e\).)62 b(The)36 b(-l)h(option)g(sa)m(v)m(es)h(a)g
+(log)f(of)g(the)h(program)f(run)f(in)f('sprinzl.tscan.log'.)61
b(The)376 2887 y(searc)m(h)31 b(\014nds)f(962/1013)35
-b(tRNAs)c(in)g(ab)s(out)g(40)h(seconds,)g(v)m(ersus)f(the)g(same)h
-(searc)m(h)g(in)f(default)376 3000 y(mo)s(de)26 b(whic)m(h)h(\014nds)e
-(1007/1013)31 b(tRNAs)c(in)g(ab)s(out)g(17)g(min)m(utes)g(\(searc)m(h)h
-(sp)s(eed)e(go)s(es)i(do)m(wn)e(for)376 3113 y(default)k(mo)s(de)g(as)h
-(densit)m(y)f(of)h(tRNAs)g(in)f(input)f(sequence\(s\))j(go)s(es)f
-(up\).)239 3320 y Fh(\))46 b Fj(Using)36 b(a)h(previous)g(result)f
-(\014le)h(to)g(get)h(secondary)f(structure)f(and)g(A)m(CeDB)i(output)e
-(without)376 3433 y(re-scanning)30 b(en)m(tire)h(sequence\(s\))376
-3583 y(First,)g(re-run)e(an)h(example)h(from)f(ab)s(o)m(v)m(e,)i(this)e
-(time)h(sa)m(ving)g(the)g(tabular)f(output)g(results:)423
+b(tRNAs)c(in)f(ab)s(out)h(40)h(seconds,)g(v)m(ersus)f(the)g(same)h
+(searc)m(h)g(in)e(default)376 3000 y(mo)s(de)c(whic)m(h)g(\014nds)f
+(1007/1013)31 b(tRNAs)c(in)f(ab)s(out)h(17)g(min)m(utes)f(\(searc)m(h)i
+(sp)s(eed)e(go)s(es)i(do)m(wn)e(for)376 3113 y(default)j(mo)s(de)h(as)h
+(densit)m(y)e(of)i(tRNAs)g(in)e(input)f(sequence\(s\))k(go)s(es)f
+(up\).)239 3320 y Fh(\))46 b Fj(Using)35 b(a)i(previous)f(result)f
+(\014le)h(to)h(get)h(secondary)f(structure)f(and)g(A)m(CeDB)i(output)e
+(without)376 3433 y(re-scanning)29 b(en)m(tire)h(sequence\(s\))376
+3583 y(First,)g(re-run)f(an)h(example)g(from)g(ab)s(o)m(v)m(e,)i(this)d
+(time)h(sa)m(ving)g(the)h(tabular)e(output)h(results:)423
3846 y Fd(>)48 b(tRNAscan-SE)c(-o#)j(F22B7.fa)376 4109
-y Fj(No)m(w,)d(supp)s(ose)c(y)m(ou'd)h(lik)m(e)h(to)g(see)g(the)f
+y Fj(No)m(w,)d(supp)s(ose)c(y)m(ou'd)h(lik)m(e)f(to)i(see)g(the)f
(secondary)g(structures)f(\(and/or)i(pro)s(duce)e(A)m(CeDB)376
-4222 y(output\))35 b(for)g(the)g(tRNAs)h(in)f(this)g(sequence.)56
-b(Instead)35 b(of)h(re-scanning)f(the)g(en)m(tire)i(sequence)376
-4335 y(with)26 b(a)h(completely)h(new)e(run,)g(sp)s(ecify)g(that)h
-(tRNAscan-SE)g(should)e(only)i(scan)g(those)g(regions)376
-4448 y(kno)m(wn)j(to)h(ha)m(v)m(e)h(tRNAs)f(from)f(a)i(previous)e
-(tRNAscan-SE)h(run.)40 b(In)30 b(the)h(follo)m(wing)h(example,)376
-4561 y(the)d(pre-existing)g(result)g(\014le)g(\\F22B7.out")k(is)c(sp)s
-(eci\014ed)f(with)h(the)g(-u)f(parameter,)i(pro)s(ducing)376
-4674 y(results)g(faster)g(than)h(a)f(complete)i(re-scan)f(of)g(the)f
-(whole)h(cosmid:)1897 5525 y(21)p eop end
+4222 y(output\))35 b(for)g(the)g(tRNAs)h(in)e(this)g(sequence.)56
+b(Instead)35 b(of)h(re-scanning)e(the)h(en)m(tire)h(sequence)376
+4335 y(with)25 b(a)i(completely)f(new)g(run,)g(sp)s(ecify)f(that)i
+(tRNAscan-SE)g(should)d(only)i(scan)h(those)g(regions)376
+4448 y(kno)m(wn)j(to)h(ha)m(v)m(e)h(tRNAs)f(from)f(a)i(previous)d
+(tRNAscan-SE)i(run.)40 b(In)30 b(the)h(follo)m(wing)e(example,)376
+4561 y(the)g(pre-existing)e(result)h(\014le)g(\\F22B7.out")33
+b(is)28 b(sp)s(eci\014ed)f(with)h(the)h(-u)f(parameter,)i(pro)s(ducing)
+376 4674 y(results)f(faster)h(than)h(a)f(complete)h(re-scan)g(of)g(the)
+f(whole)g(cosmid:)1897 5525 y(21)p eop
%%Page: 22 22
-TeXDict begin 22 21 bop 423 273 a Fd(>)48 b(tRNAscan-SE)c(-u)k
-(F22B7.out)d(-f#)i(-a)g(-o)g(F22B7.ace)e(F22B7.fa)376
-498 y(-----------------------)o(---)o(----)o(----)o(---)o(----)o(----)o
-(---)o(----)o(----)o(---)o(-)376 611 y(Sequence)g(file\(s\))h(to)h
-(search:)94 b(F22B7.fa)376 724 y(Results)45 b(written)h(to:)477
-b(F22B7.ace)376 837 y(Output)46 b(format:)714 b(ACeDB)376
-949 y(Searching)45 b(with:)667 b(Cove)46 b(only)376 1062
-y(Using)g(previous)376 1175 y(tabular)f(output)h(file:)429
-b(F22B7.out)376 1288 y(tRNA)46 b(secondary)f(structure)566
-1401 y(predictions)g(saved)i(to:)190 b(F22B7.ss)376 1514
-y(-----------------------)o(---)o(----)o(----)o(---)o(----)o(----)o
-(---)o(----)o(----)o(---)o(-)376 1739 y Fj(The)24 b(secondary)g
-(structures)g(for)g(these)h(tRNAs)g(are)g(sa)m(v)m(ed)h(in)e
-(\\F22B7.ss")k(and)c(the)g(results)h(are)376 1852 y(sa)m(v)m(ed)35
-b(in)e(A)m(CeDB)i(format)g(in)e(the)h(\014le)g(\\F22B7.ace".)56
-b(Useful)34 b(for)f(re-scanning)h(just)g(tRNAs)376 1965
-y(in)c(large)h(sequences)g(or)f(sequence)h(sets.)239
-2172 y Fh(\))46 b Fj(Using)30 b(an)g(alternate)j(genetic)f(co)s(de)e
+22 21 bop 423 273 a Fd(>)48 b(tRNAscan-SE)c(-u)k(F22B7.out)d(-f#)i(-a)g
+(-o)g(F22B7.ace)e(F22B7.fa)376 498 y(-----------------------)o(---)o
+(----)o(----)o(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
+611 y(Sequence)g(file\(s\))h(to)h(search:)94 b(F22B7.fa)376
+724 y(Results)45 b(written)h(to:)477 b(F22B7.ace)376
+837 y(Output)46 b(format:)714 b(ACeDB)376 949 y(Searching)45
+b(with:)667 b(Cove)46 b(only)376 1062 y(Using)g(previous)376
+1175 y(tabular)f(output)h(file:)429 b(F22B7.out)376 1288
+y(tRNA)46 b(secondary)f(structure)566 1401 y(predictions)g(saved)i(to:)
+190 b(F22B7.ss)376 1514 y(-----------------------)o(---)o(----)o(----)o
+(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
+1739 y Fj(The)24 b(secondary)g(structures)g(for)g(these)h(tRNAs)g(are)g
+(sa)m(v)m(ed)h(in)d(\\F22B7.ss")28 b(and)c(the)g(results)g(are)376
+1852 y(sa)m(v)m(ed)35 b(in)d(A)m(CeDB)j(format)g(in)d(the)i(\014le)f
+(\\F22B7.ace".)56 b(Useful)33 b(for)g(re-scanning)g(just)h(tRNAs)376
+1965 y(in)29 b(large)h(sequences)h(or)f(sequence)h(sets.)239
+2172 y Fh(\))46 b Fj(Using)29 b(an)h(alternate)i(genetic)f(co)s(de)f
(\014le)423 2435 y Fd(>)48 b(tRNAscan-SE)c(-g)k(gcode.cilnuc)c
(DQ6060.fa)376 2660 y(-----------------------)o(---)o(----)o(----)o
(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
@@ -4663,66 +3148,65 @@ b(parameters:)331 b(Relaxed)45 b(\(Int)i(Cutoff=)f(-32.1\))376
3451 y(Alternate)f(transl)h(code)h(used:)94 b(from)46
b(file)h(gcode.cilnuc)376 3563 y(-----------------------)o(---)o(----)o
(----)o(---)o(----)o(----)o(---)o(----)o(----)o(---)o(-)376
-3788 y Fj(The)23 b(tRNA)i(used)e(in)h(this)g(example)h(is)f(from)f(T)-8
-b(etrah)m(ymena)25 b(thermophila,)h(a)f(ciliate)h(protozoan)376
-3901 y(with)d(an)h(alternate)h(translation)g(of)e(the)h(co)s(don)g(T)-8
-b(AA)24 b(\(normally)g(a)g(stop)g(co)s(don\))g(to)g(glutamine.)376
-4014 y(By)35 b(using)f(the)i(alternate)g(translations)g(sp)s(eci\014ed)
-f(in)f(the)h(included)g(\014le)g(\\gco)s(de.ciln)m(uc",)k(the)376
-4127 y(correct)31 b(tRNA)g(t)m(yp)s(e)g(is)f(output.)1897
-5525 y(22)p eop end
+3788 y Fj(The)23 b(tRNA)i(used)e(in)g(this)g(example)h(is)f(from)g(T)-8
+b(etrah)m(ymena)25 b(thermophila,)f(a)h(ciliate)e(protozoan)376
+3901 y(with)f(an)i(alternate)g(translation)f(of)g(the)h(co)s(don)g(T)-8
+b(AA)24 b(\(normally)e(a)i(stop)g(co)s(don\))g(to)g(glutamine.)376
+4014 y(By)35 b(using)e(the)j(alternate)f(translations)f(sp)s(eci\014ed)
+g(in)f(the)i(included)e(\014le)h(\\gco)s(de.ciln)m(uc",)j(the)376
+4127 y(correct)31 b(tRNA)g(t)m(yp)s(e)g(is)e(output.)1897
+5525 y(22)p eop
%%Page: 23 23
-TeXDict begin 23 22 bop 148 273 a Fl(7)135 b(Supp)t(ort)44
-b(/)h(Bug)f(Rep)t(orts)i(/)f(Requests)h(for)f(added)g(options)148
-476 y Fj(This)26 b(is)g(the)h(\014rst)f(release)i(of)e(tRNAscan-SE,)h
-(so)g(there)g(are)g(b)s(ound)d(to)j(b)s(e)f(minor)g(problems)g(that)h
-(will)148 589 y(need)34 b(to)g(b)s(e)g(\014xed)f(\(although)h(w)m(e'v)m
-(e)i(made)e(ev)m(ery)g(attempt)h(to)g(catc)m(h)g(all)g(problems)e(on)h
-(SGI,)f(Sun,)148 702 y(DEC)27 b(Alpha,)g(and)f(In)m(tel)h(mac)m
-(hines\).)40 b(The)26 b(user)g(is)g(free)h(to)g(either)g(\014x)f(the)g
-(bug)g(him/herself,)h(or)g(send)148 815 y(me)37 b(detailed)h
-(information)e(on)h(the)g(problem)f(\(email)i(to)f(T)-8
-b(o)s(dd)35 b(Lo)m(w)m(e,)40 b(lo)m(w)m(e at genetics.wustl.edu\),)148
-927 y(and)21 b(I)g(will)h(mak)m(e)h(reasonable)f(e\013orts)g(to)g
-(remedy)f(the)h(problem.)37 b(If)21 b(y)m(ou)h(do)f(decide)h(to)g
-(\014x)f(the)h(problem)148 1040 y(y)m(ourself,)29 b(I)e(w)m(ould)g(lik)
-m(e)i(to)f(b)s(e)f(noti\014ed)g(so)h(that)g(I)f(ma)m(y)h(mak)m(e)h(the)
-e(c)m(hange)i(in)e(future)f(up)s(dates.)39 b(Also,)148
-1153 y(if)c(y)m(ou)h(ha)m(v)m(e)g(suggestions)h(for)d(options)i(that)g
-(migh)m(t)g(b)s(e)e(added)h(to)h(enhance)f(the)g(usefulness)f(of)i(the)
-148 1266 y(program,)31 b(feel)g(free)f(to)h(suggest)h(them.)148
-1553 y Fl(8)135 b(References)259 1756 y Fj(1.)47 b(Fic)m(han)m(t,)41
-b(G.A.)e(and)e(Burks,)h(C.)g(\(1991\))i(\\Iden)m(tifying)e(p)s(oten)m
-(tial)h(tRNA)f(genes)h(in)e(genomic)376 1868 y(DNA)31
-b(sequences",)g Fg(J.)h(Mol.)42 b(Biol.)p Fj(,)31 b Ff(220)p
-Fj(,)g(659-671.)259 2056 y(2.)47 b(Eddy)-8 b(,)27 b(S.R.)f(and)h
-(Durbin,)f(R.)h(\(1994\))j(\\RNA)d(sequence)h(analysis)f(using)f(co)m
-(v)-5 b(ariance)30 b(mo)s(dels",)376 2169 y Fg(Nucl.)41
-b(A)-5 b(cids)32 b(R)-5 b(es.)p Fj(,)32 b Ff(22)p Fj(,)f(2079-2088.)259
-2357 y(3.)47 b(P)m(a)m(v)m(esi,)34 b(A.,)e(Con)m(terio,)h(F.,)g(Bolc)m
-(hi,)h(A.,)e(Dieci,)i(G.,)f(Ottonello,)g(S.)f(\(1994\))i(\\Iden)m
-(ti\014cation)f(of)376 2470 y(new)26 b(euk)-5 b(ary)m(otic)28
-b(tRNA)g(genes)f(in)g(genomic)h(DNA)f(databases)h(b)m(y)f(a)g(m)m
-(ultistep)g(w)m(eigh)m(t)i(matrix)376 2582 y(analysis)i(of)f
-(transcriptional)h(con)m(trol)h(regions",)g Fg(Nucl.)41
-b(A)-5 b(cids)32 b(R)-5 b(es.)p Fj(,)32 b Ff(22)p Fj(,)f(1247-1256.)259
-2770 y(4.)47 b(Lo)m(w)m(e,)36 b(T.M.)e(&)f(Eddy)-8 b(,)34
-b(S.R.)f(\(1997\))k(\\tRNAscan-SE:)d(a)h(program)e(for)g(impro)m(v)m
-(ed)h(detection)376 2883 y(of)c(transfer)g(RNA)h(genes)g(in)f(genomic)h
-(sequence",)h Fg(Nucl.)41 b(A)-5 b(cids)32 b(R)-5 b(es.)p
-Fj(,)32 b Ff(25)p Fj(,)f(955-964.)1897 5525 y(23)p eop
-end
+23 22 bop 148 273 a Fl(7)135 b(Supp)t(ort)44 b(/)h(Bug)f(Rep)t(orts)i
+(/)f(Requests)h(for)f(added)g(options)148 476 y Fj(This)25
+b(is)g(the)i(\014rst)f(release)h(of)f(tRNAscan-SE,)h(so)g(there)g(are)g
+(b)s(ound)d(to)j(b)s(e)f(minor)f(problems)g(that)i(will)148
+589 y(need)34 b(to)g(b)s(e)g(\014xed)f(\(although)g(w)m(e'v)m(e)j(made)
+e(ev)m(ery)g(attempt)h(to)g(catc)m(h)g(all)e(problems)f(on)i(SGI,)f
+(Sun,)148 702 y(DEC)27 b(Alpha,)f(and)g(In)m(tel)g(mac)m(hines\).)39
+b(The)26 b(user)g(is)f(free)i(to)g(either)f(\014x)g(the)g(bug)g
+(him/herself,)f(or)i(send)148 815 y(me)37 b(detailed)f(information)e
+(on)j(the)g(problem)e(\(email)h(to)h(T)-8 b(o)s(dd)35
+b(Lo)m(w)m(e,)40 b(lo)m(w)m(e at genetics.wustl.edu\),)148
+927 y(and)21 b(I)g(will)e(mak)m(e)k(reasonable)e(e\013orts)h(to)g
+(remedy)f(the)h(problem.)36 b(If)21 b(y)m(ou)h(do)f(decide)g(to)h
+(\014x)f(the)h(problem)148 1040 y(y)m(ourself,)28 b(I)f(w)m(ould)f(lik)
+m(e)h(to)h(b)s(e)f(noti\014ed)f(so)i(that)g(I)f(ma)m(y)h(mak)m(e)h(the)
+e(c)m(hange)i(in)d(future)g(up)s(dates.)39 b(Also,)148
+1153 y(if)34 b(y)m(ou)i(ha)m(v)m(e)g(suggestions)g(for)e(options)h
+(that)h(migh)m(t)f(b)s(e)f(added)h(to)h(enhance)f(the)g(usefulness)e
+(of)j(the)148 1266 y(program,)31 b(feel)f(free)g(to)h(suggest)h(them.)
+148 1553 y Fl(8)135 b(References)259 1756 y Fj(1.)47
+b(Fic)m(han)m(t,)40 b(G.A.)f(and)e(Burks,)h(C.)g(\(1991\))i(\\Iden)m
+(tifying)c(p)s(oten)m(tial)h(tRNA)h(genes)h(in)d(genomic)376
+1868 y(DNA)31 b(sequences",)g Fg(J.)h(Mol.)42 b(Biol.)p
+Fj(,)31 b Ff(220)p Fj(,)g(659-671.)259 2056 y(2.)47 b(Eddy)-8
+b(,)27 b(S.R.)f(and)h(Durbin,)e(R.)i(\(1994\))j(\\RNA)d(sequence)h
+(analysis)d(using)g(co)m(v)-5 b(ariance)29 b(mo)s(dels",)376
+2169 y Fg(Nucl.)41 b(A)-5 b(cids)32 b(R)-5 b(es.)p Fj(,)32
+b Ff(22)p Fj(,)f(2079-2088.)259 2357 y(3.)47 b(P)m(a)m(v)m(esi,)33
+b(A.,)f(Con)m(terio,)g(F.,)h(Bolc)m(hi,)f(A.,)g(Dieci,)g(G.,)h
+(Ottonello,)e(S.)h(\(1994\))i(\\Iden)m(ti\014cation)d(of)376
+2470 y(new)26 b(euk)-5 b(ary)m(otic)27 b(tRNA)h(genes)f(in)f(genomic)h
+(DNA)g(databases)h(b)m(y)f(a)g(m)m(ultistep)e(w)m(eigh)m(t)j(matrix)376
+2582 y(analysis)h(of)h(transcriptional)e(con)m(trol)j(regions",)g
+Fg(Nucl.)41 b(A)-5 b(cids)32 b(R)-5 b(es.)p Fj(,)32 b
+Ff(22)p Fj(,)f(1247-1256.)259 2770 y(4.)47 b(Lo)m(w)m(e,)36
+b(T.M.)e(&)f(Eddy)-8 b(,)34 b(S.R.)f(\(1997\))k(\\tRNAscan-SE:)d(a)h
+(program)e(for)g(impro)m(v)m(ed)g(detection)376 2883
+y(of)d(transfer)g(RNA)h(genes)g(in)e(genomic)h(sequence",)i
+Fg(Nucl.)41 b(A)-5 b(cids)32 b(R)-5 b(es.)p Fj(,)32 b
+Ff(25)p Fj(,)f(955-964.)1897 5525 y(23)p eop
%%Page: 24 24
-TeXDict begin 24 23 bop 148 273 a Fl(A)134 b(F)-15 b(AST)k(A)43
-b(Sequence)i(F)-11 b(ormat)148 476 y Fj(The)33 b(F)-10
-b(AST)i(A)32 b(sequence)i(format)f(consists)g(of)g(a)g(sequence)g(name)
-g(and)f(description)h(on)f(a)h(single)h(line)148 589
-y(starting)d(with)g(the)f(greater)i(than)e(sym)m(b)s(ol)g(')p
-Fd(>)p Fj(',)h(follo)m(w)m(ed)h(b)m(y)e(the)h(sequence:)148
-914 y Fd(>)48 b(SequenceName)c(description)h(here)148
+24 23 bop 148 273 a Fl(A)134 b(F)-15 b(AST)k(A)43 b(Sequence)i(F)-11
+b(ormat)148 476 y Fj(The)33 b(F)-10 b(AST)i(A)32 b(sequence)i(format)f
+(consists)f(of)h(a)g(sequence)g(name)g(and)f(description)f(on)h(a)h
+(single)f(line)148 589 y(starting)e(with)g(the)g(greater)i(than)e(sym)m
+(b)s(ol)f(')p Fd(>)p Fj(',)i(follo)m(w)m(ed)f(b)m(y)g(the)h(sequence:)
+148 914 y Fd(>)48 b(SequenceName)c(description)h(here)148
1027 y(ATGTCGTTACCGTCGTCGGGACCGA)o(CCAT)o(G)148 1140
y(AGAGCGA)289 1465 y Fj(More)32 b(than)e(one)g(sequence)h(can)g(b)s(e)f
-(included)f(in)h(the)h(same)g(\014le:)148 1791 y Fd(>)48
+(included)d(in)i(the)i(same)g(\014le:)148 1791 y Fd(>)48
b(Randseq1)d(first)i(randomly)e(generated)g(seq)148 1904
y(GGTGGTTACTAACCGTAAGAGATGA)o(TGTC)o(GCCG)o(TGG)o(TCGC)o(GTGG)o(CGC)o
(CGCG)o(GACC)o(CAG)o(AT)148 2017 y(TGTACTTCTCTGAGTCGTTCTAGAT)o(CGAC)o
@@ -4736,378 +3220,377 @@ y(GGTGGTTACTAACCGTAAGAGATGA)o(TGTC)o(GCCG)o(TGG)o(TCGC)o(GTGG)o(CGC)o
2807 y(GGCGAGTCTGAACTCACAAATATTG)o(CACG)o(AGAG)o(TTT)o(AGTG)o(TATG)o
(TTC)o(CTCT)o(TAGG)o(CTG)o(AT)148 2920 y(AACAATAGTTTAGTGAGCGGAAATG)o
(CAAC)o(CGCG)o(AGG)o(CGGT)o(CCCC)o(TGC)o(GCTT)o(GTAA)o(TGG)o(CC)148
-3033 y(ACCTGTTGCCCGTCGGATAT)1897 5525 y Fj(24)p eop end
+3033 y(ACCTGTTGCCCGTCGGATAT)1897 5525 y Fj(24)p eop
%%Page: 25 25
-TeXDict begin 25 24 bop 148 273 a Fl(B)134 b(Distribution)46
-b(and)f(cop)l(ying)g(terms)1078 476 y Ff(GNU)35 b(GENERAL)f(PUBLIC)i
-(LICENSE)1530 589 y Fj(V)-8 b(ersion)31 b(2,)g(June)f(1991)808
-773 y(Cop)m(yrigh)m(t)i(\(C\))e(1989,)j(1991)f(F)-8 b(ree)31
-b(Soft)m(w)m(are)h(F)-8 b(oundation,)31 b(Inc.)1070 886
-y(675)g(Mass)g(Av)m(e,)h(Cam)m(bridge,)e(MA)h(02139,)i(USA)720
-998 y(Ev)m(ery)m(one)e(is)g(p)s(ermitted)f(to)h(cop)m(y)g(and)f
-(distribute)g(v)m(erbatim)h(copies)831 1111 y(of)f(this)h(license)g(do)
-s(cumen)m(t,)f(but)g(c)m(hanging)h(it)g(is)g(not)f(allo)m(w)m(ed.)1756
-1295 y(Pream)m(ble)289 1479 y(The)38 b(licenses)i(for)e(most)h(soft)m
-(w)m(are)g(are)g(designed)f(to)h(tak)m(e)h(a)m(w)m(a)m(y)h(y)m(our)d
-(freedom)g(to)h(share)g(and)148 1592 y(c)m(hange)i(it.)68
-b(By)40 b(con)m(trast,)j(the)c(GNU)h(General)h(Public)e(License)h(is)f
-(in)m(tended)g(to)h(guaran)m(tee)h(y)m(our)148 1705 y(freedom)26
+25 24 bop 148 273 a Fl(B)134 b(Distribution)46 b(and)f(cop)l(ying)g
+(terms)1078 476 y Ff(GNU)35 b(GENERAL)f(PUBLIC)i(LICENSE)1530
+589 y Fj(V)-8 b(ersion)30 b(2,)h(June)f(1991)808 773
+y(Cop)m(yrigh)m(t)h(\(C\))f(1989,)j(1991)f(F)-8 b(ree)31
+b(Soft)m(w)m(are)h(F)-8 b(oundation,)30 b(Inc.)1070 886
+y(675)h(Mass)g(Av)m(e,)h(Cam)m(bridge,)d(MA)i(02139,)i(USA)720
+998 y(Ev)m(ery)m(one)e(is)f(p)s(ermitted)f(to)i(cop)m(y)g(and)f
+(distribute)e(v)m(erbatim)i(copies)831 1111 y(of)g(this)g(license)f(do)
+s(cumen)m(t,)h(but)g(c)m(hanging)g(it)g(is)g(not)g(allo)m(w)m(ed.)1756
+1295 y(Pream)m(ble)289 1479 y(The)38 b(licenses)g(for)g(most)h(soft)m
+(w)m(are)g(are)g(designed)e(to)i(tak)m(e)h(a)m(w)m(a)m(y)h(y)m(our)d
+(freedom)g(to)h(share)g(and)148 1592 y(c)m(hange)i(it.)67
+b(By)40 b(con)m(trast,)j(the)c(GNU)h(General)g(Public)d(License)i(is)f
+(in)m(tended)g(to)i(guaran)m(tee)h(y)m(our)148 1705 y(freedom)26
b(to)h(share)f(and)g(c)m(hange)h(free)g(soft)m(w)m(are{to)i(mak)m(e)e
-(sure)e(the)i(soft)m(w)m(are)g(is)g(free)f(for)g(all)h(its)g(users.)148
-1818 y(This)38 b(General)i(Public)f(License)g(applies)g(to)h(most)f(of)
-g(the)g(F)-8 b(ree)40 b(Soft)m(w)m(are)g(F)-8 b(oundation's)40
-b(soft)m(w)m(are)148 1931 y(and)35 b(to)g(an)m(y)g(other)g(program)g
-(whose)g(authors)f(commit)i(to)g(using)e(it.)55 b(\(Some)35
+(sure)e(the)i(soft)m(w)m(are)g(is)f(free)g(for)g(all)f(its)h(users.)148
+1818 y(This)37 b(General)i(Public)e(License)h(applies)f(to)j(most)f(of)
+g(the)g(F)-8 b(ree)40 b(Soft)m(w)m(are)g(F)-8 b(oundation's)39
+b(soft)m(w)m(are)148 1931 y(and)c(to)g(an)m(y)g(other)g(program)g
+(whose)g(authors)f(commit)h(to)h(using)d(it.)54 b(\(Some)35
b(other)g(F)-8 b(ree)36 b(Soft)m(w)m(are)148 2044 y(F)-8
-b(oundation)31 b(soft)m(w)m(are)h(is)f(co)m(v)m(ered)h(b)m(y)e(the)h
-(GNU)g(Library)f(General)h(Public)f(License)h(instead.\))42
-b(Y)-8 b(ou)148 2157 y(can)31 b(apply)f(it)h(to)g(y)m(our)f(programs,)h
+b(oundation)30 b(soft)m(w)m(are)i(is)e(co)m(v)m(ered)i(b)m(y)e(the)h
+(GNU)g(Library)e(General)h(Public)e(License)i(instead.\))41
+b(Y)-8 b(ou)148 2157 y(can)31 b(apply)e(it)h(to)h(y)m(our)f(programs,)h
(to)s(o.)289 2270 y(When)36 b(w)m(e)g(sp)s(eak)f(of)h(free)f(soft)m(w)m
-(are,)k(w)m(e)d(are)g(referring)f(to)h(freedom,)h(not)f(price.)56
-b(Our)34 b(General)148 2383 y(Public)f(Licenses)h(are)g(designed)f(to)h
+(are,)k(w)m(e)d(are)g(referring)e(to)i(freedom,)h(not)f(price.)55
+b(Our)34 b(General)148 2383 y(Public)d(Licenses)i(are)h(designed)e(to)i
(mak)m(e)h(sure)d(that)i(y)m(ou)g(ha)m(v)m(e)g(the)g(freedom)f(to)h
-(distribute)f(copies)148 2495 y(of)j(free)g(soft)m(w)m(are)h(\(and)e(c)
-m(harge)i(for)e(this)h(service)g(if)g(y)m(ou)f(wish\),)i(that)f(y)m(ou)
-g(receiv)m(e)i(source)d(co)s(de)h(or)148 2608 y(can)f(get)g(it)f(if)g
-(y)m(ou)h(w)m(an)m(t)g(it,)g(that)g(y)m(ou)f(can)h(c)m(hange)g(the)f
-(soft)m(w)m(are)h(or)f(use)g(pieces)h(of)f(it)h(in)e(new)h(free)148
-2721 y(programs;)d(and)e(that)i(y)m(ou)g(kno)m(w)f(y)m(ou)h(can)g(do)f
-(these)h(things.)289 2834 y(T)-8 b(o)39 b(protect)g(y)m(our)f(righ)m
-(ts,)j(w)m(e)d(need)g(to)g(mak)m(e)h(restrictions)g(that)g(forbid)e(an)
-m(y)m(one)i(to)g(den)m(y)f(y)m(ou)148 2947 y(these)e(righ)m(ts)g(or)g
-(to)g(ask)g(y)m(ou)g(to)h(surrender)c(the)j(righ)m(ts.)57
-b(These)35 b(restrictions)i(translate)g(to)f(certain)148
-3060 y(resp)s(onsibilities)31 b(for)f(y)m(ou)h(if)f(y)m(ou)h
-(distribute)f(copies)h(of)f(the)h(soft)m(w)m(are,)h(or)e(if)h(y)m(ou)f
-(mo)s(dify)g(it.)289 3173 y(F)-8 b(or)29 b(example,)g(if)f(y)m(ou)f
-(distribute)h(copies)g(of)g(suc)m(h)f(a)h(program,)g(whether)f(gratis)i
-(or)e(for)h(a)g(fee,)h(y)m(ou)148 3286 y(m)m(ust)k(giv)m(e)h(the)f
-(recipien)m(ts)h(all)g(the)f(righ)m(ts)g(that)h(y)m(ou)f(ha)m(v)m(e.)49
+(distribute)d(copies)148 2495 y(of)36 b(free)g(soft)m(w)m(are)h(\(and)e
+(c)m(harge)i(for)e(this)g(service)g(if)g(y)m(ou)g(wish\),)h(that)g(y)m
+(ou)g(receiv)m(e)h(source)e(co)s(de)h(or)148 2608 y(can)f(get)g(it)e
+(if)g(y)m(ou)i(w)m(an)m(t)g(it,)f(that)h(y)m(ou)f(can)h(c)m(hange)g
+(the)f(soft)m(w)m(are)h(or)f(use)g(pieces)g(of)g(it)g(in)e(new)i(free)
+148 2721 y(programs;)d(and)e(that)i(y)m(ou)g(kno)m(w)f(y)m(ou)h(can)g
+(do)f(these)h(things.)289 2834 y(T)-8 b(o)39 b(protect)g(y)m(our)f
+(righ)m(ts,)i(w)m(e)e(need)g(to)g(mak)m(e)h(restrictions)e(that)i
+(forbid)d(an)m(y)m(one)j(to)g(den)m(y)f(y)m(ou)148 2947
+y(these)e(righ)m(ts)f(or)h(to)g(ask)g(y)m(ou)g(to)h(surrender)c(the)j
+(righ)m(ts.)56 b(These)35 b(restrictions)g(translate)h(to)g(certain)148
+3060 y(resp)s(onsibilities)26 b(for)k(y)m(ou)h(if)e(y)m(ou)i
+(distribute)d(copies)i(of)g(the)h(soft)m(w)m(are,)h(or)e(if)g(y)m(ou)g
+(mo)s(dify)f(it.)289 3173 y(F)-8 b(or)29 b(example,)f(if)f(y)m(ou)g
+(distribute)f(copies)h(of)h(suc)m(h)f(a)h(program,)g(whether)f(gratis)h
+(or)f(for)h(a)g(fee,)h(y)m(ou)148 3286 y(m)m(ust)k(giv)m(e)g(the)g
+(recipien)m(ts)f(all)g(the)h(righ)m(ts)f(that)i(y)m(ou)f(ha)m(v)m(e.)49
b(Y)-8 b(ou)34 b(m)m(ust)e(mak)m(e)i(sure)e(that)i(they)-8
-b(,)34 b(to)s(o,)148 3399 y(receiv)m(e)39 b(or)e(can)g(get)h(the)f
-(source)g(co)s(de.)61 b(And)36 b(y)m(ou)h(m)m(ust)g(sho)m(w)g(them)g
-(these)g(terms)g(so)g(they)g(kno)m(w)148 3512 y(their)31
-b(righ)m(ts.)289 3625 y(W)-8 b(e)28 b(protect)f(y)m(our)f(righ)m(ts)g
-(with)g(t)m(w)m(o)i(steps:)38 b(\(1\))27 b(cop)m(yrigh)m(t)h(the)e
-(soft)m(w)m(are,)j(and)c(\(2\))i(o\013er)g(y)m(ou)f(this)148
-3737 y(license)32 b(whic)m(h)e(giv)m(es)i(y)m(ou)e(legal)i(p)s
-(ermission)e(to)h(cop)m(y)-8 b(,)32 b(distribute)d(and/or)i(mo)s(dify)e
-(the)i(soft)m(w)m(are.)289 3850 y(Also,)44 b(for)d(eac)m(h)g(author's)g
-(protection)g(and)f(ours,)j(w)m(e)e(w)m(an)m(t)g(to)g(mak)m(e)h
-(certain)f(that)g(ev)m(ery)m(one)148 3963 y(understands)29
-b(that)i(there)f(is)h(no)f(w)m(arran)m(t)m(y)h(for)f(this)h(free)f
-(soft)m(w)m(are.)42 b(If)30 b(the)h(soft)m(w)m(are)h(is)e(mo)s
-(di\014ed)f(b)m(y)148 4076 y(someone)h(else)g(and)f(passed)f(on,)i(w)m
-(e)f(w)m(an)m(t)h(its)g(recipien)m(ts)g(to)g(kno)m(w)f(that)h(what)f
-(they)g(ha)m(v)m(e)h(is)f(not)h(the)148 4189 y(original,)g(so)f(that)f
-(an)m(y)h(problems)e(in)m(tro)s(duced)h(b)m(y)g(others)g(will)g(not)h
-(re\015ect)g(on)f(the)g(original)h(authors')148 4302
-y(reputations.)289 4415 y(Finally)-8 b(,)26 b(an)m(y)c(free)h(program)e
-(is)i(threatened)f(constan)m(tly)i(b)m(y)e(soft)m(w)m(are)h(paten)m
-(ts.)39 b(W)-8 b(e)23 b(wish)f(to)h(a)m(v)m(oid)148 4528
-y(the)30 b(danger)f(that)h(redistributors)e(of)i(a)f(free)h(program)f
-(will)h(individually)f(obtain)g(paten)m(t)i(licenses,)f(in)148
-4641 y(e\013ect)39 b(making)e(the)g(program)g(proprietary)-8
-b(.)60 b(T)-8 b(o)38 b(prev)m(en)m(t)f(this,)i(w)m(e)f(ha)m(v)m(e)g
-(made)f(it)g(clear)h(that)g(an)m(y)148 4754 y(paten)m(t)32
-b(m)m(ust)e(b)s(e)g(licensed)h(for)f(ev)m(ery)m(one's)i(free)e(use)g
-(or)h(not)f(licensed)h(at)g(all.)289 4867 y(The)f(precise)h(terms)f
-(and)g(conditions)h(for)f(cop)m(ying,)i(distribution)d(and)h(mo)s
-(di\014cation)h(follo)m(w.)1078 5051 y Ff(GNU)k(GENERAL)f(PUBLIC)i
-(LICENSE)289 5163 y(TERMS)f(AND)g(CONDITIONS)d(F)m(OR)j(COPYING,)f
-(DISTRIBUTION)g(AND)1532 5276 y(MODIFICA)-9 b(TION)1897
-5525 y Fj(25)p eop end
+b(,)34 b(to)s(o,)148 3399 y(receiv)m(e)k(or)f(can)g(get)h(the)f(source)
+g(co)s(de.)61 b(And)36 b(y)m(ou)h(m)m(ust)g(sho)m(w)g(them)g(these)g
+(terms)g(so)g(they)g(kno)m(w)148 3512 y(their)30 b(righ)m(ts.)289
+3625 y(W)-8 b(e)28 b(protect)f(y)m(our)f(righ)m(ts)f(with)g(t)m(w)m(o)j
+(steps:)38 b(\(1\))27 b(cop)m(yrigh)m(t)g(the)f(soft)m(w)m(are,)j(and)c
+(\(2\))i(o\013er)g(y)m(ou)f(this)148 3737 y(license)k(whic)m(h)f(giv)m
+(es)i(y)m(ou)f(legal)g(p)s(ermission)e(to)j(cop)m(y)-8
+b(,)32 b(distribute)27 b(and/or)k(mo)s(dify)d(the)j(soft)m(w)m(are.)289
+3850 y(Also,)43 b(for)e(eac)m(h)g(author's)g(protection)f(and)g(ours,)j
+(w)m(e)e(w)m(an)m(t)g(to)g(mak)m(e)h(certain)e(that)h(ev)m(ery)m(one)
+148 3963 y(understands)29 b(that)i(there)f(is)g(no)g(w)m(arran)m(t)m(y)
+h(for)f(this)g(free)g(soft)m(w)m(are.)42 b(If)30 b(the)h(soft)m(w)m
+(are)h(is)d(mo)s(di\014ed)f(b)m(y)148 4076 y(someone)i(else)f(and)g
+(passed)f(on,)i(w)m(e)f(w)m(an)m(t)h(its)f(recipien)m(ts)f(to)i(kno)m
+(w)f(that)h(what)f(they)g(ha)m(v)m(e)h(is)e(not)i(the)148
+4189 y(original,)d(so)i(that)f(an)m(y)h(problems)d(in)m(tro)s(duced)h
+(b)m(y)h(others)g(will)d(not)k(re\015ect)g(on)f(the)g(original)e
+(authors')148 4302 y(reputations.)289 4415 y(Finally)-8
+b(,)23 b(an)m(y)f(free)h(program)e(is)h(threatened)g(constan)m(tly)h(b)
+m(y)f(soft)m(w)m(are)h(paten)m(ts.)39 b(W)-8 b(e)23 b(wish)e(to)i(a)m
+(v)m(oid)148 4528 y(the)30 b(danger)f(that)h(redistributors)c(of)k(a)f
+(free)h(program)f(will)e(individually)d(obtain)k(paten)m(t)j(licenses,)
+d(in)148 4641 y(e\013ect)39 b(making)d(the)h(program)g(proprietary)-8
+b(.)59 b(T)-8 b(o)38 b(prev)m(en)m(t)f(this,)h(w)m(e)g(ha)m(v)m(e)g
+(made)f(it)f(clear)h(that)h(an)m(y)148 4754 y(paten)m(t)32
+b(m)m(ust)e(b)s(e)g(licensed)f(for)h(ev)m(ery)m(one's)i(free)e(use)g
+(or)h(not)f(licensed)f(at)i(all.)289 4867 y(The)f(precise)g(terms)g
+(and)g(conditions)f(for)h(cop)m(ying,)h(distribution)26
+b(and)k(mo)s(di\014cation)f(follo)m(w.)1078 5051 y Ff(GNU)35
+b(GENERAL)f(PUBLIC)i(LICENSE)289 5163 y(TERMS)f(AND)g(CONDITIONS)d(F)m
+(OR)j(COPYING,)f(DISTRIBUTION)g(AND)1532 5276 y(MODIFICA)-9
+b(TION)1897 5525 y Fj(25)p eop
%%Page: 26 26
-TeXDict begin 26 25 bop 259 273 a Fj(0.)47 b(This)37
-b(License)h(applies)h(to)f(an)m(y)h(program)e(or)i(other)f(w)m(ork)g
-(whic)m(h)g(con)m(tains)h(a)f(notice)i(placed)376 386
-y(b)m(y)29 b(the)g(cop)m(yrigh)m(t)i(holder)e(sa)m(ying)i(it)e(ma)m(y)h
-(b)s(e)f(distributed)g(under)e(the)j(terms)f(of)h(this)f(General)376
-499 y(Public)40 b(License.)74 b(The)40 b(\\Program",)45
-b(b)s(elo)m(w,)f(refers)d(to)h(an)m(y)f(suc)m(h)g(program)g(or)g(w)m
-(ork,)j(and)376 612 y(a)38 b(\\w)m(ork)h(based)f(on)g(the)g(Program")h
-(means)f(either)g(the)g(Program)h(or)f(an)m(y)g(deriv)-5
-b(ativ)m(e)40 b(w)m(ork)376 724 y(under)33 b(cop)m(yrigh)m(t)j(la)m(w:)
-51 b(that)36 b(is)f(to)g(sa)m(y)-8 b(,)38 b(a)d(w)m(ork)g(con)m
-(taining)i(the)e(Program)g(or)g(a)g(p)s(ortion)g(of)376
-837 y(it,)43 b(either)e(v)m(erbatim)g(or)f(with)g(mo)s(di\014cations)h
-(and/or)f(translated)h(in)m(to)g(another)f(language.)376
-950 y(\(Hereinafter,)35 b(translation)g(is)e(included)g(without)h
-(limitation)h(in)e(the)h(term)f(\\mo)s(di\014cation".\))376
-1063 y(Eac)m(h)e(licensee)g(is)g(addressed)e(as)i(\\y)m(ou".)376
-1213 y(Activities)k(other)f(than)f(cop)m(ying,)j(distribution)d(and)g
-(mo)s(di\014cation)h(are)g(not)g(co)m(v)m(ered)h(b)m(y)e(this)376
-1326 y(License;)c(they)g(are)g(outside)f(its)h(scop)s(e.)40
-b(The)28 b(act)h(of)g(running)d(the)j(Program)f(is)h(not)f(restricted,)
-376 1439 y(and)37 b(the)h(output)f(from)h(the)g(Program)g(is)g(co)m(v)m
-(ered)h(only)f(if)g(its)g(con)m(ten)m(ts)i(constitute)f(a)f(w)m(ork)376
-1552 y(based)31 b(on)h(the)g(Program)g(\(indep)s(enden)m(t)f(of)h(ha)m
-(ving)h(b)s(een)e(made)h(b)m(y)g(running)e(the)i(Program\).)376
-1665 y(Whether)e(that)h(is)f(true)h(dep)s(ends)d(on)i(what)h(the)f
+26 25 bop 259 273 a Fj(0.)47 b(This)36 b(License)h(applies)g(to)h(an)m
+(y)h(program)e(or)i(other)f(w)m(ork)g(whic)m(h)f(con)m(tains)h(a)g
+(notice)h(placed)376 386 y(b)m(y)29 b(the)g(cop)m(yrigh)m(t)h(holder)e
+(sa)m(ying)i(it)e(ma)m(y)i(b)s(e)f(distributed)e(under)g(the)j(terms)f
+(of)h(this)e(General)376 499 y(Public)38 b(License.)73
+b(The)40 b(\\Program",)45 b(b)s(elo)m(w,)e(refers)e(to)h(an)m(y)f(suc)m
+(h)g(program)g(or)g(w)m(ork,)j(and)376 612 y(a)38 b(\\w)m(ork)h(based)f
+(on)g(the)g(Program")h(means)f(either)f(the)h(Program)h(or)f(an)m(y)g
+(deriv)-5 b(ativ)m(e)38 b(w)m(ork)376 724 y(under)33
+b(cop)m(yrigh)m(t)i(la)m(w:)50 b(that)36 b(is)e(to)h(sa)m(y)-8
+b(,)38 b(a)d(w)m(ork)g(con)m(taining)g(the)g(Program)g(or)g(a)g(p)s
+(ortion)f(of)376 837 y(it,)42 b(either)e(v)m(erbatim)g(or)g(with)f(mo)s
+(di\014cations)g(and/or)h(translated)g(in)m(to)g(another)g(language.)
+376 950 y(\(Hereinafter,)34 b(translation)f(is)f(included)f(without)i
+(limitation)e(in)h(the)i(term)f(\\mo)s(di\014cation".\))376
+1063 y(Eac)m(h)e(licensee)e(is)h(addressed)f(as)i(\\y)m(ou".)376
+1213 y(Activities)h(other)i(than)f(cop)m(ying,)i(distribution)30
+b(and)j(mo)s(di\014cation)f(are)i(not)g(co)m(v)m(ered)h(b)m(y)e(this)
+376 1326 y(License;)28 b(they)h(are)g(outside)e(its)h(scop)s(e.)40
+b(The)28 b(act)h(of)g(running)c(the)k(Program)f(is)g(not)g(restricted,)
+376 1439 y(and)37 b(the)h(output)f(from)h(the)g(Program)g(is)f(co)m(v)m
+(ered)i(only)e(if)g(its)g(con)m(ten)m(ts)j(constitute)e(a)g(w)m(ork)376
+1552 y(based)31 b(on)h(the)g(Program)g(\(indep)s(enden)m(t)e(of)i(ha)m
+(ving)g(b)s(een)f(made)h(b)m(y)g(running)d(the)j(Program\).)376
+1665 y(Whether)e(that)h(is)e(true)i(dep)s(ends)d(on)i(what)h(the)f
(Program)h(do)s(es.)259 1852 y(1.)47 b(Y)-8 b(ou)37 b(ma)m(y)g(cop)m(y)
-h(and)e(distribute)g(v)m(erbatim)i(copies)g(of)f(the)g(Program's)g
-(source)g(co)s(de)g(as)g(y)m(ou)376 1965 y(receiv)m(e)27
-b(it,)g(in)f(an)m(y)g(medium,)g(pro)m(vided)f(that)h(y)m(ou)g
-(conspicuously)g(and)f(appropriately)h(publish)376 2078
-y(on)i(eac)m(h)h(cop)m(y)g(an)f(appropriate)h(cop)m(yrigh)m(t)g(notice)
-h(and)e(disclaimer)h(of)f(w)m(arran)m(t)m(y;)i(k)m(eep)f(in)m(tact)376
-2191 y(all)g(the)f(notices)h(that)g(refer)e(to)i(this)f(License)h(and)e
+h(and)e(distribute)e(v)m(erbatim)j(copies)g(of)g(the)g(Program's)g
+(source)g(co)s(de)g(as)g(y)m(ou)376 1965 y(receiv)m(e)26
+b(it,)g(in)f(an)m(y)h(medium,)f(pro)m(vided)f(that)i(y)m(ou)g
+(conspicuously)e(and)h(appropriately)f(publish)376 2078
+y(on)k(eac)m(h)h(cop)m(y)g(an)f(appropriate)g(cop)m(yrigh)m(t)g(notice)
+h(and)f(disclaimer)e(of)i(w)m(arran)m(t)m(y;)i(k)m(eep)f(in)m(tact)376
+2191 y(all)e(the)h(notices)g(that)h(refer)e(to)i(this)e(License)h(and)f
(to)i(the)f(absence)h(of)f(an)m(y)g(w)m(arran)m(t)m(y;)i(and)e(giv)m(e)
-376 2304 y(an)m(y)i(other)h(recipien)m(ts)g(of)g(the)f(Program)h(a)g
-(cop)m(y)g(of)f(this)h(License)g(along)g(with)f(the)h(Program.)376
+376 2304 y(an)m(y)i(other)h(recipien)m(ts)e(of)i(the)f(Program)h(a)g
+(cop)m(y)g(of)f(this)g(License)g(along)g(with)f(the)i(Program.)376
2454 y(Y)-8 b(ou)27 b(ma)m(y)h(c)m(harge)g(a)g(fee)f(for)g(the)g(ph)m
-(ysical)h(act)g(of)g(transferring)e(a)h(cop)m(y)-8 b(,)30
-b(and)c(y)m(ou)i(ma)m(y)f(at)h(y)m(our)376 2567 y(option)i(o\013er)h(w)
-m(arran)m(t)m(y)h(protection)f(in)f(exc)m(hange)i(for)e(a)h(fee.)259
-2754 y(2.)47 b(Y)-8 b(ou)25 b(ma)m(y)g(mo)s(dify)f(y)m(our)g(cop)m(y)h
-(or)g(copies)g(of)g(the)g(Program)f(or)h(an)m(y)g(p)s(ortion)f(of)h
-(it,)h(th)m(us)e(forming)376 2867 y(a)36 b(w)m(ork)h(based)f(on)g(the)g
-(Program,)j(and)c(cop)m(y)i(and)f(distribute)g(suc)m(h)g(mo)s
-(di\014cations)h(or)f(w)m(ork)376 2980 y(under)20 b(the)i(terms)g(of)g
-(Section)g(1)h(ab)s(o)m(v)m(e,)i(pro)m(vided)c(that)i(y)m(ou)f(also)h
-(meet)f(all)h(of)f(these)g(conditions:)414 3192 y(\(a\))47
-b(Y)-8 b(ou)36 b(m)m(ust)g(cause)g(the)h(mo)s(di\014ed)d(\014les)i(to)h
-(carry)f(prominen)m(t)g(notices)h(stating)g(that)g(y)m(ou)576
-3305 y(c)m(hanged)31 b(the)f(\014les)g(and)g(the)h(date)g(of)f(an)m(y)h
+(ysical)f(act)i(of)g(transferring)d(a)i(cop)m(y)-8 b(,)30
+b(and)c(y)m(ou)i(ma)m(y)f(at)h(y)m(our)376 2567 y(option)h(o\013er)i(w)
+m(arran)m(t)m(y)h(protection)e(in)f(exc)m(hange)j(for)e(a)h(fee.)259
+2754 y(2.)47 b(Y)-8 b(ou)25 b(ma)m(y)g(mo)s(dify)e(y)m(our)h(cop)m(y)h
+(or)g(copies)f(of)h(the)g(Program)f(or)h(an)m(y)g(p)s(ortion)e(of)i
+(it,)g(th)m(us)f(forming)376 2867 y(a)36 b(w)m(ork)h(based)f(on)g(the)g
+(Program,)j(and)c(cop)m(y)i(and)f(distribute)e(suc)m(h)i(mo)s
+(di\014cations)f(or)h(w)m(ork)376 2980 y(under)20 b(the)i(terms)g(of)g
+(Section)f(1)i(ab)s(o)m(v)m(e,)i(pro)m(vided)20 b(that)j(y)m(ou)f(also)
+g(meet)g(all)f(of)h(these)g(conditions:)414 3192 y(\(a\))47
+b(Y)-8 b(ou)36 b(m)m(ust)g(cause)g(the)h(mo)s(di\014ed)c(\014les)i(to)i
+(carry)f(prominen)m(t)f(notices)h(stating)g(that)h(y)m(ou)576
+3305 y(c)m(hanged)31 b(the)f(\014les)f(and)h(the)h(date)g(of)f(an)m(y)h
(c)m(hange.)409 3451 y(\(b\))46 b(Y)-8 b(ou)26 b(m)m(ust)f(cause)h(an)m
-(y)g(w)m(ork)g(that)g(y)m(ou)g(distribute)f(or)g(publish,)g(that)h(in)g
-(whole)f(or)h(in)f(part)576 3564 y(con)m(tains)31 b(or)f(is)g(deriv)m
-(ed)g(from)f(the)i(Program)f(or)g(an)m(y)g(part)g(thereof,)h(to)g(b)s
-(e)e(licensed)h(as)h(a)576 3677 y(whole)f(at)h(no)g(c)m(harge)g(to)g
-(all)h(third)d(parties)i(under)e(the)h(terms)g(of)h(this)f(License.)419
-3822 y(\(c\))47 b(If)31 b(the)h(mo)s(di\014ed)f(program)h(normally)h
-(reads)e(commands)h(in)m(teractiv)m(ely)j(when)c(run,)h(y)m(ou)576
-3935 y(m)m(ust)24 b(cause)h(it,)h(when)d(started)i(running)d(for)j(suc)
-m(h)f(in)m(teractiv)m(e)j(use)d(in)g(the)g(most)h(ordinary)576
-4048 y(w)m(a)m(y)-8 b(,)43 b(to)d(prin)m(t)f(or)g(displa)m(y)h(an)f
-(announcemen)m(t)g(including)g(an)g(appropriate)h(cop)m(yrigh)m(t)576
-4161 y(notice)30 b(and)f(a)g(notice)i(that)e(there)h(is)f(no)g(w)m
-(arran)m(t)m(y)h(\(or)g(else,)g(sa)m(ying)g(that)g(y)m(ou)f(pro)m(vide)
-h(a)576 4274 y(w)m(arran)m(t)m(y\))i(and)f(that)h(users)f(ma)m(y)h
-(redistribute)f(the)g(program)h(under)d(these)j(conditions,)576
-4387 y(and)42 b(telling)i(the)g(user)e(ho)m(w)h(to)h(view)f(a)h(cop)m
-(y)f(of)h(this)e(License.)80 b(\(Exception:)67 b(if)43
-b(the)576 4500 y(Program)26 b(itself)i(is)e(in)m(teractiv)m(e)j(but)d
-(do)s(es)g(not)h(normally)g(prin)m(t)f(suc)m(h)g(an)h(announcemen)m(t,)
-576 4613 y(y)m(our)j(w)m(ork)g(based)g(on)h(the)f(Program)h(is)f(not)h
-(required)e(to)i(prin)m(t)f(an)h(announcemen)m(t.\))376
-4825 y(These)37 b(requiremen)m(ts)g(apply)g(to)h(the)g(mo)s(di\014ed)e
-(w)m(ork)i(as)f(a)h(whole.)62 b(If)37 b(iden)m(ti\014able)h(sections)
-376 4938 y(of)g(that)g(w)m(ork)g(are)g(not)h(deriv)m(ed)f(from)f(the)h
-(Program,)i(and)d(can)i(b)s(e)e(reasonably)h(considered)376
-5051 y(indep)s(enden)m(t)33 b(and)i(separate)g(w)m(orks)g(in)g
-(themselv)m(es,)i(then)e(this)g(License,)h(and)f(its)g(terms,)h(do)376
-5163 y(not)e(apply)f(to)i(those)f(sections)h(when)e(y)m(ou)h
-(distribute)g(them)g(as)g(separate)h(w)m(orks.)51 b(But)34
-b(when)376 5276 y(y)m(ou)40 b(distribute)f(the)h(same)g(sections)h(as)f
-(part)f(of)h(a)h(whole)f(whic)m(h)f(is)h(a)g(w)m(ork)g(based)f(on)h
-(the)1897 5525 y(26)p eop end
+(y)g(w)m(ork)g(that)g(y)m(ou)g(distribute)d(or)i(publish,)e(that)j(in)f
+(whole)f(or)i(in)e(part)576 3564 y(con)m(tains)30 b(or)g(is)f(deriv)m
+(ed)g(from)g(the)i(Program)f(or)g(an)m(y)g(part)g(thereof,)h(to)g(b)s
+(e)e(licensed)f(as)j(a)576 3677 y(whole)e(at)i(no)g(c)m(harge)g(to)g
+(all)f(third)e(parties)i(under)f(the)h(terms)g(of)h(this)e(License.)419
+3822 y(\(c\))47 b(If)31 b(the)h(mo)s(di\014ed)e(program)i(normally)f
+(reads)g(commands)h(in)m(teractiv)m(ely)g(when)f(run,)h(y)m(ou)576
+3935 y(m)m(ust)24 b(cause)h(it,)g(when)e(started)i(running)c(for)k(suc)
+m(h)f(in)m(teractiv)m(e)h(use)f(in)f(the)h(most)h(ordinary)576
+4048 y(w)m(a)m(y)-8 b(,)43 b(to)d(prin)m(t)e(or)h(displa)m(y)f(an)h
+(announcemen)m(t)g(including)d(an)j(appropriate)g(cop)m(yrigh)m(t)576
+4161 y(notice)29 b(and)g(a)g(notice)h(that)f(there)h(is)e(no)h(w)m
+(arran)m(t)m(y)h(\(or)g(else,)f(sa)m(ying)g(that)h(y)m(ou)f(pro)m(vide)
+g(a)576 4274 y(w)m(arran)m(t)m(y\))j(and)f(that)h(users)f(ma)m(y)h
+(redistribute)d(the)i(program)h(under)d(these)j(conditions,)576
+4387 y(and)42 b(telling)f(the)j(user)e(ho)m(w)h(to)h(view)e(a)i(cop)m
+(y)f(of)h(this)d(License.)79 b(\(Exception:)66 b(if)42
+b(the)576 4500 y(Program)26 b(itself)g(is)f(in)m(teractiv)m(e)i(but)f
+(do)s(es)g(not)h(normally)e(prin)m(t)g(suc)m(h)h(an)h(announcemen)m(t,)
+576 4613 y(y)m(our)j(w)m(ork)g(based)g(on)h(the)f(Program)h(is)e(not)i
+(required)d(to)j(prin)m(t)e(an)i(announcemen)m(t.\))376
+4825 y(These)37 b(requiremen)m(ts)f(apply)g(to)i(the)g(mo)s(di\014ed)d
+(w)m(ork)j(as)f(a)h(whole.)61 b(If)37 b(iden)m(ti\014able)e(sections)
+376 4938 y(of)j(that)g(w)m(ork)g(are)g(not)h(deriv)m(ed)e(from)g(the)h
+(Program,)i(and)d(can)i(b)s(e)e(reasonably)g(considered)376
+5051 y(indep)s(enden)m(t)32 b(and)j(separate)g(w)m(orks)g(in)f
+(themselv)m(es,)i(then)f(this)f(License,)h(and)g(its)f(terms,)i(do)376
+5163 y(not)e(apply)e(to)j(those)f(sections)g(when)f(y)m(ou)h
+(distribute)e(them)i(as)g(separate)h(w)m(orks.)51 b(But)34
+b(when)376 5276 y(y)m(ou)40 b(distribute)d(the)j(same)g(sections)g(as)g
+(part)f(of)h(a)h(whole)e(whic)m(h)f(is)h(a)h(w)m(ork)g(based)f(on)h
+(the)1897 5525 y(26)p eop
%%Page: 27 27
-TeXDict begin 27 26 bop 376 273 a Fj(Program,)34 b(the)f(distribution)g
-(of)g(the)h(whole)f(m)m(ust)g(b)s(e)g(on)g(the)h(terms)f(of)g(this)g
-(License,)i(whose)376 386 y(p)s(ermissions)25 b(for)i(other)g
-(licensees)h(extend)f(to)g(the)g(en)m(tire)h(whole,)g(and)e(th)m(us)h
-(to)g(eac)m(h)h(and)e(ev)m(ery)376 499 y(part)k(regardless)h(of)f(who)g
-(wrote)h(it.)376 649 y(Th)m(us,)43 b(it)f(is)g(not)g(the)g(in)m(ten)m
-(t)h(of)e(this)h(section)h(to)f(claim)h(righ)m(ts)f(or)f(con)m(test)j
-(y)m(our)d(righ)m(ts)h(to)376 762 y(w)m(ork)30 b(written)f(en)m(tirely)
-i(b)m(y)f(y)m(ou;)h(rather,)f(the)g(in)m(ten)m(t)h(is)f(to)g(exercise)i
-(the)e(righ)m(t)g(to)h(con)m(trol)g(the)376 875 y(distribution)e(of)i
-(deriv)-5 b(ativ)m(e)32 b(or)e(collectiv)m(e)k(w)m(orks)c(based)g(on)h
-(the)f(Program.)376 1025 y(In)21 b(addition,)j(mere)e(aggregation)i(of)
-e(another)g(w)m(ork)g(not)g(based)g(on)f(the)h(Program)g(with)g(the)g
-(Pro-)376 1138 y(gram)27 b(\(or)g(with)g(a)g(w)m(ork)g(based)g(on)f
-(the)i(Program\))f(on)g(a)g(v)m(olume)h(of)f(a)g(storage)i(or)e
-(distribution)376 1251 y(medium)i(do)s(es)h(not)h(bring)e(the)i(other)g
-(w)m(ork)f(under)f(the)h(scop)s(e)h(of)f(this)h(License.)259
-1438 y(3.)47 b(Y)-8 b(ou)33 b(ma)m(y)h(cop)m(y)g(and)f(distribute)g
-(the)g(Program)h(\(or)f(a)h(w)m(ork)f(based)g(on)h(it,)g(under)e
-(Section)i(2\))376 1551 y(in)26 b(ob)5 b(ject)27 b(co)s(de)g(or)g
-(executable)h(form)e(under)f(the)i(terms)f(of)h(Sections)g(1)g(and)f(2)
-h(ab)s(o)m(v)m(e)g(pro)m(vided)376 1664 y(that)k(y)m(ou)f(also)i(do)e
+27 26 bop 376 273 a Fj(Program,)34 b(the)f(distribution)d(of)j(the)h
+(whole)e(m)m(ust)h(b)s(e)g(on)g(the)h(terms)f(of)g(this)f(License,)i
+(whose)376 386 y(p)s(ermissions)23 b(for)k(other)g(licensees)f(extend)h
+(to)g(the)g(en)m(tire)g(whole,)g(and)f(th)m(us)h(to)g(eac)m(h)h(and)e
+(ev)m(ery)376 499 y(part)k(regardless)g(of)g(who)g(wrote)h(it.)376
+649 y(Th)m(us,)43 b(it)e(is)g(not)h(the)g(in)m(ten)m(t)g(of)f(this)g
+(section)h(to)g(claim)f(righ)m(ts)g(or)g(con)m(test)j(y)m(our)d(righ)m
+(ts)g(to)376 762 y(w)m(ork)30 b(written)e(en)m(tirely)h(b)m(y)h(y)m
+(ou;)h(rather,)f(the)g(in)m(ten)m(t)g(is)f(to)h(exercise)h(the)f(righ)m
+(t)f(to)i(con)m(trol)f(the)376 875 y(distribution)c(of)31
+b(deriv)-5 b(ativ)m(e)30 b(or)g(collectiv)m(e)h(w)m(orks)f(based)g(on)h
+(the)f(Program.)376 1025 y(In)21 b(addition,)h(mere)g(aggregation)h(of)
+f(another)g(w)m(ork)g(not)g(based)g(on)f(the)h(Program)g(with)f(the)h
+(Pro-)376 1138 y(gram)27 b(\(or)g(with)f(a)h(w)m(ork)g(based)g(on)f
+(the)i(Program\))f(on)g(a)g(v)m(olume)g(of)g(a)g(storage)i(or)e
+(distribution)376 1251 y(medium)h(do)s(es)i(not)h(bring)d(the)j(other)g
+(w)m(ork)f(under)f(the)h(scop)s(e)h(of)f(this)g(License.)259
+1438 y(3.)47 b(Y)-8 b(ou)33 b(ma)m(y)h(cop)m(y)g(and)f(distribute)e
+(the)i(Program)h(\(or)f(a)h(w)m(ork)f(based)g(on)h(it,)f(under)f
+(Section)h(2\))376 1551 y(in)25 b(ob)5 b(ject)27 b(co)s(de)g(or)g
+(executable)g(form)f(under)f(the)i(terms)f(of)h(Sections)f(1)h(and)f(2)
+h(ab)s(o)m(v)m(e)g(pro)m(vided)376 1664 y(that)k(y)m(ou)f(also)h(do)f
(one)h(of)f(the)h(follo)m(wing:)414 1877 y(\(a\))47 b(Accompan)m(y)36
-b(it)h(with)e(the)h(complete)h(corresp)s(onding)e(mac)m(hine-readable)j
-(source)e(co)s(de,)576 1990 y(whic)m(h)20 b(m)m(ust)h(b)s(e)f
-(distributed)g(under)f(the)i(terms)f(of)h(Sections)h(1)f(and)f(2)h(ab)s
-(o)m(v)m(e)h(on)f(a)g(medium)576 2103 y(customarily)31
-b(used)e(for)h(soft)m(w)m(are)i(in)m(terc)m(hange;)h(or,)409
-2249 y(\(b\))46 b(Accompan)m(y)25 b(it)f(with)g(a)g(written)g(o\013er,)
-i(v)-5 b(alid)24 b(for)g(at)h(least)g(three)f(y)m(ears,)i(to)f(giv)m(e)
-h(an)m(y)e(third)576 2362 y(part)m(y)-8 b(,)34 b(for)e(a)h(c)m(harge)h
-(no)e(more)h(than)f(y)m(our)h(cost)g(of)g(ph)m(ysically)g(p)s
-(erforming)e(source)i(dis-)576 2475 y(tribution,)h(a)h(complete)g(mac)m
-(hine-readable)h(cop)m(y)e(of)g(the)h(corresp)s(onding)d(source)j(co)s
-(de,)576 2588 y(to)f(b)s(e)e(distributed)g(under)g(the)h(terms)h(of)f
-(Sections)h(1)f(and)g(2)h(ab)s(o)m(v)m(e)g(on)f(a)h(medium)e(cus-)576
-2700 y(tomarily)f(used)f(for)g(soft)m(w)m(are)i(in)m(terc)m(hange;)g
-(or,)419 2847 y(\(c\))47 b(Accompan)m(y)41 b(it)g(with)f(the)h
-(information)g(y)m(ou)g(receiv)m(ed)h(as)e(to)i(the)e(o\013er)h(to)h
-(distribute)576 2959 y(corresp)s(onding)30 b(source)h(co)s(de.)42
-b(\(This)31 b(alternativ)m(e)i(is)e(allo)m(w)m(ed)i(only)e(for)g
-(noncommercial)576 3072 y(distribution)i(and)h(only)g(if)g(y)m(ou)h
-(receiv)m(ed)g(the)g(program)f(in)g(ob)5 b(ject)35 b(co)s(de)f(or)g
-(executable)576 3185 y(form)29 b(with)i(suc)m(h)f(an)g(o\013er,)h(in)f
-(accord)h(with)f(Subsection)g(b)g(ab)s(o)m(v)m(e.\))376
+b(it)g(with)e(the)i(complete)g(corresp)s(onding)e(mac)m(hine-readable)i
+(source)g(co)s(de,)576 1990 y(whic)m(h)19 b(m)m(ust)i(b)s(e)f
+(distributed)e(under)h(the)i(terms)f(of)h(Sections)g(1)g(and)f(2)h(ab)s
+(o)m(v)m(e)h(on)f(a)g(medium)576 2103 y(customarily)29
+b(used)g(for)h(soft)m(w)m(are)i(in)m(terc)m(hange;)g(or,)409
+2249 y(\(b\))46 b(Accompan)m(y)25 b(it)e(with)g(a)h(written)f(o\013er,)
+j(v)-5 b(alid)22 b(for)i(at)h(least)f(three)g(y)m(ears,)i(to)f(giv)m(e)
+g(an)m(y)f(third)576 2362 y(part)m(y)-8 b(,)34 b(for)e(a)h(c)m(harge)h
+(no)e(more)h(than)f(y)m(our)h(cost)g(of)g(ph)m(ysically)d(p)s
+(erforming)g(source)j(dis-)576 2475 y(tribution,)f(a)j(complete)f(mac)m
+(hine-readable)g(cop)m(y)g(of)g(the)h(corresp)s(onding)c(source)k(co)s
+(de,)576 2588 y(to)f(b)s(e)e(distributed)e(under)i(the)h(terms)h(of)f
+(Sections)g(1)g(and)g(2)h(ab)s(o)m(v)m(e)g(on)f(a)h(medium)d(cus-)576
+2700 y(tomarily)e(used)h(for)g(soft)m(w)m(are)i(in)m(terc)m(hange;)f
+(or,)419 2847 y(\(c\))47 b(Accompan)m(y)41 b(it)f(with)f(the)i
+(information)e(y)m(ou)i(receiv)m(ed)g(as)f(to)i(the)e(o\013er)h(to)h
+(distribute)576 2959 y(corresp)s(onding)29 b(source)i(co)s(de.)42
+b(\(This)30 b(alternativ)m(e)h(is)f(allo)m(w)m(ed)h(only)f(for)h
+(noncommercial)576 3072 y(distribution)f(and)k(only)f(if)g(y)m(ou)i
+(receiv)m(ed)f(the)h(program)f(in)f(ob)5 b(ject)35 b(co)s(de)f(or)g
+(executable)576 3185 y(form)29 b(with)h(suc)m(h)g(an)g(o\013er,)h(in)e
+(accord)i(with)e(Subsection)g(b)h(ab)s(o)m(v)m(e.\))376
3398 y(The)k(source)h(co)s(de)g(for)f(a)h(w)m(ork)g(means)g(the)g
-(preferred)e(form)h(of)h(the)g(w)m(ork)g(for)g(making)g(mo)s(d-)376
-3511 y(i\014cations)h(to)g(it.)56 b(F)-8 b(or)36 b(an)f(executable)i(w)
-m(ork,)g(complete)f(source)g(co)s(de)f(means)g(all)h(the)g(source)376
-3624 y(co)s(de)k(for)f(all)i(mo)s(dules)e(it)h(con)m(tains,)k(plus)39
-b(an)m(y)h(asso)s(ciated)h(in)m(terface)g(de\014nition)f(\014les,)i
-(plus)376 3737 y(the)33 b(scripts)h(used)e(to)i(con)m(trol)h
-(compilation)g(and)e(installation)j(of)d(the)h(executable.)52
-b(Ho)m(w)m(ev)m(er,)376 3849 y(as)31 b(a)h(sp)s(ecial)g(exception,)h
-(the)e(source)h(co)s(de)f(distributed)g(need)g(not)g(include)g(an)m
-(ything)h(that)g(is)376 3962 y(normally)38 b(distributed)g(\(in)h
-(either)g(source)f(or)h(binary)f(form\))g(with)h(the)f(ma)5
-b(jor)39 b(comp)s(onen)m(ts)376 4075 y(\(compiler,)34
-b(k)m(ernel,)g(and)f(so)g(on\))g(of)g(the)g(op)s(erating)g(system)g(on)
-f(whic)m(h)h(the)g(executable)h(runs,)376 4188 y(unless)29
-b(that)i(comp)s(onen)m(t)g(itself)g(accompanies)h(the)e(executable.)376
-4338 y(If)k(distribution)h(of)g(executable)h(or)f(ob)5
-b(ject)36 b(co)s(de)g(is)f(made)g(b)m(y)g(o\013ering)h(access)g(to)g
-(cop)m(y)g(from)376 4451 y(a)d(designated)h(place,)h(then)d(o\013ering)
-i(equiv)-5 b(alen)m(t)35 b(access)f(to)g(cop)m(y)g(the)f(source)g(co)s
-(de)g(from)g(the)376 4564 y(same)j(place)h(coun)m(ts)f(as)g
-(distribution)f(of)h(the)g(source)g(co)s(de,)i(ev)m(en)e(though)g
-(third)e(parties)j(are)376 4677 y(not)30 b(comp)s(elled)h(to)g(cop)m(y)
-g(the)g(source)f(along)i(with)e(the)g(ob)5 b(ject)32
-b(co)s(de.)259 4865 y(4.)47 b(Y)-8 b(ou)30 b(ma)m(y)h(not)f(cop)m(y)-8
-b(,)32 b(mo)s(dify)-8 b(,)30 b(sublicense,)g(or)g(distribute)g(the)g
-(Program)h(except)g(as)f(expressly)376 4978 y(pro)m(vided)35
-b(under)g(this)h(License.)59 b(An)m(y)36 b(attempt)i(otherwise)e(to)h
-(cop)m(y)-8 b(,)39 b(mo)s(dify)-8 b(,)38 b(sublicense)e(or)376
-5091 y(distribute)g(the)h(Program)g(is)g(v)m(oid,)j(and)c(will)h
-(automatically)j(terminate)e(y)m(our)f(righ)m(ts)h(under)376
-5204 y(this)e(License.)59 b(Ho)m(w)m(ev)m(er,)40 b(parties)d(who)f(ha)m
-(v)m(e)h(receiv)m(ed)h(copies,)h(or)d(righ)m(ts,)j(from)d(y)m(ou)h
-(under)1897 5525 y(27)p eop end
+(preferred)e(form)h(of)h(the)g(w)m(ork)g(for)g(making)f(mo)s(d-)376
+3511 y(i\014cations)g(to)i(it.)55 b(F)-8 b(or)36 b(an)f(executable)h(w)
+m(ork,)h(complete)e(source)h(co)s(de)f(means)g(all)f(the)i(source)376
+3624 y(co)s(de)k(for)f(all)g(mo)s(dules)f(it)h(con)m(tains,)k(plus)38
+b(an)m(y)i(asso)s(ciated)g(in)m(terface)g(de\014nition)e(\014les,)j
+(plus)376 3737 y(the)33 b(scripts)g(used)f(to)i(con)m(trol)g
+(compilation)e(and)h(installation)f(of)h(the)h(executable.)51
+b(Ho)m(w)m(ev)m(er,)376 3849 y(as)31 b(a)h(sp)s(ecial)e(exception,)i
+(the)f(source)h(co)s(de)f(distributed)e(need)i(not)g(include)e(an)m
+(ything)i(that)h(is)376 3962 y(normally)k(distributed)g(\(in)i(either)g
+(source)g(or)h(binary)e(form\))h(with)g(the)g(ma)5 b(jor)39
+b(comp)s(onen)m(ts)376 4075 y(\(compiler,)32 b(k)m(ernel,)h(and)g(so)g
+(on\))g(of)g(the)g(op)s(erating)f(system)h(on)f(whic)m(h)g(the)h
+(executable)g(runs,)376 4188 y(unless)28 b(that)j(comp)s(onen)m(t)g
+(itself)e(accompanies)i(the)f(executable.)376 4338 y(If)k(distribution)
+e(of)j(executable)g(or)g(ob)5 b(ject)36 b(co)s(de)g(is)e(made)h(b)m(y)g
+(o\013ering)g(access)h(to)g(cop)m(y)g(from)376 4451 y(a)d(designated)g
+(place,)h(then)e(o\013ering)h(equiv)-5 b(alen)m(t)33
+b(access)h(to)g(cop)m(y)g(the)f(source)g(co)s(de)g(from)g(the)376
+4564 y(same)j(place)g(coun)m(ts)g(as)g(distribution)c(of)k(the)g
+(source)g(co)s(de,)i(ev)m(en)e(though)g(third)d(parties)j(are)376
+4677 y(not)30 b(comp)s(elled)f(to)i(cop)m(y)g(the)g(source)f(along)h
+(with)e(the)h(ob)5 b(ject)32 b(co)s(de.)259 4865 y(4.)47
+b(Y)-8 b(ou)30 b(ma)m(y)h(not)f(cop)m(y)-8 b(,)32 b(mo)s(dify)-8
+b(,)29 b(sublicense,)f(or)i(distribute)e(the)i(Program)h(except)g(as)f
+(expressly)376 4978 y(pro)m(vided)k(under)h(this)g(License.)58
+b(An)m(y)36 b(attempt)i(otherwise)d(to)i(cop)m(y)-8 b(,)39
+b(mo)s(dify)-8 b(,)37 b(sublicense)d(or)376 5091 y(distribute)g(the)j
+(Program)g(is)f(v)m(oid,)j(and)d(will)e(automatically)j(terminate)g(y)m
+(our)g(righ)m(ts)g(under)376 5204 y(this)e(License.)58
+b(Ho)m(w)m(ev)m(er,)40 b(parties)c(who)g(ha)m(v)m(e)h(receiv)m(ed)g
+(copies,)h(or)e(righ)m(ts,)i(from)e(y)m(ou)h(under)1897
+5525 y(27)p eop
%%Page: 28 28
-TeXDict begin 28 27 bop 376 273 a Fj(this)31 b(License)g(will)h(not)g
-(ha)m(v)m(e)g(their)f(licenses)h(terminated)g(so)f(long)h(as)g(suc)m(h)
-f(parties)g(remain)g(in)376 386 y(full)f(compliance.)259
-567 y(5.)47 b(Y)-8 b(ou)34 b(are)g(not)g(required)f(to)i(accept)g(this)
-f(License,)i(since)e(y)m(ou)g(ha)m(v)m(e)h(not)f(signed)g(it.)52
-b(Ho)m(w)m(ev)m(er,)376 680 y(nothing)28 b(else)h(gran)m(ts)g(y)m(ou)f
-(p)s(ermission)f(to)i(mo)s(dify)e(or)i(distribute)e(the)i(Program)f(or)
-g(its)h(deriv)-5 b(a-)376 793 y(tiv)m(e)39 b(w)m(orks.)63
-b(These)38 b(actions)h(are)f(prohibited)f(b)m(y)h(la)m(w)g(if)g(y)m(ou)
-g(do)g(not)g(accept)h(this)f(License.)376 905 y(Therefore,)29
-b(b)m(y)g(mo)s(difying)f(or)h(distributing)f(the)h(Program)h(\(or)f(an)
+28 27 bop 376 273 a Fj(this)30 b(License)g(will)f(not)j(ha)m(v)m(e)g
+(their)e(licenses)g(terminated)h(so)g(long)g(as)h(suc)m(h)f(parties)f
+(remain)g(in)376 386 y(full)e(compliance.)259 567 y(5.)47
+b(Y)-8 b(ou)34 b(are)g(not)g(required)e(to)j(accept)g(this)e(License,)i
+(since)e(y)m(ou)h(ha)m(v)m(e)h(not)f(signed)f(it.)51
+b(Ho)m(w)m(ev)m(er,)376 680 y(nothing)27 b(else)h(gran)m(ts)h(y)m(ou)f
+(p)s(ermission)d(to)k(mo)s(dify)d(or)j(distribute)c(the)k(Program)f(or)
+g(its)g(deriv)-5 b(a-)376 793 y(tiv)m(e)38 b(w)m(orks.)63
+b(These)38 b(actions)g(are)g(prohibited)d(b)m(y)j(la)m(w)f(if)g(y)m(ou)
+h(do)g(not)g(accept)h(this)e(License.)376 905 y(Therefore,)29
+b(b)m(y)g(mo)s(difying)d(or)j(distributing)c(the)k(Program)h(\(or)f(an)
m(y)g(w)m(ork)g(based)g(on)g(the)g(Pro-)376 1018 y(gram\),)37
-b(y)m(ou)f(indicate)h(y)m(our)f(acceptance)i(of)d(this)h(License)g(to)g
-(do)g(so,)h(and)f(all)g(its)g(terms)g(and)376 1131 y(conditions)30
-b(for)h(cop)m(ying,)g(distributing)f(or)g(mo)s(difying)g(the)h(Program)
+b(y)m(ou)f(indicate)f(y)m(our)h(acceptance)i(of)d(this)g(License)g(to)h
+(do)g(so,)h(and)f(all)e(its)h(terms)h(and)376 1131 y(conditions)28
+b(for)j(cop)m(ying,)f(distributing)d(or)j(mo)s(difying)e(the)j(Program)
f(or)g(w)m(orks)h(based)f(on)g(it.)259 1312 y(6.)47 b(Eac)m(h)38
-b(time)g(y)m(ou)g(redistribute)f(the)h(Program)f(\(or)h(an)m(y)g(w)m
-(ork)g(based)f(on)g(the)h(Program\),)i(the)376 1425 y(recipien)m(t)28
-b(automatically)i(receiv)m(es)e(a)g(license)g(from)e(the)i(original)g
-(licensor)g(to)f(cop)m(y)-8 b(,)30 b(distribute)376 1538
-y(or)i(mo)s(dify)g(the)g(Program)h(sub)5 b(ject)32 b(to)h(these)g
-(terms)f(and)g(conditions.)48 b(Y)-8 b(ou)33 b(ma)m(y)g(not)f(imp)s
-(ose)376 1651 y(an)m(y)i(further)e(restrictions)j(on)f(the)g(recipien)m
-(ts')h(exercise)g(of)f(the)g(righ)m(ts)g(gran)m(ted)h(herein.)51
-b(Y)-8 b(ou)376 1764 y(are)30 b(not)h(resp)s(onsible)e(for)i(enforcing)
-f(compliance)i(b)m(y)e(third)g(parties)g(to)i(this)e(License.)259
+b(time)f(y)m(ou)h(redistribute)d(the)j(Program)f(\(or)h(an)m(y)g(w)m
+(ork)g(based)f(on)g(the)h(Program\),)i(the)376 1425 y(recipien)m(t)26
+b(automatically)h(receiv)m(es)g(a)h(license)e(from)g(the)i(original)d
+(licensor)h(to)h(cop)m(y)-8 b(,)30 b(distribute)376 1538
+y(or)i(mo)s(dify)f(the)h(Program)h(sub)5 b(ject)32 b(to)h(these)g
+(terms)f(and)g(conditions.)46 b(Y)-8 b(ou)33 b(ma)m(y)g(not)f(imp)s
+(ose)376 1651 y(an)m(y)i(further)e(restrictions)h(on)h(the)g(recipien)m
+(ts')f(exercise)h(of)g(the)g(righ)m(ts)f(gran)m(ted)i(herein.)50
+b(Y)-8 b(ou)376 1764 y(are)30 b(not)h(resp)s(onsible)c(for)k(enforcing)
+e(compliance)h(b)m(y)g(third)f(parties)g(to)j(this)d(License.)259
1945 y(7.)47 b(If,)24 b(as)f(a)g(consequence)g(of)g(a)g(court)g
-(judgmen)m(t)g(or)f(allegation)k(of)d(paten)m(t)h(infringemen)m(t)e(or)
-h(for)g(an)m(y)376 2058 y(other)33 b(reason)g(\(not)g(limited)g(to)h
-(paten)m(t)g(issues\),)f(conditions)g(are)h(imp)s(osed)e(on)g(y)m(ou)h
+(judgmen)m(t)g(or)f(allegation)h(of)g(paten)m(t)h(infringemen)m(t)c(or)
+j(for)g(an)m(y)376 2058 y(other)33 b(reason)g(\(not)g(limited)d(to)k
+(paten)m(t)g(issues\),)e(conditions)f(are)j(imp)s(osed)d(on)h(y)m(ou)h
(\(whether)376 2171 y(b)m(y)24 b(court)h(order,)g(agreemen)m(t)h(or)f
-(otherwise\))g(that)g(con)m(tradict)h(the)e(conditions)h(of)g(this)f
+(otherwise\))f(that)h(con)m(tradict)g(the)f(conditions)f(of)i(this)e
(License,)376 2284 y(they)32 b(do)f(not)h(excuse)h(y)m(ou)f(from)f(the)
-i(conditions)f(of)g(this)g(License.)45 b(If)32 b(y)m(ou)g(cannot)h
-(distribute)376 2396 y(so)43 b(as)f(to)i(satisfy)f(sim)m(ultaneously)h
-(y)m(our)e(obligations)j(under)c(this)h(License)i(and)e(an)m(y)h(other)
-376 2509 y(p)s(ertinen)m(t)31 b(obligations,)j(then)e(as)f(a)i
-(consequence)f(y)m(ou)g(ma)m(y)g(not)g(distribute)g(the)f(Program)h(at)
-376 2622 y(all.)57 b(F)-8 b(or)36 b(example,)i(if)e(a)g(paten)m(t)g
-(license)h(w)m(ould)f(not)f(p)s(ermit)g(ro)m(y)m(alt)m(y-free)k
-(redistribution)c(of)376 2735 y(the)c(Program)h(b)m(y)f(all)h(those)g
-(who)f(receiv)m(e)j(copies)e(directly)g(or)f(indirectly)h(through)f(y)m
-(ou,)h(then)376 2848 y(the)i(only)g(w)m(a)m(y)h(y)m(ou)f(could)g
-(satisfy)h(b)s(oth)e(it)i(and)e(this)h(License)g(w)m(ould)g(b)s(e)g(to)
-g(refrain)g(en)m(tirely)376 2961 y(from)29 b(distribution)h(of)h(the)f
-(Program.)376 3108 y(If)38 b(an)m(y)h(p)s(ortion)f(of)h(this)g(section)
-h(is)e(held)h(in)m(v)-5 b(alid)39 b(or)g(unenforceable)f(under)g(an)m
-(y)h(particular)376 3221 y(circumstance,)j(the)d(balance)h(of)f(the)h
-(section)g(is)f(in)m(tended)g(to)h(apply)e(and)h(the)g(section)h(as)g
-(a)376 3334 y(whole)30 b(is)h(in)m(tended)f(to)h(apply)f(in)g(other)h
-(circumstances.)376 3481 y(It)37 b(is)f(not)h(the)g(purp)s(ose)f(of)g
-(this)h(section)h(to)g(induce)e(y)m(ou)h(to)h(infringe)e(an)m(y)h
-(paten)m(ts)h(or)f(other)376 3594 y(prop)s(ert)m(y)e(righ)m(t)h(claims)
-h(or)f(to)g(con)m(test)i(v)-5 b(alidit)m(y)37 b(of)f(an)m(y)g(suc)m(h)g
-(claims;)k(this)35 b(section)i(has)f(the)376 3706 y(sole)26
-b(purp)s(ose)d(of)i(protecting)i(the)e(in)m(tegrit)m(y)i(of)e(the)h
-(free)f(soft)m(w)m(are)h(distribution)f(system,)h(whic)m(h)376
-3819 y(is)k(implemen)m(ted)h(b)m(y)g(public)f(license)h(practices.)43
-b(Man)m(y)31 b(p)s(eople)g(ha)m(v)m(e)g(made)g(generous)g(con)m(tri-)
-376 3932 y(butions)f(to)h(the)h(wide)e(range)h(of)g(soft)m(w)m(are)i
-(distributed)d(through)g(that)h(system)g(in)g(reliance)h(on)376
-4045 y(consisten)m(t)h(application)g(of)e(that)i(system;)f(it)h(is)e
-(up)g(to)h(the)g(author/donor)f(to)i(decide)f(if)g(he)f(or)376
-4158 y(she)h(is)h(willing)h(to)f(distribute)g(soft)m(w)m(are)h(through)
-f(an)m(y)g(other)g(system)g(and)g(a)g(licensee)h(cannot)376
-4271 y(imp)s(ose)c(that)h(c)m(hoice.)376 4418 y(This)22
-b(section)i(is)f(in)m(tended)g(to)g(mak)m(e)h(thoroughly)f(clear)h
-(what)f(is)g(b)s(eliev)m(ed)h(to)g(b)s(e)e(a)h(consequence)376
-4531 y(of)30 b(the)h(rest)f(of)h(this)f(License.)259
-4712 y(8.)47 b(If)30 b(the)g(distribution)g(and/or)h(use)f(of)h(the)f
-(Program)h(is)f(restricted)i(in)e(certain)h(coun)m(tries)h(either)376
-4825 y(b)m(y)e(paten)m(ts)h(or)g(b)m(y)f(cop)m(yrigh)m(ted)i(in)m
-(terfaces,)h(the)d(original)i(cop)m(yrigh)m(t)g(holder)e(who)g(places)i
-(the)376 4938 y(Program)e(under)f(this)h(License)h(ma)m(y)g(add)f(an)g
-(explicit)i(geographical)g(distribution)e(limitation)376
-5051 y(excluding)23 b(those)i(coun)m(tries,)h(so)d(that)i(distribution)
-e(is)g(p)s(ermitted)g(only)h(in)f(or)h(among)g(coun)m(tries)376
-5163 y(not)k(th)m(us)g(excluded.)40 b(In)28 b(suc)m(h)g(case,)j(this)d
-(License)h(incorp)s(orates)g(the)f(limitation)j(as)e(if)f(written)376
-5276 y(in)i(the)g(b)s(o)s(dy)f(of)i(this)f(License.)1897
-5525 y(28)p eop end
+i(conditions)d(of)i(this)f(License.)44 b(If)32 b(y)m(ou)g(cannot)h
+(distribute)376 2396 y(so)43 b(as)f(to)i(satisfy)e(sim)m(ultaneously)f
+(y)m(our)h(obligations)g(under)f(this)g(License)i(and)f(an)m(y)h(other)
+376 2509 y(p)s(ertinen)m(t)30 b(obligations,)h(then)h(as)f(a)i
+(consequence)f(y)m(ou)g(ma)m(y)g(not)g(distribute)e(the)h(Program)h(at)
+376 2622 y(all.)55 b(F)-8 b(or)36 b(example,)h(if)e(a)h(paten)m(t)g
+(license)f(w)m(ould)g(not)g(p)s(ermit)f(ro)m(y)m(alt)m(y-free)k
+(redistribution)32 b(of)376 2735 y(the)f(Program)h(b)m(y)f(all)f(those)
+i(who)f(receiv)m(e)i(copies)e(directly)f(or)h(indirectly)e(through)i(y)
+m(ou,)h(then)376 2848 y(the)i(only)f(w)m(a)m(y)i(y)m(ou)f(could)f
+(satisfy)h(b)s(oth)f(it)h(and)f(this)g(License)g(w)m(ould)g(b)s(e)h(to)
+g(refrain)f(en)m(tirely)376 2961 y(from)c(distribution)e(of)k(the)f
+(Program.)376 3108 y(If)38 b(an)m(y)h(p)s(ortion)e(of)i(this)f(section)
+h(is)e(held)h(in)m(v)-5 b(alid)36 b(or)j(unenforceable)e(under)h(an)m
+(y)h(particular)376 3221 y(circumstance,)i(the)e(balance)g(of)g(the)h
+(section)f(is)f(in)m(tended)g(to)i(apply)d(and)i(the)g(section)g(as)h
+(a)376 3334 y(whole)29 b(is)h(in)m(tended)f(to)i(apply)e(in)g(other)i
+(circumstances.)376 3481 y(It)37 b(is)e(not)i(the)g(purp)s(ose)f(of)g
+(this)g(section)h(to)h(induce)d(y)m(ou)i(to)h(infringe)c(an)m(y)j
+(paten)m(ts)h(or)f(other)376 3594 y(prop)s(ert)m(y)e(righ)m(t)g(claims)
+g(or)h(to)g(con)m(test)i(v)-5 b(alidit)m(y)34 b(of)i(an)m(y)g(suc)m(h)g
+(claims;)i(this)c(section)i(has)g(the)376 3706 y(sole)25
+b(purp)s(ose)e(of)i(protecting)h(the)f(in)m(tegrit)m(y)g(of)g(the)h
+(free)f(soft)m(w)m(are)h(distribution)c(system,)k(whic)m(h)376
+3819 y(is)j(implemen)m(ted)g(b)m(y)i(public)d(license)h(practices.)42
+b(Man)m(y)31 b(p)s(eople)f(ha)m(v)m(e)h(made)g(generous)g(con)m(tri-)
+376 3932 y(butions)e(to)i(the)h(wide)d(range)i(of)g(soft)m(w)m(are)i
+(distributed)28 b(through)i(that)h(system)g(in)f(reliance)g(on)376
+4045 y(consisten)m(t)i(application)e(of)h(that)i(system;)f(it)g(is)e
+(up)h(to)h(the)g(author/donor)f(to)i(decide)e(if)g(he)g(or)376
+4158 y(she)h(is)g(willing)e(to)j(distribute)e(soft)m(w)m(are)j(through)
+f(an)m(y)g(other)g(system)g(and)g(a)g(licensee)f(cannot)376
+4271 y(imp)s(ose)d(that)i(c)m(hoice.)376 4418 y(This)21
+b(section)i(is)f(in)m(tended)g(to)h(mak)m(e)h(thoroughly)e(clear)h
+(what)g(is)f(b)s(eliev)m(ed)g(to)i(b)s(e)e(a)h(consequence)376
+4531 y(of)30 b(the)h(rest)f(of)h(this)e(License.)259
+4712 y(8.)47 b(If)30 b(the)g(distribution)d(and/or)k(use)f(of)h(the)f
+(Program)h(is)e(restricted)i(in)e(certain)h(coun)m(tries)h(either)376
+4825 y(b)m(y)f(paten)m(ts)h(or)g(b)m(y)f(cop)m(yrigh)m(ted)h(in)m
+(terfaces,)h(the)e(original)f(cop)m(yrigh)m(t)i(holder)e(who)h(places)h
+(the)376 4938 y(Program)f(under)f(this)g(License)h(ma)m(y)h(add)f(an)g
+(explicit)f(geographical)h(distribution)d(limitation)376
+5051 y(excluding)21 b(those)k(coun)m(tries,)g(so)e(that)i(distribution)
+20 b(is)i(p)s(ermitted)g(only)h(in)f(or)i(among)g(coun)m(tries)376
+5163 y(not)k(th)m(us)g(excluded.)39 b(In)28 b(suc)m(h)g(case,)j(this)c
+(License)h(incorp)s(orates)g(the)g(limitation)f(as)i(if)e(written)376
+5276 y(in)i(the)h(b)s(o)s(dy)f(of)i(this)e(License.)1897
+5525 y(28)p eop
%%Page: 29 29
-TeXDict begin 29 28 bop 259 273 a Fj(9.)47 b(The)21 b(F)-8
-b(ree)23 b(Soft)m(w)m(are)g(F)-8 b(oundation)22 b(ma)m(y)h(publish)d
-(revised)i(and/or)g(new)f(v)m(ersions)h(of)g(the)g(General)376
-386 y(Public)33 b(License)h(from)f(time)i(to)f(time.)51
-b(Suc)m(h)33 b(new)g(v)m(ersions)h(will)g(b)s(e)f(similar)h(in)f
-(spirit)h(to)g(the)376 499 y(presen)m(t)c(v)m(ersion,)h(but)f(ma)m(y)h
-(di\013er)f(in)g(detail)h(to)h(address)d(new)h(problems)g(or)g
-(concerns.)376 649 y(Eac)m(h)41 b(v)m(ersion)g(is)g(giv)m(en)h(a)f
-(distinguishing)f(v)m(ersion)h(n)m(um)m(b)s(er.)70 b(If)41
-b(the)f(Program)h(sp)s(eci\014es)g(a)376 762 y(v)m(ersion)32
-b(n)m(um)m(b)s(er)e(of)i(this)f(License)i(whic)m(h)e(applies)h(to)g(it)
-g(and)g(\\an)m(y)g(later)h(v)m(ersion",)g(y)m(ou)f(ha)m(v)m(e)376
-875 y(the)d(option)g(of)g(follo)m(wing)h(the)f(terms)g(and)f
-(conditions)i(either)f(of)g(that)h(v)m(ersion)f(or)g(of)g(an)m(y)g
-(later)376 988 y(v)m(ersion)i(published)f(b)m(y)h(the)h(F)-8
-b(ree)32 b(Soft)m(w)m(are)h(F)-8 b(oundation.)44 b(If)31
+29 28 bop 259 273 a Fj(9.)47 b(The)21 b(F)-8 b(ree)23
+b(Soft)m(w)m(are)g(F)-8 b(oundation)21 b(ma)m(y)i(publish)18
+b(revised)j(and/or)h(new)f(v)m(ersions)g(of)h(the)g(General)376
+386 y(Public)31 b(License)i(from)g(time)h(to)g(time.)50
+b(Suc)m(h)33 b(new)g(v)m(ersions)g(will)e(b)s(e)i(similar)e(in)h
+(spirit)g(to)i(the)376 499 y(presen)m(t)c(v)m(ersion,)g(but)g(ma)m(y)h
+(di\013er)e(in)g(detail)g(to)j(address)d(new)h(problems)f(or)h
+(concerns.)376 649 y(Eac)m(h)41 b(v)m(ersion)f(is)g(giv)m(en)h(a)g
+(distinguishing)36 b(v)m(ersion)k(n)m(um)m(b)s(er.)70
+b(If)41 b(the)f(Program)h(sp)s(eci\014es)f(a)376 762
+y(v)m(ersion)31 b(n)m(um)m(b)s(er)f(of)i(this)e(License)i(whic)m(h)e
+(applies)g(to)i(it)f(and)h(\\an)m(y)g(later)g(v)m(ersion",)g(y)m(ou)g
+(ha)m(v)m(e)376 875 y(the)d(option)f(of)h(follo)m(wing)e(the)i(terms)g
+(and)f(conditions)g(either)g(of)h(that)h(v)m(ersion)e(or)h(of)g(an)m(y)
+g(later)376 988 y(v)m(ersion)h(published)e(b)m(y)j(the)h(F)-8
+b(ree)32 b(Soft)m(w)m(are)h(F)-8 b(oundation.)43 b(If)31
b(the)g(Program)h(do)s(es)f(not)g(sp)s(ecify)376 1101
-y(a)h(v)m(ersion)h(n)m(um)m(b)s(er)e(of)i(this)f(License,)i(y)m(ou)e
-(ma)m(y)h(c)m(ho)s(ose)g(an)m(y)g(v)m(ersion)g(ev)m(er)g(published)e(b)
-m(y)h(the)376 1213 y(F)-8 b(ree)31 b(Soft)m(w)m(are)h(F)-8
-b(oundation.)214 1401 y(10.)47 b(If)d(y)m(ou)i(wish)f(to)h(incorp)s
-(orate)f(parts)h(of)f(the)h(Program)f(in)m(to)h(other)g(free)f
-(programs)g(whose)376 1514 y(distribution)34 b(conditions)i(are)g
-(di\013eren)m(t,)h(write)f(to)g(the)f(author)g(to)h(ask)g(for)f(p)s
-(ermission.)54 b(F)-8 b(or)376 1627 y(soft)m(w)m(are)42
-b(whic)m(h)f(is)g(cop)m(yrigh)m(ted)i(b)m(y)e(the)h(F)-8
-b(ree)42 b(Soft)m(w)m(are)g(F)-8 b(oundation,)45 b(write)d(to)g(the)f
-(F)-8 b(ree)376 1740 y(Soft)m(w)m(are)37 b(F)-8 b(oundation;)41
-b(w)m(e)36 b(sometimes)i(mak)m(e)f(exceptions)h(for)e(this.)59
-b(Our)35 b(decision)i(will)g(b)s(e)376 1853 y(guided)j(b)m(y)g(the)h(t)
-m(w)m(o)h(goals)g(of)f(preserving)f(the)g(free)h(status)g(of)g(all)g
-(deriv)-5 b(ativ)m(es)42 b(of)f(our)f(free)376 1966 y(soft)m(w)m(are)31
-b(and)f(of)h(promoting)f(the)h(sharing)f(and)g(reuse)g(of)g(soft)m(w)m
-(are)i(generally)-8 b(.)1897 5525 y(29)p eop end
+y(a)h(v)m(ersion)g(n)m(um)m(b)s(er)f(of)i(this)e(License,)i(y)m(ou)f
+(ma)m(y)h(c)m(ho)s(ose)g(an)m(y)g(v)m(ersion)f(ev)m(er)h(published)c(b)
+m(y)j(the)376 1213 y(F)-8 b(ree)31 b(Soft)m(w)m(are)h(F)-8
+b(oundation.)214 1401 y(10.)47 b(If)d(y)m(ou)i(wish)e(to)i(incorp)s
+(orate)e(parts)i(of)f(the)h(Program)f(in)m(to)g(other)h(free)f
+(programs)g(whose)376 1514 y(distribution)31 b(conditions)j(are)i
+(di\013eren)m(t,)g(write)f(to)h(the)f(author)g(to)h(ask)g(for)f(p)s
+(ermission.)52 b(F)-8 b(or)376 1627 y(soft)m(w)m(are)42
+b(whic)m(h)e(is)g(cop)m(yrigh)m(ted)i(b)m(y)f(the)h(F)-8
+b(ree)42 b(Soft)m(w)m(are)g(F)-8 b(oundation,)44 b(write)d(to)h(the)f
+(F)-8 b(ree)376 1740 y(Soft)m(w)m(are)37 b(F)-8 b(oundation;)40
+b(w)m(e)c(sometimes)h(mak)m(e)g(exceptions)g(for)f(this.)58
+b(Our)35 b(decision)g(will)f(b)s(e)376 1853 y(guided)39
+b(b)m(y)h(the)h(t)m(w)m(o)h(goals)f(of)g(preserving)e(the)h(free)h
+(status)g(of)g(all)e(deriv)-5 b(ativ)m(es)40 b(of)h(our)f(free)376
+1966 y(soft)m(w)m(are)31 b(and)f(of)h(promoting)e(the)i(sharing)e(and)h
+(reuse)g(of)g(soft)m(w)m(are)i(generally)-8 b(.)1897
+5525 y(29)p eop
%%Page: 30 30
-TeXDict begin 30 29 bop 1636 273 a Ff(NO)34 b(W)-12 b(ARRANTY)214
-523 y Fj(11.)47 b(BECA)m(USE)34 b(THE)f(PR)m(OGRAM)i(IS)e(LICENSED)g
-(FREE)h(OF)g(CHAR)m(GE,)h(THERE)e(IS)g(NO)376 636 y(W)-10
-b(ARRANTY)35 b(F)m(OR)h(THE)f(PR)m(OGRAM,)i(TO)d(THE)h(EXTENT)g
-(PERMITTED)g(BY)h(AP-)376 749 y(PLICABLE)k(LA)-10 b(W.)42
-b(EX)m(CEPT)f(WHEN)h(OTHER)-10 b(WISE)40 b(ST)-8 b(A)g(TED)41
-b(IN)g(WRITING)g(THE)376 861 y(COPYRIGHT)19 b(HOLDERS)h(AND/OR)h(OTHER)
-e(P)-8 b(AR)g(TIES)20 b(PR)m(O)m(VIDE)h(THE)f(PR)m(OGRAM)376
+30 29 bop 1636 273 a Ff(NO)34 b(W)-12 b(ARRANTY)214 523
+y Fj(11.)47 b(BECA)m(USE)34 b(THE)f(PR)m(OGRAM)i(IS)e(LICENSED)g(FREE)h
+(OF)g(CHAR)m(GE,)h(THERE)e(IS)g(NO)376 636 y(W)-10 b(ARRANTY)35
+b(F)m(OR)h(THE)f(PR)m(OGRAM,)i(TO)d(THE)h(EXTENT)g(PERMITTED)g(BY)h
+(AP-)376 749 y(PLICABLE)k(LA)-10 b(W.)42 b(EX)m(CEPT)f(WHEN)h(OTHER)-10
+b(WISE)40 b(ST)-8 b(A)g(TED)41 b(IN)g(WRITING)g(THE)376
+861 y(COPYRIGHT)19 b(HOLDERS)h(AND/OR)h(OTHER)e(P)-8
+b(AR)g(TIES)20 b(PR)m(O)m(VIDE)h(THE)f(PR)m(OGRAM)376
974 y(\\AS)25 b(IS")g(WITHOUT)g(W)-10 b(ARRANTY)26 b(OF)f(ANY)h(KIND,)g
(EITHER)e(EXPRESSED)h(OR)g(IM-)376 1087 y(PLIED,)37 b(INCLUDING,)h(BUT)
g(NOT)f(LIMITED)h(TO,)f(THE)g(IMPLIED)h(W)-10 b(ARRANTIES)376
@@ -5136,8 +3619,8 @@ b(OR)f(A)h(F)-10 b(AILURE)35 b(OF)g(THE)376 2743 y(PR)m(OGRAM)d(TO)g
(SUCH)376 2856 y(HOLDER)27 b(OR)h(OTHER)f(P)-8 b(AR)g(TY)28
b(HAS)f(BEEN)h(AD)m(VISED)h(OF)f(THE)f(POSSIBILITY)f(OF)376
2969 y(SUCH)j(D)m(AMA)m(GES.)1153 3181 y(END)i(OF)f(TERMS)g(AND)h
-(CONDITIONS)1897 5525 y(30)p eop end
+(CONDITIONS)1897 5525 y(30)p eop
%%Trailer
-
+end
userdict /end-hook known{end-hook}if
%%EOF
diff --git a/PSELCinf-c.cm b/PSELCinf-c.cm
deleted file mode 100644
index fe77b5f..0000000
--- a/PSELCinf-c.cm
+++ /dev/null
@@ -1,406 +0,0 @@
-INFERNAL-1 [1.0]
-NAME prok-selcysteine-tRNA
-STATES 295
-NODES 73
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 8
-EFFNSEQ 8.000
-CLEN 92
-BCOM cmbuild --rf --enone PSELCinf-nc.cm prok-selc.sto
-BDATE Sun Feb 8 16:47:12 2009
-CCOM cmcalibrate --exp-hfile cmcalibrate_files/PSELCinf.hfile --exp-sfile cmcalibrate_files/PSELCinf.sfile --exp-qqfile cmcalibrate_files/PSELCinf.qqfile --exp-ffile cmcalibrate_files/PSELCinf.ffile --fil-dfile cmcalibrate_files/PSELCinf.dfile -s 208 PSELCinf-c.cm
-CDATE Sun Feb 8 20:35:21 2009
-NULL 0.000 0.000 0.000 0.000
-PART 1 0 100
-E-LC 0 0.83067 -5.33369 2.13858 1500000 558251 0.002015
-E-GC 0 0.37779 -32.13896 -19.42138 1500000 45775 0.008192
-E-LI 0 0.69607 -6.28673 2.49866 1500000 509317 0.002209
-E-GI 0 0.41203 -25.24054 -13.68825 1500000 43773 0.008567
-E-LV 0 0.91490 -0.71814 4.25595 15000000 106548 0.010559
-E-GV 0 0.35889 -26.83591 -11.09940 15000000 106358 0.003526
-E-LF 0 0.99295 1.07082 5.65406 15000000 106560 0.010557
-E-GF 0 0.38395 -20.69631 -5.98375 15000000 106494 0.003521
-FT-LC 20 0.99500 10000 1500000 0
- 7.08987 5.68736 4.14569 3.2086 3.13248 2.97336 2.478 2.42514 2.11587 2.11384 1.45721 1.45721 1.45721 1.45721 1.44241 1.44241 1.44241 1.43435 3.19316e-07 1.80078e-07
- 4799.95 4078.63 3175.73 2755.35 2393 1923.41 1662.19 1478.41 1295.51 1125.14 951.323 537.489 465.878 366.365 307.622 222.112 148.715 111.668 11.7174 11.1668
-FT-LI 19 0.99500 10000 1500000 0
- 22.8434 19.6436 13.2041 12.6502 10.4378 8.76801 8.56663 8.20153 7.69122 7.50921 5.49652 5.49652 5.49652 5.49652 5.4496 5.4496 5.4496 5.41432 2.00107e-06
- 4799.95 4078.63 3175.73 2755.35 2393 1923.41 1662.19 1478.41 1295.51 1125.14 951.323 537.489 465.878 366.365 307.622 222.112 151.999 111.668 11.1668
-FT-GC 2 0.99500 10000 1500000 1
- 0.000557072 0.000148877
- 88.2441 8.82441
-FT-GI 2 0.99500 10000 1500000 1
- 0.000165821 0.000132357
- 88.2441 8.82441
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 6 -9.837 -9.776 -0.203 -8.553 -3.001 -9.227
- IL 1 1 2 1 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 2 2 3 2 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 1 ]
- MP 3 2 3 7 6 -9.648 -9.587 -0.100 -8.364 -4.067 -9.038 -5.993 -4.008 -6.722 -0.176 -6.518 -4.764 -1.083 -6.026 -5.097 3.659 -4.707 -1.561 -1.136 -4.630 -0.115 -4.946
- ML 4 2 3 7 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 5 2 3 7 6 -8.732 -7.461 -0.325 -7.439 -2.573 -5.653 -1.176 1.514 -2.003 -1.146
- D 6 2 3 7 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 7 7 5 7 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 8 8 6 8 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 2 ]
- MP 9 8 6 13 6 -9.763 -9.702 -0.013 -8.478 -8.758 -9.153 -8.148 -4.230 -8.694 -0.961 -8.193 -4.552 -2.256 -7.376 -5.375 3.859 -4.870 -1.907 -2.177 -4.616 -4.083 -6.226
- ML 10 8 6 13 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 11 8 6 13 6 -7.959 -6.688 -0.610 -6.666 -1.800 -4.879 -0.169 -0.887 -0.964 1.041
- D 12 8 6 13 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 13 13 5 13 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 14 14 6 14 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 3 ]
- MP 15 14 6 19 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -4.208 -3.290 -4.919 3.427 -5.303 -4.962 -0.984 -4.045 -4.572 1.662 -4.997 -1.433 -0.953 -4.655 -2.496 -3.546
- ML 16 14 6 19 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 17 14 6 19 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 18 14 6 19 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 19 19 5 19 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 20 20 6 20 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 4 ]
- MP 21 20 6 25 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -4.114 -3.170 -4.915 2.993 -5.404 -4.882 -0.506 -4.201 -4.364 1.922 -4.379 1.040 -0.507 -4.416 -2.076 -3.456
- ML 22 20 6 25 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 23 20 6 25 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 24 20 6 25 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 25 25 5 25 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 26 26 6 26 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 5 ]
- MP 27 26 6 31 6 -9.837 -9.776 -0.103 -8.553 -8.832 -4.017 -6.268 -4.085 -7.039 -0.433 -6.932 -4.709 -1.718 -6.355 -5.165 3.727 -4.762 -1.729 -1.637 -4.627 -3.361 -0.408
- ML 28 26 6 31 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 29 26 6 31 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 30 26 6 31 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 31 31 5 31 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 32 32 6 32 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 6 ]
- MP 33 32 6 37 6 -9.747 -9.687 -0.014 -8.463 -8.743 -9.138 -4.193 -3.189 -5.088 2.308 -5.528 -4.939 0.892 -4.570 -4.312 2.754 -4.025 -0.729 -0.034 -4.331 -1.629 -3.480
- ML 34 32 6 37 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 35 32 6 37 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 36 32 6 37 6 -10.475 -9.173 -0.600 -5.652 -5.670 -1.745
- IL 37 37 5 37 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 38 38 6 38 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 7 ]
- MP 39 38 6 43 6 -9.837 -9.776 -0.203 -2.995 -8.832 -9.227 -3.342 -3.462 -3.984 0.204 -3.207 -4.487 -0.363 -4.007 1.240 2.538 -4.000 -1.439 2.156 -3.615 -1.538 -3.055
- ML 40 38 6 43 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 41 38 6 43 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 42 38 6 43 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 43 43 5 43 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 44 44 6 44 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 8 ]
- MP 45 44 6 49 4 -8.079 -8.286 -0.024 -6.701 -3.629 -4.174 -3.852 -0.204 -2.817 -4.529 2.826 0.753 -4.135 -0.305 -4.188 -1.838 2.013 -3.909 -0.887 -3.063
- ML 46 44 6 49 4 -5.350 -5.533 -0.149 -4.262 -1.250 -2.301 1.615 -1.672
- MR 47 44 6 49 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 48 44 6 49 4 -4.568 -4.250 -2.265 -0.520
- IL 49 49 5 49 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 50 50 6 50 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 9 ]
- ML 51 50 6 53 3 -9.343 -0.008 -7.997 1.224 -2.297 0.216 -1.742
- D 52 50 6 53 3 -6.174 -1.687 -0.566
- IL 53 53 3 53 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 10 ]
- ML 54 53 3 56 2 -9.904 -0.002 -3.221 -3.065 -3.956 1.891
- D 55 53 3 56 2 -8.445 -0.004
- IL 56 56 3 56 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ BIF 11 ]
- B 57 56 3 58 173
- [ BEGL 12 ]
- S 58 57 1 59 1 0.000
- [ BIF 13 ]
- B 59 58 1 60 110
- [ BEGL 14 ]
- S 60 59 1 61 4 -0.024 -7.737 -7.144 -7.784
- [ MATP 15 ]
- MP 61 60 1 65 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -6.448 -6.388 -4.535 -1.927 -4.254 -5.159 3.815 -5.190 -7.971 -1.890 -4.532 -3.550 -0.469 -7.090 -1.599 -5.287
- ML 62 60 1 65 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 63 60 1 65 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 64 60 1 65 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 65 65 5 65 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 66 66 6 66 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 16 ]
- MP 67 66 6 71 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -4.453 -3.293 -5.378 1.644 -6.067 -4.804 -0.455 -4.862 -4.410 3.117 -4.078 1.008 -0.453 -4.325 -2.059 -3.753
- ML 68 66 6 71 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 69 66 6 71 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 70 66 6 71 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 71 71 5 71 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 72 72 6 72 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 17 ]
- MP 73 72 6 77 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -6.793 -5.809 -7.039 -2.012 -6.268 -8.657 -2.144 -6.229 -6.397 -2.222 -6.473 1.841 -1.833 -6.715 3.502 -5.483
- ML 74 72 6 77 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 75 72 6 77 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 76 72 6 77 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 77 77 5 77 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 78 78 6 78 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 18 ]
- MP 79 78 6 83 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -6.650 -6.159 -5.257 -1.010 -4.633 -5.927 3.498 -5.587 -7.521 1.362 -5.260 -2.637 -0.115 -7.102 -1.496 -5.104
- ML 80 78 6 83 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 81 78 6 83 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 82 78 6 83 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 83 83 5 83 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 84 84 6 84 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 19 ]
- MP 85 84 6 89 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -4.768 -4.861 -4.928 1.536 -3.498 -5.576 2.479 -4.862 -5.246 0.084 -5.220 -1.665 2.380 -4.845 -0.945 -3.534
- ML 86 84 6 89 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 87 84 6 89 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 88 84 6 89 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 89 89 5 89 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 90 90 6 90 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 20 ]
- MP 91 90 6 95 4 -8.394 -8.601 -0.019 -7.015 -6.448 -6.388 -4.535 -1.927 -4.254 -5.159 3.815 -5.190 -7.971 -1.890 -4.532 -3.550 -0.469 -7.090 -1.599 -5.287
- ML 92 90 6 95 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 93 90 6 95 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 94 90 6 95 4 -4.568 -4.250 -2.265 -0.520
- IL 95 95 5 95 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 96 96 6 96 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 21 ]
- ML 97 96 6 99 3 -9.343 -0.008 -7.997 -2.133 1.571 -3.010 -0.565
- D 98 96 6 99 3 -6.174 -1.687 -0.566
- IL 99 99 3 99 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 22 ]
- ML 100 99 3 102 3 -9.343 -0.008 -7.997 -2.576 -4.009 1.875 -3.290
- D 101 99 3 102 3 -6.174 -1.687 -0.566
- IL 102 102 3 102 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 23 ]
- ML 103 102 3 105 3 -9.343 -0.008 -7.997 -2.576 -4.009 1.875 -3.290
- D 104 102 3 105 3 -6.174 -1.687 -0.566
- IL 105 105 3 105 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 24 ]
- ML 106 105 3 108 2 * 0.000 -3.221 -3.065 -3.956 1.891
- D 107 105 3 108 2 * 0.000
- IL 108 108 3 108 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 25 ]
- E 109 108 3 -1 0
- [ BEGR 26 ]
- S 110 59 1 111 3 -9.343 -0.539 -1.688
- IL 111 111 2 111 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 27 ]
- ML 112 111 2 114 5 -7.860 -1.684 -7.675 -1.953 -1.247 -2.830 1.854 -3.714 -2.565
- D 113 111 2 114 5 -7.324 -0.125 -6.585 -4.960 -4.872
- IL 114 114 3 114 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 28 ]
- MP 115 114 3 119 6 -9.269 -9.208 -0.019 -7.985 -8.265 -8.660 -6.091 -4.562 -6.091 -0.710 -5.655 -7.603 -1.043 -5.061 -5.359 -0.806 -5.259 3.729 -0.768 -5.693 -2.057 -4.410
- ML 116 114 3 119 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 117 114 3 119 6 -8.732 -7.461 -0.325 -7.439 -2.573 -5.653 -1.039 -1.496 -1.821 1.524
- D 118 114 3 119 6 -11.790 -10.488 -0.212 -6.967 -6.985 -3.060
- IL 119 119 5 119 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 120 120 6 120 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 29 ]
- MP 121 120 6 125 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -6.448 -6.388 -4.535 -1.927 -4.254 -5.159 3.815 -5.190 -7.971 -1.890 -4.532 -3.550 -0.469 -7.090 -1.599 -5.287
- ML 122 120 6 125 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 123 120 6 125 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 124 120 6 125 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 125 125 5 125 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 126 126 6 126 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 30 ]
- MP 127 126 6 131 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -4.686 -4.844 -4.921 1.370 -3.485 -5.595 2.059 -4.858 -5.163 0.044 -5.240 -1.685 2.801 -4.803 -0.967 -3.528
- ML 128 126 6 131 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 129 126 6 131 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 130 126 6 131 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 131 131 5 131 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 132 132 6 132 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 31 ]
- MP 133 132 6 137 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -8.337 -4.279 -8.862 -1.034 -8.309 -4.586 -2.345 -7.492 -5.425 3.866 -4.916 -1.961 -2.261 -4.656 -4.188 -6.333
- ML 134 132 6 137 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 135 132 6 137 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 136 132 6 137 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 137 137 5 137 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 138 138 6 138 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 32 ]
- MP 139 138 6 143 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -8.337 -4.279 -8.862 -1.034 -8.309 -4.586 -2.345 -7.492 -5.425 3.866 -4.916 -1.961 -2.261 -4.656 -4.188 -6.333
- ML 140 138 6 143 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 141 138 6 143 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 142 138 6 143 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 143 143 5 143 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 144 144 6 144 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 33 ]
- MP 145 144 6 149 4 -8.394 -8.601 -0.019 -7.015 -5.018 -4.289 -5.616 3.470 -5.244 -6.010 -1.008 -4.851 -5.312 -0.630 -5.807 -2.122 1.620 -5.433 -2.489 -4.259
- ML 146 144 6 149 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 147 144 6 149 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 148 144 6 149 4 -4.568 -4.250 -2.265 -0.520
- IL 149 149 5 149 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 150 150 6 150 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 34 ]
- ML 151 150 6 153 3 -9.343 -0.008 -7.997 -2.420 1.672 -3.322 -0.925
- D 152 150 6 153 3 -6.174 -1.687 -0.566
- IL 153 153 3 153 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 35 ]
- ML 154 153 3 156 3 -9.343 -0.008 -7.997 -3.221 -3.065 -3.956 1.891
- D 155 153 3 156 3 -6.174 -1.687 -0.566
- IL 156 156 3 156 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 36 ]
- ML 157 156 3 159 3 -9.343 -0.008 -7.997 -3.221 -3.065 -3.956 1.891
- D 158 156 3 159 3 -6.174 -1.687 -0.566
- IL 159 159 3 159 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 37 ]
- ML 160 159 3 162 3 -9.343 -0.008 -7.997 -3.417 1.902 -4.334 -3.061
- D 161 159 3 162 3 -6.174 -1.687 -0.566
- IL 162 162 3 162 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 38 ]
- ML 163 162 3 165 3 -9.343 -0.008 -7.997 1.931 -4.287 -4.033 -3.748
- D 164 162 3 165 3 -6.174 -1.687 -0.566
- IL 165 165 3 165 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 39 ]
- ML 166 165 3 168 3 -9.343 -0.008 -7.997 1.931 -4.287 -4.033 -3.748
- D 167 165 3 168 3 -6.174 -1.687 -0.566
- IL 168 168 3 168 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 40 ]
- ML 169 168 3 171 2 * 0.000 1.931 -4.287 -4.033 -3.748
- D 170 168 3 171 2 * 0.000
- IL 171 171 3 171 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 41 ]
- E 172 171 3 -1 0
- [ BEGR 42 ]
- S 173 57 1 174 2 -1.570 -0.592
- IL 174 174 2 174 2 -1.796 -0.490 0.000 0.000 0.000 0.000
- [ BIF 43 ]
- B 175 174 2 176 238
- [ BEGL 44 ]
- S 176 175 1 177 4 -0.428 -2.028 -7.144 -7.784
- [ MATP 45 ]
- MP 177 176 1 181 6 -9.506 -9.445 -0.016 -8.221 -8.501 -8.896 -3.378 -3.853 -3.949 -1.085 -3.040 -4.739 -0.947 -3.991 -3.724 -1.326 2.242 -1.938 -0.186 -3.687 3.004 -3.147
- ML 178 176 1 181 6 -8.715 -9.061 -0.165 -3.470 -8.911 -6.440 -0.601 -1.220 0.224 0.802
- MR 179 176 1 181 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 180 176 1 181 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 181 181 5 181 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 182 182 6 182 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 46 ]
- MP 183 182 6 187 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -5.006 -4.027 -5.698 0.474 -5.411 -5.718 1.714 -5.166 -5.098 2.620 -4.831 1.848 -0.103 -5.083 -1.654 -4.100
- ML 184 182 6 187 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 185 182 6 187 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 186 182 6 187 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 187 187 5 187 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 188 188 6 188 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 47 ]
- MP 189 188 6 193 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -4.129 -3.118 -5.049 2.401 -5.767 -4.881 -0.248 -4.521 -4.243 2.714 -3.965 0.707 -0.244 -4.272 -1.831 -3.461
- ML 190 188 6 193 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 191 188 6 193 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 192 188 6 193 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 193 193 5 193 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 194 194 6 194 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 48 ]
- MP 195 194 6 199 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -4.459 -3.437 -5.332 1.870 -5.553 -5.158 1.466 -4.823 -4.559 2.866 -4.248 -0.902 -0.041 -4.558 -1.641 -3.691
- ML 196 194 6 199 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 197 194 6 199 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 198 194 6 199 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 199 199 5 199 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 200 200 6 200 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 49 ]
- MP 201 200 6 205 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -4.047 -3.129 -4.573 0.668 -4.627 -0.223 -0.692 -4.289 -3.960 3.175 -3.781 1.273 -0.630 -3.664 -2.133 -3.546
- ML 202 200 6 205 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 203 200 6 205 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 204 200 6 205 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 205 205 5 205 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 206 206 6 206 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 50 ]
- MP 207 206 6 211 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -3.385 -3.309 -3.584 1.433 -3.005 -3.924 2.424 0.476 -3.626 0.394 -3.728 1.200 0.673 -3.304 -1.080 -2.864
- ML 208 206 6 211 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 209 206 6 211 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 210 206 6 211 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 211 211 5 211 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 212 212 6 212 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 51 ]
- MP 213 212 6 217 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -5.355 -5.860 -4.133 -1.809 -3.729 -4.753 3.568 -4.795 -6.453 -1.787 -0.323 -3.587 -0.163 -5.916 0.563 -4.677
- ML 214 212 6 217 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 215 212 6 217 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 216 212 6 217 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 217 217 5 217 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 218 218 6 218 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 52 ]
- MP 219 218 6 223 4 -8.394 -8.601 -0.019 -7.015 -5.969 -5.343 -6.148 -0.121 -4.780 -6.742 2.509 -5.715 -6.345 2.277 -6.103 -1.840 0.373 -6.196 1.467 -4.534
- ML 220 218 6 223 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 221 218 6 223 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 222 218 6 223 4 -4.568 -4.250 -2.265 -0.520
- IL 223 223 5 223 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 224 224 6 224 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 53 ]
- ML 225 224 6 227 3 -9.343 -0.125 -3.614 0.068 0.720 -0.274 -1.066
- D 226 224 6 227 3 -6.174 -1.687 -0.566
- IL 227 227 3 227 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 54 ]
- ML 228 227 3 230 3 -9.226 -0.009 -7.880 1.361 -0.244 -2.138 -1.472
- D 229 227 3 230 3 -7.695 -0.396 -2.087
- IL 230 230 3 230 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 55 ]
- ML 231 230 3 233 3 -9.343 -0.314 -2.364 0.230 -0.194 0.317 -0.499
- D 232 230 3 233 3 -6.174 -1.687 -0.566
- IL 233 233 3 233 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 56 ]
- ML 234 233 3 236 2 * 0.000 0.201 -0.454 0.707 -1.034
- D 235 233 3 236 2 * 0.000
- IL 236 236 3 236 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 57 ]
- E 237 236 3 -1 0
- [ BEGR 58 ]
- S 238 175 1 239 3 -2.411 -0.695 -2.364
- IL 239 239 2 239 3 -2.530 -1.886 -0.846 0.000 0.000 0.000 0.000
- [ MATL 59 ]
- ML 240 239 2 242 5 -7.718 -0.025 -7.533 -7.746 -8.637 -2.059 -3.381 1.811 -2.687
- D 241 239 2 242 5 -7.568 -0.954 -6.829 -1.182 -5.117
- IL 242 242 3 242 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 60 ]
- MP 243 242 3 247 6 -9.652 -9.591 -0.014 -8.368 -8.648 -9.043 -6.485 -5.009 -6.736 -0.900 -6.567 -7.484 -1.404 -5.770 -5.968 2.262 -5.756 3.258 -1.318 -6.198 -2.674 -5.020
- ML 244 242 3 247 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 245 242 3 247 6 -8.711 -7.440 -0.330 -7.418 -2.552 -5.632 -1.012 -1.476 -1.795 1.514
- D 246 242 3 247 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 247 247 5 247 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 248 248 6 248 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 61 ]
- MP 249 248 6 253 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -4.858 -5.138 -5.212 -0.346 -3.831 -6.027 2.410 -5.162 -5.329 -0.370 -5.568 -1.988 3.019 -5.141 -1.244 -3.912
- ML 250 248 6 253 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 251 248 6 253 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 252 248 6 253 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 253 253 5 253 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 254 254 6 254 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 62 ]
- MP 255 254 6 259 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -4.440 -3.425 -5.282 2.894 -5.833 -5.214 -0.557 -4.619 -4.584 2.597 -4.428 -1.090 -0.557 -4.642 -2.114 -3.724
- ML 256 254 6 259 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 257 254 6 259 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 258 254 6 259 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 259 259 5 259 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 260 260 6 260 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 63 ]
- MP 261 260 6 265 6 -9.837 -9.776 -0.013 -8.553 -8.832 -9.227 -8.337 -4.279 -8.862 -1.034 -8.309 -4.586 -2.345 -7.492 -5.425 3.866 -4.916 -1.961 -2.261 -4.656 -4.188 -6.333
- ML 262 260 6 265 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 263 260 6 265 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 264 260 6 265 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 265 265 5 265 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 266 266 6 266 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 64 ]
- MP 267 266 6 271 4 -8.394 -8.601 -0.019 -7.015 -8.337 -4.279 -8.862 -1.034 -8.309 -4.586 -2.345 -7.492 -5.425 3.866 -4.916 -1.961 -2.261 -4.656 -4.188 -6.333
- ML 268 266 6 271 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 269 266 6 271 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 270 266 6 271 4 -4.568 -4.250 -2.265 -0.520
- IL 271 271 5 271 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 272 272 6 272 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 65 ]
- ML 273 272 6 275 3 -9.343 -0.008 -7.997 -3.221 -3.065 -3.956 1.891
- D 274 272 6 275 3 -6.174 -1.687 -0.566
- IL 275 275 3 275 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 66 ]
- ML 276 275 3 278 3 -9.343 -0.008 -7.997 -3.221 -3.065 -3.956 1.891
- D 277 275 3 278 3 -6.174 -1.687 -0.566
- IL 278 278 3 278 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 67 ]
- ML 279 278 3 281 3 -9.343 -0.008 -7.997 -3.417 1.902 -4.334 -3.061
- D 280 278 3 281 3 -6.174 -1.687 -0.566
- IL 281 281 3 281 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 68 ]
- ML 282 281 3 284 3 -9.343 -0.008 -7.997 -0.885 -3.485 1.688 -2.763
- D 283 281 3 284 3 -6.174 -1.687 -0.566
- IL 284 284 3 284 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 69 ]
- ML 285 284 3 287 3 -9.343 -0.008 -7.997 1.931 -4.287 -4.033 -3.748
- D 286 284 3 287 3 -6.174 -1.687 -0.566
- IL 287 287 3 287 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 70 ]
- ML 288 287 3 290 3 -9.343 -0.008 -7.997 -2.133 1.571 -3.010 -0.565
- D 289 287 3 290 3 -6.174 -1.687 -0.566
- IL 290 290 3 290 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 71 ]
- ML 291 290 3 293 2 * 0.000 -3.221 -3.065 -3.956 1.891
- D 292 290 3 293 2 * 0.000
- IL 293 293 3 293 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 72 ]
- E 294 293 3 -1 0
-//
diff --git a/README b/README
index 866d28b..c277ef7 100644
--- a/README
+++ b/README
@@ -1,14 +1,15 @@
-------------------------------------------------------------
tRNAscan-SE: An improved tool for transfer RNA detection
-Patricia Chan and Todd Lowe
+Todd Lowe (1) & Sean Eddy (2)
-School of Engineering, University of California, Santa Cruz, CA
+(1) School of Engineering, University of California, Santa Cruz, CA
+(2) Dept. of Genetics, Washington U. School of Medicine, St. Louis, MO
--------------------------------------------------------------
-Current release: 1.3.1 (January 2012)
+Current release: 1.23 (Apr 2002)
tRNAscan-SE was written in the PERL (version 5.0) script language.
-Input consists of DNA or RNA sequences in FASTA format. tRNA
+Input consists of DNA or RNA sequences in FASTA format. tRNA
predictions are output in standard tabular or ACeDB format.
tRNAscan-SE does no tRNA detection itself, but instead combines the
strengths of three independent tRNA prediction programs by negotiating
@@ -16,15 +17,15 @@ the flow of information between them, performing a limited amount of
post-processing, and outputting the results in one of several
formats.
-tRNAscan-SE combines the specificity of the Cove/Infernal probabilistic
-RNA prediction package (1-2) with the speed and sensitivity of tRNAscan 1.3
-(3) plus an implementation of an algorithm described by Pavesi and
-colleagues (4), which searches for eukaryotic pol III tRNA promoters
-(our implementation referred to as EufindtRNA). tRNAscan and
+tRNAscan-SE combines the specificity of the Cove probabilistic RNA
+prediction package (1) with the speed and sensitivity of tRNAscan 1.3
+(2) plus an implementation of an algorithm described by Pavesi and
+colleagues (3), which searches for eukaryotic pol III tRNA promoters
+(our implementation referred to as EufindtRNA). tRNAscan and
EufindtRNA are used as first-pass prefilters to identify "candidate"
-tRNA regions of the sequence. These subsequences are then passed to
+tRNA regions of the sequence. These subsequences are then passed to
Cove for further analysis, and output if Cove confirms the initial
-tRNA prediction. In this way, tRNAscan-SE attains the best of both
+tRNA prediction. In this way, tRNAscan-SE attains the best of both
worlds: (1) a false positive rate equally low to using Cove analysis,
(2) the combined sensitivities of tRNAscan and EufindtRNA (detection
of 98-99% of true tRNAs), and (3) search speed 1,000 to 3,000 times
@@ -42,13 +43,7 @@ eufindtRNA are included for use with the tRNAscan-SE program, but may
also be run as stand-alone programs). Installation of the PERL
(Practical Extraction and Report Language, Larry Wall) interpreter
package version 5.0 or later is required to run the tRNAscan-SE PERL
-script. An newer implementation of covariance model searches, Infernal, may
-be used in place of Cove which allows for faster searches and new, specialized
-search options. To use Infernal as the second-pass scanner or to include
-prediction of noncanonical introns and split fragments in archaeal tRNA
-genes, Infernal 1.0 must be pre-installed. Previous versions of Infernal
-will not work with the covariance models provided with tRNAscan-SE.
-The Infernal source package can be downloaded at http://infernal.janelia.org/.
+script.
For more detailed information, please read the following files:
@@ -63,19 +58,19 @@ For more detailed information, please read the following files:
You can obtain a copy of this software from
-http://lowelab.ucsc.edu/software/tRNAscan-SE.tar.gz
+http://lowelab.ucsc.edu/software/tRNAscan-SE.tar.Z
or
-ftp://selab.janelia.org/pub/software/tRNAscan-SE.tar.Z
+ftp://ftp.genetics.wustl.edu/pub/eddy/software/tRNAscan-SE.tar.Z
If you use this software, please cite the Nucleic Acids Research paper
describing the program & its analysis of several genomes (4).
-If you have any questions, bug reports, or suggestions, please e-mail
+If you have any questions, complaints, or suggestions, please e-mail me
Todd Lowe
lowe at soe.ucsc.edu
- Department of Biomolecular Engineering
+ 227 Sinsheimer Labs
University of California
1156 High Street
Santa Cruz, ZA 95064
@@ -86,17 +81,17 @@ References
1. Eddy, S.R. and Durbin, R. (1994) "RNA sequence analysis using
covariance models", Nucl. Acids Res., 22, 2079-2088.
-2. Nawrocki, E.P., Kolbe, D.L. & Eddy, S.R. (2010) "Infernal 1.0:
- Inference of RNA Alignments", Bioinformatics, 25, 1335-1337.
-
-3. Fichant, G.A. and Burks, C. (1991) "Identifying potential tRNA
+2. Fichant, G.A. and Burks, C. (1991) "Identifying potential tRNA
genes in genomic DNA sequences", J. Mol. Biol., 220, 659-671.
-4. Pavesi, A., Conterio, F., Bolchi, A., Dieci, G., Ottonello,
+3. Pavesi, A., Conterio, F., Bolchi, A., Dieci, G., Ottonello,
S. (1994) "Identification of new eukaryotic tRNA genes in genomic DNA
databases by a multistep weight matrix analysis of transcriptional
control regions", Nucl. Acids Res., 22, 1247-1256.
-5. Lowe, T.M. & Eddy, S.R. (1997) "tRNAscan-SE: A program
+4. Lowe, T.M. & Eddy, S.R. (1997) "tRNAscan-SE: A program
for improved detection of transfer RNA genes in genomic
sequence", Nucl. Acids Res., 25, 955-964.
+
+
+
diff --git a/Release.history b/Release.history
index 9131825..d98ad5d 100644
--- a/Release.history
+++ b/Release.history
@@ -360,46 +360,4 @@ sequences. Even though not IUPAC, the program now replaces
X's with N's so it doesn't throw errors.
-Version 1.3 (March 2011)
-------------
--Removed option "P" (prokaryotic scan mode) which was already depricated;
-Use -B (bacterial) or -A (archaeal) scan modes instead
-
--Added long option names for all supported options
-
--Added "--newscan" option for using Infernal 1.0 instead of
-COVE as second-pass scanner
-
--Added "-i" or "--infernal" option for using Infernal 1.0 only search mode
-
--Added "--ncintron" option to search for noncanonical introns. This option
-is only available for Archaeal scan mode.
-
--Added "--frag <file>" option to search for tRNA gene fragments that may
-form split tRNAs. Results are saved as tab-delimited output file
-specified with option. This option is only available for Archaeal scan mode.
-
--Added output support of multiple introns in an archaeal tRNA gene. Start and
-end positions of the introns are delimited by comma in the corresponding fields
-in the output file. Start and end positions of all the introns are also listed
-in the tRNA secondary structure output file.
-
--Added "PRE" output line in tRNA secondary structure output file for those
-archaeal tRNA genes that are predicted to have noncanonical introns. Regions
-enclosed in [] are predicted intron sequences.
-
--Added an extra column at the end of output file for Archaeal scan mode to
-display the number of predicted canonical (CI) and noncanonical (NCI) introns
-for each predicted tRNA gene.
-
--Methods in this version of tRNAscan-SE have been rearranged into multiple
-Perl modules under package tRNAscanSE. The file path has to be added in
-PERL5LIB environment variable for execution. Corresponding changes in the
-Makefile have been included.
-
-Version 1.3.1 (January 2012)
-------------
--Change getline() to GetLine() in sqio.c to eliminate error when compiling
-with gcc v4.2 or above
--Fix most of the warnings when compiling in 64-bit environment
diff --git a/TRNAinf-arch-3h-nc.cm b/TRNAinf-arch-3h-nc.cm
deleted file mode 100644
index 17d29b2..0000000
--- a/TRNAinf-arch-3h-nc.cm
+++ /dev/null
@@ -1,242 +0,0 @@
-INFERNAL-1 [1.0.2]
-NAME tRNA1415G-arch-3h
-STATES 177
-NODES 50
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 62
-EFFNSEQ 62.000
-CLEN 56
-BCOM cmbuild -F --rf --enone TRNAinf-arch-3h-nc.cm trna1415G-arch-3h.sto
-BDATE Thu Mar 24 01:55:40 2011
-NULL 0.000 0.000 0.000 0.000
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 4 -11.123 -11.330 -0.003 -9.744
- IL 1 1 2 1 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 2 2 3 2 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 1 ]
- ML 3 2 3 5 3 -12.038 -0.001 -10.692 1.733 -1.353 -2.605 -3.067
- D 4 2 3 5 3 -6.174 -1.687 -0.566
- IL 5 5 3 5 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 2 ]
- ML 6 5 3 8 3 -12.038 -0.001 -10.692 -2.347 0.289 0.562 0.144
- D 7 5 3 8 3 -6.174 -1.687 -0.566
- IL 8 8 3 8 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 3 ]
- ML 9 8 3 11 3 -12.038 -0.001 -10.692 -4.964 1.656 -0.548 -2.921
- D 10 8 3 11 3 -6.174 -1.687 -0.566
- IL 11 11 3 11 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 4 ]
- ML 12 11 3 14 3 -12.038 -0.001 -10.692 -0.930 1.410 -1.065 -1.555
- D 13 11 3 14 3 -6.174 -1.687 -0.566
- IL 14 14 3 14 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 5 ]
- ML 15 14 3 17 3 -12.038 -0.001 -10.692 -0.276 -1.411 0.943 -0.193
- D 16 14 3 17 3 -6.174 -1.687 -0.566
- IL 17 17 3 17 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 6 ]
- ML 18 17 3 20 3 -12.038 -0.001 -10.692 -1.105 -1.526 1.453 -1.152
- D 19 17 3 20 3 -6.174 -1.687 -0.566
- IL 20 20 3 20 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 7 ]
- ML 21 20 3 23 3 -12.038 -0.301 -2.409 0.500 -0.822 -1.702 0.776
- D 22 20 3 23 3 -6.174 -1.687 -0.566
- IL 23 23 3 23 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 8 ]
- ML 24 23 3 26 3 -12.039 -1.980 -0.422 -0.855 -1.776 1.446 -1.219
- D 25 23 3 26 3 -9.851 -4.965 -0.049
- IL 26 26 3 26 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 9 ]
- MR 27 26 3 29 3 -10.064 -0.006 -8.382 1.949 -4.726 -4.423 -4.171
- D 28 26 3 29 3 -13.110 -8.288 -0.005
- IR 29 29 3 29 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 10 ]
- MR 30 29 3 32 3 -10.064 -0.006 -8.382 -3.748 1.922 -4.677 -3.364
- D 31 29 3 32 3 -13.110 -5.564 -0.031
- IR 32 32 3 32 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 11 ]
- MR 33 32 3 35 3 -10.161 -0.005 -8.479 -3.418 1.846 -4.418 -1.918
- D 34 32 3 35 3 -13.084 -0.009 -7.314
- IR 35 35 3 35 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 12 ]
- MR 36 35 3 38 3 -12.337 -0.001 -10.655 1.298 -2.392 -0.132 -1.189
- D 37 35 3 38 3 -6.390 -1.568 -0.620
- IR 38 38 3 38 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 13 ]
- MR 39 38 3 41 3 -12.337 -0.001 -10.655 -4.995 1.846 -3.353 -1.857
- D 40 38 3 41 3 -6.390 -1.568 -0.620
- IR 41 41 3 41 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 14 ]
- MR 42 41 3 44 3 -12.337 -0.001 -10.655 -1.818 0.629 1.086 -4.408
- D 43 41 3 44 3 -6.390 -1.568 -0.620
- IR 44 44 3 44 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 15 ]
- MR 45 44 3 47 3 -12.337 -0.001 -10.655 -2.285 0.091 0.884 -0.177
- D 46 44 3 47 3 -6.390 -1.568 -0.620
- IR 47 47 3 47 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 16 ]
- MR 48 47 3 50 3 -12.337 -0.001 -10.655 -1.472 0.682 0.722 -1.372
- D 49 47 3 50 3 -6.390 -1.568 -0.620
- IR 50 50 3 50 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 17 ]
- MR 51 50 3 53 3 -12.337 -0.001 -10.655 -1.320 -0.069 1.170 -1.337
- D 52 50 3 53 3 -6.390 -1.568 -0.620
- IR 53 53 3 53 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 18 ]
- MR 54 53 3 56 3 -12.337 -0.001 -10.655 -1.932 0.953 0.576 -1.685
- D 55 53 3 56 3 -6.390 -1.568 -0.620
- IR 56 56 3 56 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 19 ]
- MR 57 56 3 59 2 -12.680 -0.000 -2.173 1.662 -5.647 -0.750
- D 58 56 3 59 2 -4.432 -0.068
- IR 59 59 3 59 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ BIF 20 ]
- B 60 59 3 61 117
- [ BEGL 21 ]
- S 61 60 1 62 4 -1.996 -10.099 -9.506 -0.421
- [ MATP 22 ]
- MP 62 61 1 66 6 -10.171 -10.110 -0.010 -8.886 -9.166 -9.561 -5.649 -4.417 -6.425 0.020 -6.225 -5.932 1.824 -5.803 -5.561 3.127 -5.225 0.697 -0.657 -5.465 -2.206 -4.680
- ML 63 61 1 66 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 64 61 1 66 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 65 61 1 66 6 -15.585 -14.283 -10.080 -10.762 -10.779 -0.003
- IL 66 66 5 66 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 67 67 6 67 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 23 ]
- MP 68 67 6 72 6 -10.171 -10.110 -0.010 -8.886 -9.166 -9.561 -5.621 -4.588 -6.330 1.280 -5.771 -6.400 2.432 -5.734 -5.766 2.704 -5.441 -1.709 -0.246 -5.783 -1.811 -4.560
- ML 69 67 6 72 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 70 67 6 72 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 71 67 6 72 6 -15.585 -14.283 -10.080 -10.762 -10.779 -0.003
- IL 72 72 5 72 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 73 73 6 73 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 24 ]
- MP 74 73 6 78 6 -10.171 -10.110 -0.900 -8.886 -9.166 -1.125 -6.129 -6.250 -4.854 0.389 -4.229 -5.478 3.449 -5.370 -7.275 -1.127 -4.944 -2.977 0.979 -6.582 -0.046 -4.894
- ML 75 73 6 78 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 76 73 6 78 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 77 73 6 78 6 -15.585 -14.283 -10.080 -10.762 -10.779 -0.003
- IL 78 78 5 78 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 79 79 6 79 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 25 ]
- MP 80 79 6 84 6 -9.289 -9.228 -0.019 -8.005 -8.284 -8.679 -4.214 -4.442 -4.294 0.299 -3.107 -4.987 2.767 -4.373 -4.726 0.306 -4.554 -1.405 2.351 -4.451 -0.576 -3.249
- ML 81 79 6 84 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 82 79 6 84 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 83 79 6 84 6 -15.816 -14.515 -10.312 -10.994 -11.011 -0.003
- IL 84 84 5 84 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 85 85 6 85 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 26 ]
- MP 86 85 6 90 6 -9.289 -9.228 -0.546 -8.005 -8.284 -1.713 -5.691 -5.607 -4.274 -0.974 -3.824 -4.920 3.681 -4.789 -6.659 -0.927 -4.290 -2.571 0.204 -6.169 -1.090 -4.545
- ML 87 85 6 90 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 88 85 6 90 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 89 85 6 90 6 -15.816 -14.515 -10.312 -10.994 -11.011 -0.003
- IL 90 90 5 90 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 91 91 6 91 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 27 ]
- MP 92 91 6 96 6 -8.769 -8.708 -0.027 -7.485 -7.765 -8.160 -3.305 -2.766 -3.576 1.411 -2.869 -4.048 1.948 -3.248 -3.354 2.027 -3.320 -0.140 1.330 -3.299 -0.204 -2.459
- ML 93 91 6 96 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 94 91 6 96 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 95 91 6 96 6 -15.891 -14.590 -10.387 -11.069 -11.086 -0.002
- IL 96 96 5 96 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 97 97 6 97 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 28 ]
- MP 98 97 6 102 4 -5.802 -6.009 -0.120 -4.423 -3.305 -2.766 -3.576 1.411 -2.869 -4.048 1.948 -3.248 -3.354 2.027 -3.320 -0.140 1.330 -3.299 -0.204 -2.459
- ML 99 97 6 102 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 100 97 6 102 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 101 97 6 102 4 -11.314 -3.715 -3.087 -0.312
- IL 102 102 5 102 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 103 103 6 103 3 -3.405 -0.166 -6.105 0.000 0.000 0.000 0.000
- [ MATL 29 ]
- ML 104 103 6 106 3 -9.832 -0.006 -8.487 -2.477 -3.877 1.746 -1.329
- D 105 103 6 106 3 -13.116 -8.629 -0.004
- IL 106 106 3 106 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 30 ]
- ML 107 106 3 109 3 -9.832 -0.006 -8.487 -3.083 -1.352 -3.863 1.775
- D 108 106 3 109 3 -13.116 -8.629 -0.004
- IL 109 109 3 109 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 31 ]
- ML 110 109 3 112 3 -9.832 -0.190 -3.034 1.163 -0.793 -2.299 -0.028
- D 111 109 3 112 3 -13.116 -8.629 -0.004
- IL 112 112 3 112 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 32 ]
- ML 113 112 3 115 2 * 0.000 0.101 -0.716 0.992 -1.599
- D 114 112 3 115 2 * 0.000
- IL 115 115 3 115 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 33 ]
- E 116 115 3 -1 0
- [ BEGR 34 ]
- S 117 60 1 118 3 -12.038 -0.040 -5.210
- IL 118 118 2 118 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 35 ]
- ML 119 118 2 121 3 -0.533 -1.698 -10.653 0.645 -2.848 0.755 -0.714
- D 120 118 2 121 3 -0.309 -4.041 -2.920
- IL 121 121 3 121 3 -4.728 -0.058 -9.003 0.000 0.000 0.000 0.000
- [ MATL 36 ]
- ML 122 121 3 124 5 -10.983 -0.003 -10.799 -11.011 -11.902 -6.177 1.986 -6.986 -5.896
- D 123 121 3 124 5 -4.959 -0.803 -4.221 -2.596 -2.508
- IL 124 124 3 124 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 37 ]
- MP 125 124 3 129 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -8.144 -7.028 -8.755 0.269 -7.720 -8.935 2.569 -8.033 -8.364 2.622 -7.984 0.004 -0.514 -8.397 -0.060 -6.794
- ML 126 124 3 129 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 127 124 3 129 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 128 124 3 129 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 129 129 5 129 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 130 130 6 130 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 38 ]
- MP 131 130 6 135 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -8.111 -7.809 -8.067 0.611 -6.468 -8.756 3.158 -7.793 -8.648 1.258 -8.359 -0.729 1.162 -8.204 -1.926 -6.451
- ML 132 130 6 135 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 133 130 6 135 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 134 130 6 135 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 135 135 5 135 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 136 136 6 136 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 39 ]
- MP 137 136 6 141 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -7.678 -6.283 -8.440 0.411 -7.868 -7.575 1.114 -7.776 -7.500 3.502 -7.111 -3.486 -0.775 -7.280 -1.185 -6.568
- ML 138 136 6 141 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 139 136 6 141 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 140 136 6 141 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 141 141 5 141 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 142 142 6 142 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 40 ]
- MP 143 142 6 147 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -10.070 -5.376 -10.897 -0.970 -9.838 -5.571 -3.691 -9.349 -6.533 3.890 -6.002 -3.136 -1.502 -5.685 -5.851 -7.907
- ML 144 142 6 147 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 145 142 6 147 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 146 142 6 147 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 147 147 5 147 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 148 148 6 148 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 41 ]
- MP 149 148 6 153 4 -11.123 -11.330 -0.003 -9.744 -11.170 -6.905 -11.033 -3.627 -10.757 -7.380 -4.824 -9.431 -8.041 3.977 -7.551 -4.453 -4.613 -7.379 -6.287 -8.552
- ML 150 148 6 153 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 151 148 6 153 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 152 148 6 153 4 -4.568 -4.250 -2.265 -0.520
- IL 153 153 5 153 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 154 154 6 154 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 42 ]
- ML 155 154 6 157 3 -12.038 -0.001 -10.692 -5.986 -5.748 -6.637 1.984
- D 156 154 6 157 3 -6.174 -1.687 -0.566
- IL 157 157 3 157 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 43 ]
- ML 158 157 3 160 3 -12.038 -0.001 -10.692 -5.160 -3.461 -5.910 1.950
- D 159 157 3 160 3 -6.174 -1.687 -0.566
- IL 160 160 3 160 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 44 ]
- ML 161 160 3 163 3 -12.038 -0.001 -10.692 -5.515 1.965 -4.489 -5.093
- D 162 160 3 163 3 -6.174 -1.687 -0.566
- IL 163 163 3 163 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 45 ]
- ML 164 163 3 166 3 -12.038 -0.001 -10.692 1.276 -7.518 0.646 -7.132
- D 165 163 3 166 3 -6.174 -1.687 -0.566
- IL 166 166 3 166 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 46 ]
- ML 167 166 3 169 3 -12.038 -0.001 -10.692 1.985 -6.571 -6.091 -5.965
- D 168 166 3 169 3 -6.174 -1.687 -0.566
- IL 169 169 3 169 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 47 ]
- ML 170 169 3 172 3 -12.038 -0.001 -10.692 1.773 -4.394 -1.489 -2.478
- D 171 169 3 172 3 -6.174 -1.687 -0.566
- IL 172 172 3 172 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 48 ]
- ML 173 172 3 175 2 * 0.000 -5.125 -1.809 -5.879 1.875
- D 174 172 3 175 2 * 0.000
- IL 175 175 3 175 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 49 ]
- E 176 175 3 -1 0
-//
diff --git a/TRNAinf-arch-5h-nc.cm b/TRNAinf-arch-5h-nc.cm
deleted file mode 100644
index 6feb6e1..0000000
--- a/TRNAinf-arch-5h-nc.cm
+++ /dev/null
@@ -1,165 +0,0 @@
-INFERNAL-1 [1.0.2]
-NAME tRNA1415G-arch-5h
-STATES 115
-NODES 35
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 62
-EFFNSEQ 62.000
-CLEN 37
-BCOM cmbuild -F --rf --enone TRNAinf-arch-5h-nc.cm trna1415G-arch-5h.sto
-BDATE Thu Mar 24 00:53:49 2011
-NULL 0.000 0.000 0.000 0.000
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 4 -4.683 -3.095 -0.247 -9.744
- IL 1 1 2 1 4 -3.700 -4.384 -0.207 -6.869 0.000 0.000 0.000 0.000
- IR 2 2 3 2 3 -0.088 -4.096 -10.593 0.000 0.000 0.000 0.000
- [ MATL 1 ]
- ML 3 2 3 5 3 -12.038 -0.001 -10.692 -1.586 -3.140 1.814 -4.771
- D 4 2 3 5 3 -6.174 -1.687 -0.566
- IL 5 5 3 5 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 2 ]
- ML 6 5 3 8 3 -12.038 -0.001 -10.692 -3.948 1.018 0.698 -1.793
- D 7 5 3 8 3 -6.174 -1.687 -0.566
- IL 8 8 3 8 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 3 ]
- ML 9 8 3 11 3 -12.038 -0.001 -10.692 -1.229 0.886 0.598 -2.239
- D 10 8 3 11 3 -6.174 -1.687 -0.566
- IL 11 11 3 11 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 4 ]
- ML 12 11 3 14 3 -12.038 -0.001 -10.692 -1.575 0.642 0.813 -1.530
- D 13 11 3 14 3 -6.174 -1.687 -0.566
- IL 14 14 3 14 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 5 ]
- ML 15 14 3 17 3 -12.038 -0.001 -10.692 -1.287 0.987 -0.049 -0.642
- D 16 14 3 17 3 -6.174 -1.687 -0.566
- IL 17 17 3 17 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 6 ]
- ML 18 17 3 20 3 -12.038 -0.001 -10.692 -1.864 0.364 0.992 -1.153
- D 19 17 3 20 3 -6.174 -1.687 -0.566
- IL 20 20 3 20 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 7 ]
- ML 21 20 3 23 3 -12.038 -0.001 -10.692 -0.880 -5.508 1.688 -2.233
- D 22 20 3 23 3 -6.174 -1.687 -0.566
- IL 23 23 3 23 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 8 ]
- ML 24 23 3 26 3 -12.038 -0.046 -4.993 -5.135 -2.836 -5.888 1.932
- D 25 23 3 26 3 -6.174 -1.687 -0.566
- IL 26 26 3 26 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 9 ]
- ML 27 26 3 29 3 -7.402 -0.009 -10.610 0.964 -1.828 0.640 -2.262
- D 28 26 3 29 3 -7.590 -0.155 -3.373
- IL 29 29 3 29 3 -2.288 -0.412 -4.526 0.000 0.000 0.000 0.000
- [ MATR 10 ]
- MR 30 29 3 32 3 -12.337 -0.001 -10.655 1.068 -7.542 0.919 -7.099
- D 31 29 3 32 3 -6.390 -1.568 -0.620
- IR 32 32 3 32 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 11 ]
- MR 33 32 3 35 3 -12.337 -0.001 -10.655 -0.357 0.237 -0.267 0.274
- D 34 32 3 35 3 -6.390 -1.568 -0.620
- IR 35 35 3 35 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 12 ]
- MR 36 35 3 38 3 -12.337 -0.001 -10.655 0.375 -0.433 -0.156 0.091
- D 37 35 3 38 3 -6.390 -1.568 -0.620
- IR 38 38 3 38 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 13 ]
- MR 39 38 3 41 3 -12.337 -0.001 -10.655 -3.411 0.312 0.286 0.531
- D 40 38 3 41 3 -6.390 -1.568 -0.620
- IR 41 41 3 41 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 14 ]
- MR 42 41 3 44 3 -12.337 -0.001 -10.655 -5.986 -5.748 -6.637 1.984
- D 43 41 3 44 3 -6.390 -1.568 -0.620
- IR 44 44 3 44 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 15 ]
- MR 45 44 3 47 3 -12.337 -0.001 -10.655 -5.164 1.722 -6.170 -0.600
- D 46 44 3 47 3 -6.390 -1.568 -0.620
- IR 47 47 3 47 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 16 ]
- MR 48 47 3 50 3 -12.337 -0.001 -10.655 0.149 0.596 0.239 -2.327
- D 49 47 3 50 3 -6.390 -1.568 -0.620
- IR 50 50 3 50 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 17 ]
- MR 51 50 3 53 3 -12.337 -0.001 -10.655 -5.285 -0.484 1.698 -6.018
- D 52 50 3 53 3 -6.390 -1.568 -0.620
- IR 53 53 3 53 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 18 ]
- MR 54 53 3 56 3 -12.337 -0.001 -10.655 -1.923 -1.069 1.510 -1.278
- D 55 53 3 56 3 -6.390 -1.568 -0.620
- IR 56 56 3 56 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 19 ]
- MR 57 56 3 59 3 -12.337 -0.001 -10.655 -0.425 0.857 -0.820 -0.189
- D 58 56 3 59 3 -6.390 -1.568 -0.620
- IR 59 59 3 59 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 20 ]
- MR 60 59 3 62 3 -12.337 -0.001 -10.655 -0.917 1.124 -1.360 -0.151
- D 61 59 3 62 3 -6.390 -1.568 -0.620
- IR 62 62 3 62 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 21 ]
- MR 63 62 3 65 5 -10.983 -0.003 -10.799 -11.011 -11.902 -1.026 -3.111 1.626 -1.710
- D 64 62 3 65 5 -5.352 -0.707 -2.978 -4.409 -2.404
- IR 65 65 3 65 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 22 ]
- MP 66 65 3 70 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -11.605 -8.575 -10.956 -4.707 -10.828 -10.953 0.337 -9.413 -9.651 3.395 -9.309 2.042 -4.901 -9.835 -6.207 -8.779
- ML 67 65 3 70 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 68 65 3 70 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 69 65 3 70 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 70 70 5 70 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 71 71 6 71 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 23 ]
- MP 72 71 6 76 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -9.991 -8.855 -9.655 -2.931 -7.749 -10.815 3.083 -8.867 -10.500 1.162 -9.938 -4.575 2.329 -10.539 -3.775 -7.618
- ML 73 71 6 76 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 74 71 6 76 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 75 71 6 76 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 76 76 5 76 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 77 77 6 77 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 24 ]
- MP 78 77 6 82 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -7.211 -0.735 -7.408 -2.193 -5.911 -8.103 2.742 -7.289 -7.702 1.482 -7.745 -1.111 2.337 -7.331 -3.200 -5.943
- ML 79 77 6 82 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 80 77 6 82 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 81 77 6 82 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 82 82 5 82 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 83 83 6 83 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 25 ]
- MP 84 83 6 88 4 -11.123 -11.330 -0.003 -9.744 -1.088 -1.107 -4.104 -0.621 -3.755 -1.503 2.196 -4.047 1.129 -2.407 -4.389 -3.050 -0.595 -1.174 1.350 1.626
- ML 85 83 6 88 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 86 83 6 88 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 87 83 6 88 4 -4.568 -4.250 -2.265 -0.520
- IL 88 88 5 88 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 89 89 6 89 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 26 ]
- ML 90 89 6 92 3 -12.038 -0.001 -10.692 1.985 -6.571 -6.091 -5.965
- D 91 89 6 92 3 -6.174 -1.687 -0.566
- IL 92 92 3 92 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 27 ]
- ML 93 92 3 95 3 -12.038 -0.001 -10.692 -6.252 -7.554 1.991 -7.009
- D 94 92 3 95 3 -6.174 -1.687 -0.566
- IL 95 95 3 95 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 28 ]
- ML 96 95 3 98 3 -12.038 -0.290 -2.460 -2.109 1.017 -3.044 0.699
- D 97 95 3 98 3 -6.174 -1.687 -0.566
- IL 98 98 3 98 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 29 ]
- ML 99 98 3 101 3 -0.333 -2.285 -10.404 -1.646 1.439 -4.503 -0.113
- D 100 98 3 101 3 -11.042 -0.034 -5.434
- IL 101 101 3 101 3 -6.165 -0.023 -8.865 0.000 0.000 0.000 0.000
- [ MATL 30 ]
- ML 102 101 3 104 3 -12.038 -0.001 -10.692 -6.252 -7.554 1.991 -7.009
- D 103 101 3 104 3 -6.174 -1.687 -0.566
- IL 104 104 3 104 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 31 ]
- ML 105 104 3 107 3 -12.038 -0.001 -10.692 -6.252 -7.554 1.991 -7.009
- D 106 104 3 107 3 -6.174 -1.687 -0.566
- IL 107 107 3 107 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 32 ]
- ML 108 107 3 110 3 -0.799 -1.236 -10.692 -0.779 0.341 -1.257 0.793
- D 109 107 3 110 3 -6.174 -1.687 -0.566
- IL 110 110 3 110 3 -1.405 -0.687 -9.355 0.000 0.000 0.000 0.000
- [ MATL 33 ]
- ML 111 110 3 113 2 * 0.000 1.943 -5.670 -3.237 -5.048
- D 112 110 3 113 2 * 0.000
- IL 113 113 3 113 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 34 ]
- E 114 113 3 -1 0
-//
diff --git a/TRNAinf-arch-c.cm b/TRNAinf-arch-c.cm
deleted file mode 100644
index 6cc41fc..0000000
--- a/TRNAinf-arch-c.cm
+++ /dev/null
@@ -1,415 +0,0 @@
-INFERNAL-1 [1.0]
-NAME tRNA1415G-arch
-STATES 298
-NODES 79
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 62
-EFFNSEQ 62.000
-CLEN 93
-BCOM cmbuild --rf --enone TRNAinf-arch-nc.cm trna1415G-arch.sto
-BDATE Sun Feb 8 16:46:36 2009
-CCOM cmcalibrate --exp-hfile cmcalibrate_files/TRNAinf-arch.hfile --exp-sfile cmcalibrate_files/TRNAinf-arch.sfile --exp-qqfile cmcalibrate_files/TRNAinf-arch.qqfile --exp-ffile cmcalibrate_files/TRNAinf-arch.ffile --fil-dfile cmcalibrate_files/TRNAinf-arch.dfile -s 208 TRNAinf-arch-c.cm
-CDATE Sun Feb 8 19:56:48 2009
-NULL 0.000 0.000 0.000 0.000
-PART 1 0 100
-E-LC 0 0.79080 -6.05377 1.74701 1500000 537353 0.002094
-E-GC 0 0.34092 -36.60830 -23.07041 1500000 37885 0.009898
-E-LI 0 0.68252 -7.04406 1.91352 1500000 508509 0.002212
-E-GI 0 0.35486 -32.60887 -19.71497 1500000 36405 0.010301
-E-LV 0 0.74538 -0.99223 3.70630 48670000 121144 0.030131
-E-GV 0 0.32837 -22.22404 -8.21495 48670000 121066 0.010050
-E-LF 0 0.66040 -0.10168 5.20152 48670000 121149 0.030130
-E-GF 0 0.35058 -18.76218 -5.63802 48670000 121181 0.010041
-FT-LC 27 0.99500 10000 1500000 0
- 27.834 27.834 26.7192 26.2711 25.3709 7.0174 4.96286 3.46051 2.95227 2.75284 1.2807 1.15246 0.960678 0.684234 0.486205 0.320843 0.225312 0.14124 0.107615 0.1057 0.0808781 0.0808781 0.0808781 0.0806581 0.07573 0.0546174 8.30129e-17
- 1343.66 1171.2 948.726 815.033 694.195 572.823 472.048 423.594 258.645 217.838 174.143 153.304 134.958 111.289 93.36 77.2409 62.5272 49.1992 43.5986 30.5208 22.6144 18.4644 16.591 14.0104 11.7766 9.60599 0.960599
-FT-LI 27 0.99500 10000 1500000 0
- 51.723 49.9161 47.7457 46.4376 40.6566 14.531 9.99927 7.44873 7.12282 3.92067 3.62885 3.10429 2.00265 1.79171 1.38061 0.819573 0.541235 0.509414 0.334516 0.334516 0.334516 0.292453 0.239123 0.238371 0.205372 0.149049 2.89719e-14
- 1343.66 1171.2 948.726 815.033 694.195 572.823 472.048 423.594 258.645 217.838 174.143 153.304 134.958 111.289 93.36 77.2409 62.5272 49.1992 43.5986 30.5208 22.6144 18.4644 16.591 14.0104 11.7766 9.60599 0.960599
-FT-GC 4 0.99500 10000 1500000 1
- 1.54861e-05 1.06157e-05 9.83182e-06 3.29077e-07
- 2.89211 1.22643 0.904344 0.754031
-FT-GI 4 0.99500 10000 1500000 1
- 1.43094e-05 1.163e-05 2.50222e-06 4.25207e-07
- 2.89211 1.22643 0.904344 0.754031
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 4 -4.693 -12.169 -2.552 -0.339
- IL 1 1 2 1 4 -4.509 -6.011 -0.869 -1.348 0.000 0.000 0.000 0.000
- IR 2 2 3 2 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 1 ]
- MR 3 2 3 5 3 -9.983 -0.006 -8.301 1.945 -4.637 -4.343 -4.086
- D 4 2 3 5 3 -13.130 -8.308 -0.005
- IR 5 5 3 5 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 2 ]
- MR 6 5 3 8 3 -9.983 -0.006 -8.301 -3.682 1.918 -4.609 -3.302
- D 7 5 3 8 3 -13.130 -5.234 -0.039
- IR 8 8 3 8 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 3 ]
- MR 9 8 3 11 3 -10.117 -0.005 -8.435 -3.307 1.818 -4.292 -1.633
- D 10 8 3 11 3 -13.096 -0.009 -7.326
- IR 11 11 3 11 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 4 ]
- MR 12 11 3 14 5 -10.983 -0.003 -10.799 -11.011 -11.902 1.338 -2.349 -0.204 -1.296
- D 13 11 3 14 5 -5.352 -0.707 -2.978 -4.409 -2.404
- IR 14 14 3 14 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 5 ]
- MP 15 14 3 19 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -10.015 -5.364 -10.853 0.082 -9.814 -5.560 -1.394 -9.328 -6.521 3.833 -5.990 -3.123 -3.626 -5.674 -5.827 -7.885
- ML 16 14 3 19 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 17 14 3 19 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 18 14 3 19 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 19 19 5 19 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 20 20 6 20 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 6 ]
- MP 21 20 6 25 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -10.632 -8.947 -10.202 -3.165 -8.192 -11.711 3.044 -9.086 -10.671 2.689 -10.196 -4.740 0.111 -10.978 -4.045 -7.887
- ML 22 20 6 25 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 23 20 6 25 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 24 20 6 25 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 25 25 5 25 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 26 26 6 26 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 7 ]
- MP 27 26 6 31 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -9.177 -7.906 -9.453 0.514 -7.789 -9.963 2.919 -8.555 -9.513 2.009 -9.037 1.142 -0.585 -9.556 -3.603 -7.260
- ML 28 26 6 31 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 29 26 6 31 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 30 26 6 31 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 31 31 5 31 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 32 32 6 32 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 8 ]
- MP 33 32 6 37 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -8.554 -7.403 -9.035 0.230 -7.707 -9.342 2.679 -8.257 -8.824 2.735 -8.416 -1.500 0.206 -8.847 -2.137 -6.989
- ML 34 32 6 37 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 35 32 6 37 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 36 32 6 37 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 37 37 5 37 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 38 38 6 38 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 9 ]
- MP 39 38 6 43 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -9.759 -8.672 -9.457 0.501 -7.457 -10.407 3.004 -8.692 -10.488 1.962 -9.841 -4.353 0.655 -10.227 0.030 -7.343
- ML 40 38 6 43 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 41 38 6 43 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 42 38 6 43 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 43 43 5 43 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 44 44 6 44 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 10 ]
- MP 45 44 6 49 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -9.659 -8.313 -9.712 -0.053 -7.765 -10.458 2.430 -8.738 -10.144 2.976 -9.596 -4.281 -0.316 -10.185 -0.145 -7.409
- ML 46 44 6 49 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 47 44 6 49 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 48 44 6 49 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 49 49 5 49 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 50 50 6 50 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 11 ]
- MP 51 50 6 55 4 -11.123 -11.330 -0.003 -9.744 -8.521 -5.291 -9.442 0.877 -9.342 -5.635 -3.351 -8.517 -6.443 3.684 -5.942 -1.265 -0.596 -5.697 -5.329 -7.219
- ML 52 50 6 55 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 53 50 6 55 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 54 50 6 55 4 -4.568 -4.250 -2.265 -0.520
- IL 55 55 5 55 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 56 56 6 56 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 12 ]
- ML 57 56 6 59 3 -12.038 -0.045 -5.039 -5.136 -2.870 -5.889 1.933
- D 58 56 6 59 3 -6.174 -1.687 -0.566
- IL 59 59 3 59 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 13 ]
- ML 60 59 3 62 2 -7.097 -0.011 0.978 -1.766 0.622 -2.341
- D 61 59 3 62 2 -8.802 -0.003
- IL 62 62 3 62 2 -2.377 -0.309 0.000 0.000 0.000 0.000
- [ BIF 14 ]
- B 63 62 3 64 173
- [ BEGL 15 ]
- S 64 63 1 65 1 0.000
- [ BIF 16 ]
- B 65 64 1 66 116
- [ BEGL 17 ]
- S 66 65 1 67 4 -0.005 -10.099 -9.506 -10.146
- [ MATP 18 ]
- MP 67 66 1 71 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -11.570 -8.496 -10.949 -4.651 -10.793 -10.605 0.413 -9.410 -9.578 3.414 -9.225 1.967 -4.868 -9.682 -6.186 -8.764
- ML 68 66 1 71 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 69 66 1 71 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 70 66 1 71 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 71 71 5 71 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 72 72 6 72 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 19 ]
- MP 73 72 6 77 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -9.985 -8.856 -9.567 -2.938 -7.732 -10.684 3.126 -8.843 -10.515 1.108 -9.827 -4.582 2.278 -10.545 -3.773 -7.621
- ML 74 72 6 77 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 75 72 6 77 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 76 72 6 77 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 77 77 5 77 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 78 78 6 78 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 20 ]
- MP 79 78 6 83 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -7.146 -0.744 -7.345 -2.165 -5.854 -8.035 2.715 -7.237 -7.636 1.424 -7.681 -1.198 2.408 -7.261 -3.177 -5.890
- ML 80 78 6 83 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 81 78 6 83 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 82 78 6 83 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 83 83 5 83 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 84 84 6 84 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 21 ]
- MP 85 84 6 89 4 -11.123 -11.330 -0.003 -9.744 -1.059 -1.207 -4.350 -0.986 -3.920 -1.588 2.273 -4.321 1.158 -2.680 -4.660 -3.308 -0.663 -1.273 1.421 1.585
- ML 86 84 6 89 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 87 84 6 89 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 88 84 6 89 4 -4.568 -4.250 -2.265 -0.520
- IL 89 89 5 89 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 90 90 6 90 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 22 ]
- ML 91 90 6 93 3 -12.038 -0.001 -10.692 1.985 -6.571 -6.091 -5.965
- D 92 90 6 93 3 -6.174 -1.687 -0.566
- IL 93 93 3 93 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 23 ]
- ML 94 93 3 96 3 -12.038 -0.001 -10.692 -6.252 -7.554 1.991 -7.009
- D 95 93 3 96 3 -6.174 -1.687 -0.566
- IL 96 96 3 96 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 24 ]
- ML 97 96 3 99 3 -12.038 -0.296 -2.433 -2.146 1.034 -3.180 0.692
- D 98 96 3 99 3 -6.174 -1.687 -0.566
- IL 99 99 3 99 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 25 ]
- ML 100 99 3 102 3 -0.346 -2.234 -10.398 -1.682 1.432 -4.485 -0.080
- D 101 99 3 102 3 -11.068 -0.034 -5.460
- IL 102 102 3 102 3 -6.146 -0.024 -8.847 0.000 0.000 0.000 0.000
- [ MATL 26 ]
- ML 103 102 3 105 3 -12.038 -0.001 -10.692 -6.252 -7.554 1.991 -7.009
- D 104 102 3 105 3 -6.174 -1.687 -0.566
- IL 105 105 3 105 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 27 ]
- ML 106 105 3 108 3 -12.038 -0.001 -10.692 -6.252 -7.554 1.991 -7.009
- D 107 105 3 108 3 -6.174 -1.687 -0.566
- IL 108 108 3 108 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 28 ]
- ML 109 108 3 111 3 -0.829 -1.196 -10.692 -0.760 0.255 -1.274 0.850
- D 110 108 3 111 3 -6.174 -1.687 -0.566
- IL 111 111 3 111 3 -1.387 -0.699 -9.337 0.000 0.000 0.000 0.000
- [ MATL 29 ]
- ML 112 111 3 114 2 * 0.000 1.946 -5.710 -3.349 -5.078
- D 113 111 3 114 2 * 0.000
- IL 114 114 3 114 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 30 ]
- E 115 114 3 -1 0
- [ BEGR 31 ]
- S 116 65 1 117 3 -12.038 -0.001 -10.692
- IL 117 117 2 117 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 32 ]
- ML 118 117 2 120 5 -10.983 -0.003 -10.799 -11.011 -11.902 -1.084 -3.136 1.640 -1.751
- D 119 117 2 120 5 -4.959 -0.803 -4.221 -2.596 -2.508
- IL 120 120 3 120 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 33 ]
- MP 121 120 3 125 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -9.079 -8.455 -8.492 0.844 -6.990 -9.259 3.175 -8.246 -9.864 0.619 -8.762 -4.331 0.991 -9.411 0.647 -7.059
- ML 122 120 3 125 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 123 120 3 125 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 124 120 3 125 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 125 125 5 125 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 126 126 6 126 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 34 ]
- MP 127 126 6 131 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -6.404 -6.495 -6.524 1.364 -5.076 -7.122 2.869 -6.476 -6.870 0.667 -6.804 -0.571 1.686 -6.386 -0.999 -5.105
- ML 128 126 6 131 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 129 126 6 131 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 130 126 6 131 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 131 131 5 131 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 132 132 6 132 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 35 ]
- MP 133 132 6 137 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -8.148 -6.758 -8.804 0.185 -7.901 -8.135 1.101 -8.076 -8.017 3.430 -7.624 -3.768 0.806 -7.825 -3.760 -6.856
- ML 134 132 6 137 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 135 132 6 137 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 136 132 6 137 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 137 137 5 137 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 138 138 6 138 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 36 ]
- MP 139 138 6 143 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -11.083 -7.134 -10.902 -3.666 -10.264 -7.695 1.527 -9.382 -8.277 3.641 -7.797 -1.096 -4.303 -7.664 -5.886 -8.492
- ML 140 138 6 143 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 141 138 6 143 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 142 138 6 143 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 143 143 5 143 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 144 144 6 144 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 37 ]
- MP 145 144 6 149 4 -11.123 -11.330 -0.003 -9.744 -7.595 -6.513 -8.344 2.053 -7.762 -8.392 2.582 -7.691 -7.765 2.292 -7.411 -2.340 -0.674 -7.807 -3.597 -6.492
- ML 146 144 6 149 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 147 144 6 149 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 148 144 6 149 4 -4.568 -4.250 -2.265 -0.520
- IL 149 149 5 149 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 150 150 6 150 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 38 ]
- ML 151 150 6 153 3 -12.038 -0.001 -10.692 -5.181 1.706 -6.181 -0.522
- D 152 150 6 153 3 -6.174 -1.687 -0.566
- IL 153 153 3 153 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 39 ]
- ML 154 153 3 156 3 -12.038 -0.001 -10.692 -5.986 -5.748 -6.637 1.984
- D 155 153 3 156 3 -6.174 -1.687 -0.566
- IL 156 156 3 156 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 40 ]
- ML 157 156 3 159 3 -12.038 -0.001 -10.692 -3.411 0.262 0.295 0.566
- D 158 156 3 159 3 -6.174 -1.687 -0.566
- IL 159 159 3 159 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 41 ]
- ML 160 159 3 162 3 -12.038 -0.001 -10.692 0.373 -0.476 -0.090 0.066
- D 161 159 3 162 3 -6.174 -1.687 -0.566
- IL 162 162 3 162 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 42 ]
- ML 163 162 3 165 3 -12.038 -0.001 -10.692 -0.414 0.235 -0.281 0.321
- D 164 162 3 165 3 -6.174 -1.687 -0.566
- IL 165 165 3 165 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 43 ]
- ML 166 165 3 168 3 -3.068 -0.184 -10.692 1.104 -7.571 0.879 -7.144
- D 167 165 3 168 3 -6.174 -1.687 -0.566
- IL 168 168 3 168 3 -0.088 -4.101 -10.629 0.000 0.000 0.000 0.000
- [ MATL 44 ]
- ML 169 168 3 171 2 * 0.000 1.737 -1.357 -2.681 -3.044
- D 170 168 3 171 2 * 0.000
- IL 171 171 3 171 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 45 ]
- E 172 171 3 -1 0
- [ BEGR 46 ]
- S 173 63 1 174 3 -12.038 -0.001 -10.692
- IL 174 174 2 174 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 47 ]
- ML 175 174 2 177 3 -12.038 -0.289 -2.463 0.488 -0.754 -1.483 0.720
- D 176 174 2 177 3 -6.174 -1.687 -0.566
- IL 177 177 3 177 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 48 ]
- ML 178 177 3 180 2 -12.389 -0.000 -1.059 -1.734 1.473 -1.172
- D 179 177 3 180 2 -9.877 -0.002
- IL 180 180 3 180 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ BIF 49 ]
- B 181 180 3 182 238
- [ BEGL 50 ]
- S 182 181 1 183 4 -2.034 -10.099 -9.506 -0.408
- [ MATP 51 ]
- MP 183 182 1 187 6 -10.137 -10.077 -0.010 -8.853 -9.133 -9.528 -5.612 -4.384 -6.384 0.059 -6.159 -5.891 1.866 -5.766 -5.528 3.126 -5.192 0.545 -0.600 -5.428 -2.152 -4.640
- ML 184 182 1 187 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 185 182 1 187 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 186 182 1 187 6 -15.597 -14.295 -10.092 -10.774 -10.792 -0.003
- IL 187 187 5 187 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 188 188 6 188 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 52 ]
- MP 189 188 6 193 6 -10.137 -10.077 -0.010 -8.853 -9.133 -9.528 -5.672 -4.642 -6.349 1.199 -5.704 -6.447 2.476 -5.751 -5.823 2.690 -5.497 -1.722 -0.197 -5.834 -1.765 -4.574
- ML 190 188 6 193 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 191 188 6 193 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 192 188 6 193 6 -15.597 -14.295 -10.092 -10.774 -10.792 -0.003
- IL 193 193 5 193 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 194 194 6 194 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 53 ]
- MP 195 194 6 199 6 -10.137 -10.077 -0.901 -8.853 -9.133 -1.125 -6.048 -6.135 -4.941 0.687 -4.221 -5.572 3.391 -5.389 -7.061 -0.965 -5.049 -2.799 1.000 -6.442 -0.000 -4.781
- ML 196 194 6 199 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 197 194 6 199 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 198 194 6 199 6 -15.597 -14.295 -10.092 -10.774 -10.792 -0.003
- IL 199 199 5 199 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 200 200 6 200 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 54 ]
- MP 201 200 6 205 6 -9.256 -9.195 -0.019 -7.972 -8.251 -8.646 -4.124 -4.353 -4.244 0.359 -3.051 -4.935 2.710 -4.310 -4.625 0.371 -4.507 -1.343 2.376 -4.360 -0.534 -3.181
- ML 202 200 6 205 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 203 200 6 205 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 204 200 6 205 6 -15.822 -14.520 -10.317 -11.000 -11.017 -0.003
- IL 205 205 5 205 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 206 206 6 206 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 55 ]
- MP 207 206 6 211 6 -9.256 -9.195 -0.514 -7.972 -8.251 -1.791 -5.601 -5.515 -4.260 -0.876 -3.785 -4.908 3.662 -4.752 -6.510 -0.827 -4.279 -2.472 0.271 -6.055 -1.047 -4.463
- ML 208 206 6 211 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 209 206 6 211 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 210 206 6 211 6 -15.822 -14.520 -10.317 -11.000 -11.017 -0.003
- IL 211 211 5 211 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 212 212 6 212 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 56 ]
- MP 213 212 6 217 6 -8.769 -8.708 -0.027 -7.485 -7.765 -8.160 -3.305 -2.766 -3.576 1.411 -2.869 -4.048 1.948 -3.248 -3.354 2.027 -3.320 -0.140 1.330 -3.299 -0.204 -2.459
- ML 214 212 6 217 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 215 212 6 217 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 216 212 6 217 6 -15.891 -14.590 -10.387 -11.069 -11.086 -0.002
- IL 217 217 5 217 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 218 218 6 218 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 57 ]
- MP 219 218 6 223 4 -5.802 -6.009 -0.120 -4.423 -3.305 -2.766 -3.576 1.411 -2.869 -4.048 1.948 -3.248 -3.354 2.027 -3.320 -0.140 1.330 -3.299 -0.204 -2.459
- ML 220 218 6 223 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 221 218 6 223 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 222 218 6 223 4 -11.314 -3.805 -3.116 -0.299
- IL 223 223 5 223 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 224 224 6 224 3 -3.338 -0.175 -6.038 0.000 0.000 0.000 0.000
- [ MATL 58 ]
- ML 225 224 6 227 3 -9.786 -0.006 -8.440 -2.444 -3.838 1.744 -1.334
- D 226 224 6 227 3 -13.129 -8.642 -0.004
- IL 227 227 3 227 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 59 ]
- ML 228 227 3 230 3 -9.786 -0.006 -8.440 -3.029 -1.352 -3.811 1.772
- D 229 227 3 230 3 -13.129 -8.642 -0.004
- IL 230 230 3 230 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 60 ]
- ML 231 230 3 233 3 -9.786 -0.189 -3.037 1.230 -0.834 -2.296 -0.169
- D 232 230 3 233 3 -13.129 -8.642 -0.004
- IL 233 233 3 233 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 61 ]
- ML 234 233 3 236 2 * 0.000 -0.014 -0.636 1.024 -1.587
- D 235 233 3 236 2 * 0.000
- IL 236 236 3 236 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 62 ]
- E 237 236 3 -1 0
- [ BEGR 63 ]
- S 238 181 1 239 3 -12.038 -0.042 -5.118
- IL 239 239 2 239 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 64 ]
- ML 240 239 2 242 3 -0.515 -1.740 -10.651 0.696 -2.789 0.714 -0.749
- D 241 239 2 242 3 -0.292 -4.117 -2.996
- IL 242 242 3 242 3 -4.682 -0.060 -9.023 0.000 0.000 0.000 0.000
- [ MATL 65 ]
- ML 243 242 3 245 5 -10.983 -0.003 -10.799 -11.011 -11.902 -6.177 1.986 -6.986 -5.896
- D 244 242 3 245 5 -4.959 -0.803 -4.221 -2.596 -2.508
- IL 245 245 3 245 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 66 ]
- MP 246 245 3 250 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -8.425 -7.280 -8.956 0.151 -7.726 -9.214 2.599 -8.192 -8.674 2.629 -8.275 -0.285 -0.503 -8.706 0.108 -6.934
- ML 247 245 3 250 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 248 245 3 250 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 249 245 3 250 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 250 250 5 250 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 251 251 6 251 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 67 ]
- MP 252 251 6 256 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -8.347 -7.950 -8.279 0.577 -6.642 -8.987 3.159 -7.948 -8.896 1.290 -8.568 -0.379 1.041 -8.469 -1.935 -6.608
- ML 253 251 6 256 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 254 251 6 256 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 255 251 6 256 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 256 256 5 256 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 257 257 6 257 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 68 ]
- MP 258 257 6 262 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -7.857 -6.453 -8.580 0.294 -7.858 -7.755 1.193 -7.892 -7.689 3.497 -7.295 -3.582 -0.772 -7.467 -1.082 -6.674
- ML 259 257 6 262 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 260 257 6 262 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 261 257 6 262 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 262 262 5 262 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 263 263 6 263 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 69 ]
- MP 264 263 6 268 6 -12.016 -11.955 -0.003 -10.732 -11.012 -11.407 -10.077 -5.384 -10.899 -1.124 -9.844 -5.579 -3.698 -9.350 -6.540 3.897 -6.010 -3.142 -1.577 -5.693 -5.855 -7.912
- ML 265 263 6 268 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 266 263 6 268 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 267 263 6 268 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 268 268 5 268 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 269 269 6 269 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 70 ]
- MP 270 269 6 274 4 -11.123 -11.330 -0.003 -9.744 -11.170 -6.905 -11.033 -3.627 -10.757 -7.380 -4.824 -9.431 -8.041 3.977 -7.551 -4.453 -4.613 -7.379 -6.287 -8.552
- ML 271 269 6 274 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 272 269 6 274 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 273 269 6 274 4 -4.568 -4.250 -2.265 -0.520
- IL 274 274 5 274 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 275 275 6 275 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 71 ]
- ML 276 275 6 278 3 -12.038 -0.001 -10.692 -5.986 -5.748 -6.637 1.984
- D 277 275 6 278 3 -6.174 -1.687 -0.566
- IL 278 278 3 278 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 72 ]
- ML 279 278 3 281 3 -12.038 -0.001 -10.692 -5.165 -3.547 -5.915 1.952
- D 280 278 3 281 3 -6.174 -1.687 -0.566
- IL 281 281 3 281 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 73 ]
- ML 282 281 3 284 3 -12.038 -0.001 -10.692 -5.531 1.967 -4.665 -5.111
- D 283 281 3 284 3 -6.174 -1.687 -0.566
- IL 284 284 3 284 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 74 ]
- ML 285 284 3 287 3 -12.038 -0.001 -10.692 1.305 -7.468 0.600 -7.082
- D 286 284 3 287 3 -6.174 -1.687 -0.566
- IL 287 287 3 287 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 75 ]
- ML 288 287 3 290 3 -12.038 -0.001 -10.692 1.985 -6.571 -6.091 -5.965
- D 289 287 3 290 3 -6.174 -1.687 -0.566
- IL 290 290 3 290 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 76 ]
- ML 291 290 3 293 3 -12.038 -0.001 -10.692 1.773 -4.394 -1.488 -2.493
- D 292 290 3 293 3 -6.174 -1.687 -0.566
- IL 293 293 3 293 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 77 ]
- ML 294 293 3 296 2 * 0.000 -5.125 -1.961 -5.878 1.887
- D 295 293 3 296 2 * 0.000
- IL 296 296 3 296 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 78 ]
- E 297 296 3 -1 0
-//
diff --git a/TRNAinf-arch-ns-c.cm b/TRNAinf-arch-ns-c.cm
deleted file mode 100644
index d29bd74..0000000
--- a/TRNAinf-arch-ns-c.cm
+++ /dev/null
@@ -1,416 +0,0 @@
-INFERNAL-1 [1.0]
-NAME tRNA1415G-arch-nostruct
-STATES 283
-NODES 95
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 62
-EFFNSEQ 62.000
-CLEN 93
-BCOM cmbuild --rf --enone -F TRNAinf-arch-ns-nc.cm trna1415G-arch-ns.sto
-BDATE Sun Feb 8 18:06:51 2009
-CCOM cmcalibrate --exp-hfile cmcalibrate_files/TRNAinf-arch-ns.hfile --exp-sfile cmcalibrate_files/TRNAinf-arch-ns.sfile --exp-qqfile cmcalibrate_files/TRNAinf-arch-ns.qqfile --exp-ffile cmcalibrate_files/TRNAinf-arch-ns.ffile --fil-dfile cmcalibrate_files/TRNAinf-arch-ns.dfile -s 208 TRNAinf-arch-ns-c.cm
-CDATE Sun Feb 8 19:59:12 2009
-NULL 0.000 0.000 0.000 0.000
-PART 1 0 100
-E-LC 0 0.64507 -11.44395 -1.14500 1500000 863822 0.001302
-E-GC 0 0.31911 -29.20560 -15.01859 1500000 34690 0.010810
-E-LI 0 0.61785 -10.83534 -0.36287 1500000 726504 0.001549
-E-GI 0 0.33011 -26.13627 -12.48049 1500000 34024 0.011022
-E-LV 0 0.62174 -3.67264 1.98411 32320000 81652 0.029687
-E-GV 0 0.34755 -21.38243 -8.12223 32320000 81081 0.009965
-E-LF 0 0.59976 -0.34575 5.52007 32320000 81736 0.029656
-E-GF 0 0.35374 -18.68940 -5.65897 32320000 81139 0.009958
-FT-LC 33 0.99500 10000 1500000 0
- 11584.1 9356.94 8252.27 8082.38 7305.08 6353.93 6181.85 6017.01 4476.31 4060.85 2788.51 2609.26 2112.21 1710.08 1124.22 850.929 786.338 738.047 638.516 376.609 344.361 277.173 213.638 182.922 159.18 149.247 143.777 2.51917 1.17731 1.0678 0.558037 0.449367 0.191891
- 1366.05 1211.63 914.554 744.952 629.035 556.261 436.826 357.1 314.463 280.932 249.625 196.971 152.286 129.208 106.389 91.2465 74.7721 61.6037 49.196 43.5044 36.1883 32.1555 28.6751 24.4614 18.0369 16.1717 13.9251 9.4714 7.98804 3.7994 2.65591 1.74326 1.39251
-FT-LI 39 0.99500 10000 1500000 0
- 10929.9 9229.94 7856.85 7484.38 7045.88 6436.48 6238.52 6173.58 4755.93 3421.44 3112.79 2990.89 2116.37 1807.63 1283.87 825.629 757.018 678.06 562.971 455.91 343.751 251.027 242.145 224.865 195.339 173.879 173.422 3.57002 2.96432 2.62038 2.15274 1.9965 1.56256 1.45489 1.01519 0.746638 0.568454 0.501147 0.356016
- 1366.05 1211.63 914.554 744.952 629.035 556.261 436.826 357.1 314.463 280.932 249.625 196.971 152.286 129.208 106.389 91.2465 74.7721 61.6037 49.196 43.5044 36.1883 32.1555 28.6751 24.4614 18.0369 16.1717 13.9251 11.5236 10.1599 8.17708 7.1706 6.26164 5.62424 4.16704 3.31978 2.20795 1.89937 1.58946 1.39251
-FT-GC 1 0.99500 10000 1500000 1
- 0.841728
- 1.12142
-FT-GI 1 0.99500 10000 1500000 1
- 1.14672
- 1.12142
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 4 -4.688 -11.330 -0.059 -9.744
- IL 1 1 2 1 4 -3.697 -4.380 -0.207 -6.865 0.000 0.000 0.000 0.000
- IR 2 2 3 2 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 1 ]
- ML 3 2 3 5 3 -12.038 -0.001 -10.692 -1.647 -3.136 1.820 -4.772
- D 4 2 3 5 3 -6.174 -1.687 -0.566
- IL 5 5 3 5 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 2 ]
- ML 6 5 3 8 3 -12.038 -0.001 -10.692 -3.952 1.030 0.684 -1.797
- D 7 5 3 8 3 -6.174 -1.687 -0.566
- IL 8 8 3 8 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 3 ]
- ML 9 8 3 11 3 -12.038 -0.001 -10.692 -1.302 0.894 0.615 -2.289
- D 10 8 3 11 3 -6.174 -1.687 -0.566
- IL 11 11 3 11 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 4 ]
- ML 12 11 3 14 3 -12.038 -0.001 -10.692 -1.572 0.658 0.788 -1.475
- D 13 11 3 14 3 -6.174 -1.687 -0.566
- IL 14 14 3 14 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 5 ]
- ML 15 14 3 17 3 -12.038 -0.001 -10.692 -1.286 0.971 -0.037 -0.610
- D 16 14 3 17 3 -6.174 -1.687 -0.566
- IL 17 17 3 17 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 6 ]
- ML 18 17 3 20 3 -12.038 -0.001 -10.692 -1.777 0.382 0.979 -1.202
- D 19 17 3 20 3 -6.174 -1.687 -0.566
- IL 20 20 3 20 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 7 ]
- ML 21 20 3 23 3 -12.038 -0.001 -10.692 -0.913 -5.512 1.697 -2.282
- D 22 20 3 23 3 -6.174 -1.687 -0.566
- IL 23 23 3 23 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 8 ]
- ML 24 23 3 26 3 -12.038 -0.045 -5.039 -5.136 -2.870 -5.889 1.933
- D 25 23 3 26 3 -6.174 -1.687 -0.566
- IL 26 26 3 26 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 9 ]
- ML 27 26 3 29 3 -7.094 -0.012 -10.648 0.978 -1.766 0.622 -2.341
- D 28 26 3 29 3 -8.671 -0.188 -3.062
- IL 29 29 3 29 3 -1.785 -0.588 -4.485 0.000 0.000 0.000 0.000
- [ MATL 10 ]
- ML 30 29 3 32 3 -12.038 -0.001 -10.692 -4.697 -1.690 1.859 -5.433
- D 31 29 3 32 3 -6.174 -1.687 -0.566
- IL 32 32 3 32 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 11 ]
- ML 33 32 3 35 3 -12.038 -0.001 -10.692 -3.513 1.104 -0.886 0.288
- D 34 32 3 35 3 -6.174 -1.687 -0.566
- IL 35 35 3 35 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 12 ]
- ML 36 35 3 38 3 -12.038 -0.001 -10.692 -1.991 0.699 -0.355 0.426
- D 37 35 3 38 3 -6.174 -1.687 -0.566
- IL 38 38 3 38 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 13 ]
- ML 39 38 3 41 3 -12.038 -0.001 -10.692 -1.345 0.404 -0.715 0.743
- D 40 38 3 41 3 -6.174 -1.687 -0.566
- IL 41 41 3 41 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 14 ]
- ML 42 41 3 44 3 -12.038 -0.001 -10.692 1.985 -6.571 -6.091 -5.965
- D 43 41 3 44 3 -6.174 -1.687 -0.566
- IL 44 44 3 44 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 15 ]
- ML 45 44 3 47 3 -12.038 -0.001 -10.692 -6.252 -7.554 1.991 -7.009
- D 46 44 3 47 3 -6.174 -1.687 -0.566
- IL 47 47 3 47 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 16 ]
- ML 48 47 3 50 3 -12.038 -0.296 -2.433 -2.146 1.034 -3.180 0.692
- D 49 47 3 50 3 -6.174 -1.687 -0.566
- IL 50 50 3 50 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 17 ]
- ML 51 50 3 53 3 -0.346 -2.234 -10.398 -1.682 1.432 -4.485 -0.080
- D 52 50 3 53 3 -11.068 -0.034 -5.460
- IL 53 53 3 53 3 -6.146 -0.024 -8.847 0.000 0.000 0.000 0.000
- [ MATL 18 ]
- ML 54 53 3 56 3 -12.038 -0.001 -10.692 -6.252 -7.554 1.991 -7.009
- D 55 53 3 56 3 -6.174 -1.687 -0.566
- IL 56 56 3 56 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 19 ]
- ML 57 56 3 59 3 -12.038 -0.001 -10.692 -6.252 -7.554 1.991 -7.009
- D 58 56 3 59 3 -6.174 -1.687 -0.566
- IL 59 59 3 59 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 20 ]
- ML 60 59 3 62 3 -0.829 -1.196 -10.692 -0.760 0.255 -1.274 0.850
- D 61 59 3 62 3 -6.174 -1.687 -0.566
- IL 62 62 3 62 3 -1.387 -0.699 -9.337 0.000 0.000 0.000 0.000
- [ MATL 21 ]
- ML 63 62 3 65 3 -12.038 -0.001 -10.692 1.946 -5.710 -3.349 -5.078
- D 64 62 3 65 3 -6.174 -1.687 -0.566
- IL 65 65 3 65 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 22 ]
- ML 66 65 3 68 3 -12.038 -0.001 -10.692 -0.234 -1.621 0.925 -0.110
- D 67 65 3 68 3 -6.174 -1.687 -0.566
- IL 68 68 3 68 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 23 ]
- ML 69 68 3 71 3 -12.038 -0.001 -10.692 0.423 -0.242 0.697 -2.379
- D 70 68 3 71 3 -6.174 -1.687 -0.566
- IL 71 71 3 71 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 24 ]
- ML 72 71 3 74 3 -12.038 -0.001 -10.692 0.212 -0.972 1.185 -4.086
- D 73 71 3 74 3 -6.174 -1.687 -0.566
- IL 74 74 3 74 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 25 ]
- ML 75 74 3 77 3 -12.038 -0.001 -10.692 -3.992 1.422 -1.624 -0.099
- D 76 74 3 77 3 -6.174 -1.687 -0.566
- IL 77 77 3 77 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 26 ]
- ML 78 77 3 80 3 -12.038 -0.001 -10.692 -1.084 -3.136 1.640 -1.751
- D 79 77 3 80 3 -6.174 -1.687 -0.566
- IL 80 80 3 80 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 27 ]
- ML 81 80 3 83 3 -12.038 -0.001 -10.692 -0.977 1.139 -1.334 -0.162
- D 82 80 3 83 3 -6.174 -1.687 -0.566
- IL 83 83 3 83 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 28 ]
- ML 84 83 3 86 3 -12.038 -0.001 -10.692 -0.492 0.894 -0.835 -0.200
- D 85 83 3 86 3 -6.174 -1.687 -0.566
- IL 86 86 3 86 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 29 ]
- ML 87 86 3 89 3 -12.038 -0.001 -10.692 -1.803 -1.059 1.492 -1.245
- D 88 86 3 89 3 -6.174 -1.687 -0.566
- IL 89 89 3 89 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 30 ]
- ML 90 89 3 92 3 -12.038 -0.001 -10.692 -5.317 -0.451 1.691 -6.050
- D 91 89 3 92 3 -6.174 -1.687 -0.566
- IL 92 92 3 92 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 31 ]
- ML 93 92 3 95 3 -12.038 -0.001 -10.692 0.105 0.592 0.285 -2.338
- D 94 92 3 95 3 -6.174 -1.687 -0.566
- IL 95 95 3 95 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 32 ]
- ML 96 95 3 98 3 -12.038 -0.001 -10.692 -5.181 1.706 -6.181 -0.522
- D 97 95 3 98 3 -6.174 -1.687 -0.566
- IL 98 98 3 98 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 33 ]
- ML 99 98 3 101 3 -12.038 -0.001 -10.692 -5.986 -5.748 -6.637 1.984
- D 100 98 3 101 3 -6.174 -1.687 -0.566
- IL 101 101 3 101 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 34 ]
- ML 102 101 3 104 3 -12.038 -0.001 -10.692 -3.411 0.262 0.295 0.566
- D 103 101 3 104 3 -6.174 -1.687 -0.566
- IL 104 104 3 104 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 35 ]
- ML 105 104 3 107 3 -12.038 -0.001 -10.692 0.373 -0.476 -0.090 0.066
- D 106 104 3 107 3 -6.174 -1.687 -0.566
- IL 107 107 3 107 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 36 ]
- ML 108 107 3 110 3 -12.038 -0.001 -10.692 -0.414 0.235 -0.281 0.321
- D 109 107 3 110 3 -6.174 -1.687 -0.566
- IL 110 110 3 110 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 37 ]
- ML 111 110 3 113 3 -3.068 -0.184 -10.692 1.104 -7.571 0.879 -7.144
- D 112 110 3 113 3 -6.174 -1.687 -0.566
- IL 113 113 3 113 3 -0.088 -4.101 -10.629 0.000 0.000 0.000 0.000
- [ MATL 38 ]
- ML 114 113 3 116 3 -12.038 -0.001 -10.692 1.737 -1.357 -2.681 -3.044
- D 115 113 3 116 3 -6.174 -1.687 -0.566
- IL 116 116 3 116 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 39 ]
- ML 117 116 3 119 3 -12.038 -0.001 -10.692 -2.330 0.262 0.584 0.141
- D 118 116 3 119 3 -6.174 -1.687 -0.566
- IL 119 119 3 119 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 40 ]
- ML 120 119 3 122 3 -12.038 -0.001 -10.692 -4.955 1.666 -0.609 -2.856
- D 121 119 3 122 3 -6.174 -1.687 -0.566
- IL 122 122 3 122 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 41 ]
- ML 123 122 3 125 3 -12.038 -0.001 -10.692 -1.090 1.435 -0.960 -1.682
- D 124 122 3 125 3 -6.174 -1.687 -0.566
- IL 125 125 3 125 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 42 ]
- ML 126 125 3 128 3 -12.038 -0.001 -10.692 -0.373 -1.289 0.969 -0.216
- D 127 125 3 128 3 -6.174 -1.687 -0.566
- IL 128 128 3 128 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 43 ]
- ML 129 128 3 131 3 -12.038 -0.001 -10.692 -1.063 -1.470 1.440 -1.160
- D 130 128 3 131 3 -6.174 -1.687 -0.566
- IL 131 131 3 131 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 44 ]
- ML 132 131 3 134 3 -12.038 -0.289 -2.463 0.488 -0.754 -1.483 0.720
- D 133 131 3 134 3 -6.174 -1.687 -0.566
- IL 134 134 3 134 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 45 ]
- ML 135 134 3 137 3 -11.750 -4.854 -0.051 -1.059 -1.734 1.473 -1.172
- D 136 134 3 137 3 -11.039 -0.035 -5.431
- IL 137 137 3 137 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 46 ]
- ML 138 137 3 140 3 -9.786 -0.006 -8.440 -2.458 -0.333 1.531 -2.891
- D 139 137 3 140 3 -13.129 -8.642 -0.004
- IL 140 140 3 140 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 47 ]
- ML 141 140 3 143 3 -9.786 -0.006 -8.440 -0.581 0.448 0.696 -1.522
- D 142 140 3 143 3 -13.129 -8.642 -0.004
- IL 143 143 3 143 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 48 ]
- ML 144 143 3 146 3 -9.786 -1.500 -0.632 -0.560 1.216 -2.457 -0.292
- D 145 143 3 146 3 -13.129 -8.642 -0.004
- IL 146 146 3 146 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 49 ]
- ML 147 146 3 149 3 -8.302 -0.016 -6.956 -0.588 0.266 -1.422 0.815
- D 148 146 3 149 3 -13.354 -8.867 -0.003
- IL 149 149 3 149 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 50 ]
- ML 150 149 3 152 3 -8.302 -1.405 -0.691 -1.938 1.726 -2.780 -1.813
- D 151 149 3 152 3 -13.354 -8.867 -0.003
- IL 152 152 3 152 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 51 ]
- ML 153 152 3 155 3 -6.939 -0.042 -5.593 0.660 -0.612 -0.293 -0.076
- D 154 152 3 155 3 -13.424 -8.937 -0.003
- IL 155 155 3 155 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 52 ]
- ML 156 155 3 158 3 -6.939 -0.042 -5.593 0.660 -0.612 -0.293 -0.076
- D 157 155 3 158 3 -13.424 -2.419 -0.299
- IL 158 158 3 158 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 53 ]
- ML 159 158 3 161 3 -9.786 -0.006 -8.440 -2.444 -3.838 1.744 -1.334
- D 160 158 3 161 3 -13.129 -8.642 -0.004
- IL 161 161 3 161 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 54 ]
- ML 162 161 3 164 3 -9.786 -0.006 -8.440 -3.029 -1.352 -3.811 1.772
- D 163 161 3 164 3 -13.129 -8.642 -0.004
- IL 164 164 3 164 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 55 ]
- ML 165 164 3 167 3 -9.786 -0.189 -3.037 1.230 -0.834 -2.296 -0.169
- D 166 164 3 167 3 -13.129 -8.642 -0.004
- IL 167 167 3 167 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 56 ]
- ML 168 167 3 170 3 -1.405 -2.707 -1.092 -0.014 -0.636 1.024 -1.587
- D 169 167 3 170 3 -13.173 -8.686 -0.004
- IL 170 170 3 170 3 -3.338 -2.694 -0.422 0.000 0.000 0.000 0.000
- [ MATL 57 ]
- ML 171 170 3 173 3 -6.939 -0.042 -5.593 0.660 -0.612 -0.293 -0.076
- D 172 170 3 173 3 -13.424 -8.937 -0.003
- IL 173 173 3 173 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 58 ]
- ML 174 173 3 176 3 -6.939 -0.042 -5.593 0.660 -0.612 -0.293 -0.076
- D 175 173 3 176 3 -13.424 -4.352 -0.073
- IL 176 176 3 176 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 59 ]
- ML 177 176 3 179 3 -8.302 -0.016 -6.956 -1.724 -2.917 1.746 -2.253
- D 178 176 3 179 3 -13.354 -8.867 -0.003
- IL 179 179 3 179 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 60 ]
- ML 180 179 3 182 3 -8.302 -0.016 -6.956 0.828 -1.516 0.438 -0.943
- D 181 179 3 182 3 -13.354 -2.766 -0.229
- IL 182 182 3 182 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 61 ]
- ML 183 182 3 185 3 -9.786 -0.006 -8.440 -1.144 -3.350 1.588 -1.175
- D 184 182 3 185 3 -13.129 -8.642 -0.004
- IL 185 185 3 185 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 62 ]
- ML 186 185 3 188 3 -9.786 -0.006 -8.440 -1.403 0.610 0.498 -0.550
- D 187 185 3 188 3 -13.129 -8.642 -0.004
- IL 188 188 3 188 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 63 ]
- ML 189 188 3 191 3 -9.786 -0.215 -2.866 -1.485 1.025 -0.069 -0.610
- D 190 188 3 191 3 -13.129 -0.008 -7.520
- IL 191 191 3 191 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 64 ]
- ML 192 191 3 194 3 -0.515 -1.740 -10.651 0.696 -2.789 0.714 -0.749
- D 193 191 3 194 3 -0.292 -4.117 -2.996
- IL 194 194 3 194 3 -4.682 -0.060 -9.023 0.000 0.000 0.000 0.000
- [ MATL 65 ]
- ML 195 194 3 197 3 -12.038 -0.001 -10.692 -6.177 1.986 -6.986 -5.896
- D 196 194 3 197 3 -6.174 -1.687 -0.566
- IL 197 197 3 197 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 66 ]
- ML 198 197 3 200 3 -12.038 -0.001 -10.692 -1.646 0.581 0.785 -1.116
- D 199 197 3 200 3 -6.174 -1.687 -0.566
- IL 200 200 3 200 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 67 ]
- ML 201 200 3 203 3 -12.038 -0.001 -10.692 -1.232 1.141 -0.325 -0.810
- D 202 200 3 203 3 -6.174 -1.687 -0.566
- IL 203 203 3 203 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 68 ]
- ML 204 203 3 206 3 -12.038 -0.001 -10.692 -1.774 -0.990 1.574 -2.137
- D 205 203 3 206 3 -6.174 -1.687 -0.566
- IL 206 206 3 206 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 69 ]
- ML 207 206 3 209 3 -12.038 -0.001 -10.692 -2.875 -5.554 1.899 -3.131
- D 208 206 3 209 3 -6.174 -1.687 -0.566
- IL 209 209 3 209 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 70 ]
- ML 210 209 3 212 3 -12.038 -0.001 -10.692 -6.252 -7.554 1.991 -7.009
- D 211 209 3 212 3 -6.174 -1.687 -0.566
- IL 212 212 3 212 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 71 ]
- ML 213 212 3 215 3 -12.038 -0.001 -10.692 -5.986 -5.748 -6.637 1.984
- D 214 212 3 215 3 -6.174 -1.687 -0.566
- IL 215 215 3 215 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 72 ]
- ML 216 215 3 218 3 -12.038 -0.001 -10.692 -5.165 -3.547 -5.915 1.952
- D 217 215 3 218 3 -6.174 -1.687 -0.566
- IL 218 218 3 218 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 73 ]
- ML 219 218 3 221 3 -12.038 -0.001 -10.692 -5.531 1.967 -4.665 -5.111
- D 220 218 3 221 3 -6.174 -1.687 -0.566
- IL 221 221 3 221 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 74 ]
- ML 222 221 3 224 3 -12.038 -0.001 -10.692 1.305 -7.468 0.600 -7.082
- D 223 221 3 224 3 -6.174 -1.687 -0.566
- IL 224 224 3 224 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 75 ]
- ML 225 224 3 227 3 -12.038 -0.001 -10.692 1.985 -6.571 -6.091 -5.965
- D 226 224 3 227 3 -6.174 -1.687 -0.566
- IL 227 227 3 227 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 76 ]
- ML 228 227 3 230 3 -12.038 -0.001 -10.692 1.773 -4.394 -1.488 -2.493
- D 229 227 3 230 3 -6.174 -1.687 -0.566
- IL 230 230 3 230 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 77 ]
- ML 231 230 3 233 3 -12.038 -0.001 -10.692 -5.125 -1.961 -5.878 1.887
- D 232 230 3 233 3 -6.174 -1.687 -0.566
- IL 233 233 3 233 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 78 ]
- ML 234 233 3 236 3 -12.038 -0.001 -10.692 -6.177 1.986 -6.986 -5.896
- D 235 233 3 236 3 -6.174 -1.687 -0.566
- IL 236 236 3 236 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 79 ]
- ML 237 236 3 239 3 -12.038 -0.001 -10.692 -3.239 1.912 -6.045 -3.102
- D 238 236 3 239 3 -6.174 -1.687 -0.566
- IL 239 239 3 239 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 80 ]
- ML 240 239 3 242 3 -12.038 -0.001 -10.692 -2.720 1.554 -0.706 -1.745
- D 241 239 3 242 3 -6.174 -1.687 -0.566
- IL 242 242 3 242 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 81 ]
- ML 243 242 3 245 3 -12.038 -0.001 -10.692 -0.953 -0.709 1.194 -0.776
- D 244 242 3 245 3 -6.174 -1.687 -0.566
- IL 245 245 3 245 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 82 ]
- ML 246 245 3 248 3 -12.038 -0.001 -10.692 -2.218 0.616 0.805 -0.985
- D 247 245 3 248 3 -6.174 -1.687 -0.566
- IL 248 248 3 248 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 83 ]
- ML 249 248 3 251 3 -12.038 -0.001 -10.692 -2.301 1.670 -5.694 -0.748
- D 250 248 3 251 3 -6.174 -1.687 -0.566
- IL 251 251 3 251 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 84 ]
- ML 252 251 3 254 3 -12.038 -0.001 -10.692 -2.069 0.970 0.594 -1.773
- D 253 251 3 254 3 -6.174 -1.687 -0.566
- IL 254 254 3 254 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 85 ]
- ML 255 254 3 257 3 -12.038 -0.001 -10.692 -1.278 -0.060 1.161 -1.352
- D 256 254 3 257 3 -6.174 -1.687 -0.566
- IL 257 257 3 257 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 86 ]
- ML 258 257 3 260 3 -12.038 -0.001 -10.692 -1.614 0.725 0.689 -1.293
- D 259 257 3 260 3 -6.174 -1.687 -0.566
- IL 260 260 3 260 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 87 ]
- ML 261 260 3 263 3 -12.038 -0.001 -10.692 -2.280 0.002 0.895 -0.100
- D 262 260 3 263 3 -6.174 -1.687 -0.566
- IL 263 263 3 263 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 88 ]
- ML 264 263 3 266 3 -12.038 -0.001 -10.692 -1.864 0.648 1.078 -4.431
- D 265 263 3 266 3 -6.174 -1.687 -0.566
- IL 266 266 3 266 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 89 ]
- ML 267 266 3 269 3 -12.038 -0.001 -10.692 -4.991 1.836 -3.259 -1.770
- D 268 266 3 269 3 -6.174 -1.687 -0.566
- IL 269 269 3 269 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 90 ]
- ML 270 269 3 272 3 -12.038 -2.248 -0.342 1.338 -2.349 -0.204 -1.296
- D 271 269 3 272 3 -6.174 -1.687 -0.566
- IL 272 272 3 272 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 91 ]
- ML 273 272 3 275 3 -9.796 -0.143 -3.424 -3.307 1.818 -4.292 -1.633
- D 274 272 3 275 3 -13.126 -8.639 -0.004
- IL 275 275 3 275 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 92 ]
- ML 276 275 3 278 3 -9.660 -0.006 -8.314 -3.682 1.918 -4.609 -3.302
- D 277 275 3 278 3 -13.160 -8.673 -0.004
- IL 278 278 3 278 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 93 ]
- ML 279 278 3 281 2 * 0.000 1.945 -4.637 -4.343 -4.086
- D 280 278 3 281 2 * 0.000
- IL 281 281 3 281 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 94 ]
- E 282 281 3 -1 0
-//
diff --git a/TRNAinf-bact-c.cm b/TRNAinf-bact-c.cm
deleted file mode 100644
index 09b02b9..0000000
--- a/TRNAinf-bact-c.cm
+++ /dev/null
@@ -1,415 +0,0 @@
-INFERNAL-1 [1.0]
-NAME tRNA1415G-eub
-STATES 298
-NODES 79
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 249
-EFFNSEQ 249.000
-CLEN 93
-BCOM cmbuild --rf --enone TRNAinf-bact-nc.cm trna1415G-bact.sto
-BDATE Sun Feb 8 16:45:45 2009
-CCOM cmcalibrate --exp-hfile cmcalibrate_files/TRNAinf-bact.hfile --exp-sfile cmcalibrate_files/TRNAinf-bact.sfile --exp-qqfile cmcalibrate_files/TRNAinf-bact.qqfile --exp-ffile cmcalibrate_files/TRNAinf-bact.ffile --fil-dfile cmcalibrate_files/TRNAinf-bact.dfile -s 208 TRNAinf-bact-c.cm
-CDATE Sun Feb 8 20:07:08 2009
-NULL 0.000 0.000 0.000 0.000
-PART 1 0 100
-E-LC 0 0.67174 -7.74784 1.35716 1500000 509766 0.002207
-E-GC 0 0.35637 -41.39324 -28.49011 1500000 37244 0.010069
-E-LI 0 0.61266 -8.31345 1.57664 1500000 481577 0.002336
-E-GI 0 0.36329 -38.02444 -25.47379 1500000 35827 0.010467
-E-LV 0 0.87314 -1.12092 4.12302 15000000 109563 0.010268
-E-GV 0 0.34365 -27.90220 -11.38503 15000000 109430 0.003427
-E-LF 0 0.79464 -0.33504 5.42687 15000000 109554 0.010269
-E-GF 0 0.36226 -24.54848 -8.87863 15000000 109476 0.003425
-FT-LC 20 0.99500 10000 1500000 0
- 32.7319 26.005 17.0953 12.7323 11.3108 7.05091 6.41222 6.21019 6.01368 5.84247 5.84247 5.71223 4.23466 3.67566 2.9638 2.91846 1.93825 1.79231 1.79231 5.73661e-06
- 5409.32 4680.94 3822.35 2792.63 2510.55 2231.99 1962.39 1437.16 902.851 761.664 676.616 415.381 313.779 275.658 227.977 186.902 163.285 133.229 123.171 12.3171
-FT-LI 21 0.99500 10000 1500000 0
- 51.2091 36.9391 24.8352 20.0348 18.027 11.3314 10.9201 10.8943 10.8943 10.6111 10.6111 9.15061 7.29256 5.70272 5.70184 5.12687 3.87866 3.61164 3.61164 7.80008e-05 7.82384e-06
- 5409.32 4680.94 3822.35 2792.63 2510.55 2231.99 1962.39 1437.16 902.851 761.664 676.616 415.381 313.779 275.658 227.977 186.902 163.285 133.229 123.171 53.1262 12.3171
-FT-GC 2 0.99500 10000 1500000 1
- 4.6166e-06 3.08769e-07
- 87.4853 9.71507
-FT-GI 2 0.99500 10000 1500000 1
- 8.55844e-06 6.08794e-07
- 87.4853 9.71507
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 4 -4.212 -14.142 -0.360 -2.582
- IL 1 1 2 1 4 -6.557 -8.059 -0.372 -2.231 0.000 0.000 0.000 0.000
- IR 2 2 3 2 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 1 ]
- MR 3 2 3 5 3 -14.024 -0.000 -12.341 1.996 -8.236 -7.705 -8.011
- D 4 2 3 5 3 -12.926 -8.103 -0.005
- IR 5 5 3 5 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 2 ]
- MR 6 5 3 8 3 -14.024 -0.000 -12.341 -8.745 1.998 -9.265 -8.847
- D 7 5 3 8 3 -12.926 -8.103 -0.005
- IR 8 8 3 8 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 3 ]
- MR 9 8 3 11 3 -14.024 -0.000 -12.341 -8.745 1.998 -9.265 -8.847
- D 10 8 3 11 3 -12.926 -0.122 -3.626
- IR 11 11 3 11 3 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000
- [ MATR 4 ]
- MR 12 11 3 14 5 -6.336 -0.034 -12.744 -6.561 -13.848 1.183 -2.858 0.062 -0.868
- D 13 11 3 14 5 -7.629 -0.120 -5.256 -6.686 -4.681
- IR 14 14 3 14 5 -3.975 -0.149 -7.486 -5.654 -6.760 0.000 0.000 0.000 0.000
- [ MATP 5 ]
- MP 15 14 3 19 6 -13.888 -13.828 -0.001 -12.604 -12.884 -13.279 -7.177 -6.400 -7.823 -0.211 -2.016 -7.733 0.101 -3.727 -7.269 3.544 -7.051 -0.067 0.057 -7.294 -5.262 -6.681
- ML 16 14 3 19 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 17 14 3 19 6 -9.075 -7.804 -0.250 -7.782 -2.916 -5.996 -0.624 -0.170 -1.457 1.069
- D 18 14 3 19 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 19 19 5 19 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 20 20 6 20 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 6 ]
- MP 21 20 6 25 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -7.707 -6.730 -8.656 -0.676 -9.309 -8.526 2.459 -6.587 -7.835 3.054 -3.164 -1.200 -0.572 -7.876 -1.764 -6.110
- ML 22 20 6 25 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 23 20 6 25 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 24 20 6 25 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 25 25 5 25 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 26 26 6 26 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 7 ]
- MP 27 26 6 31 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -9.405 -8.330 -10.166 1.466 -9.625 -10.198 2.431 -9.525 -9.576 2.496 -9.222 -0.655 0.578 -9.614 -4.061 -8.325
- ML 28 26 6 31 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 29 26 6 31 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 30 26 6 31 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 31 31 5 31 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 32 32 6 32 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 8 ]
- MP 33 32 6 37 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -10.770 -9.556 -11.165 0.222 -9.670 -11.548 2.247 -10.324 -11.071 2.940 -10.626 -2.006 0.893 -11.102 -1.755 -9.040
- ML 34 32 6 37 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 35 32 6 37 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 36 32 6 37 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 37 37 5 37 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 38 38 6 38 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 9 ]
- MP 39 38 6 43 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -7.643 -3.651 -8.602 1.918 -9.439 -8.444 2.316 -5.189 -7.760 2.497 -7.445 -1.414 -0.536 -7.801 -1.359 -6.988
- ML 40 38 6 43 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 41 38 6 43 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 42 38 6 43 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 43 43 5 43 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 44 44 6 44 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 10 ]
- MP 45 44 6 49 6 -8.229 -13.842 -0.005 -12.619 -12.899 -13.294 -7.105 -7.196 -7.296 1.716 -5.947 -7.838 1.864 -3.826 -7.537 1.967 -7.482 -4.430 2.052 -4.132 -0.368 -5.943
- ML 46 44 6 49 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 47 44 6 49 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 48 44 6 49 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 49 49 5 49 6 -3.498 -3.761 -0.352 -5.416 -6.192 -5.853 0.000 0.000 0.000 0.000
- IR 50 50 6 50 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 11 ]
- MP 51 50 6 55 4 -13.101 -13.308 -0.006 -8.103 -7.894 -6.882 -8.838 2.191 -9.502 -8.695 -0.588 -8.333 -8.014 2.763 -7.697 -0.800 1.741 -8.056 -5.405 -7.203
- ML 52 50 6 55 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 53 50 6 55 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 54 50 6 55 4 -4.568 -4.250 -2.265 -0.520
- IL 55 55 5 55 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 56 56 6 56 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 12 ]
- ML 57 56 6 59 3 -14.007 -0.005 -8.118 -7.763 -7.499 -4.305 1.978
- D 58 56 6 59 3 -7.779 -0.371 -2.171
- IL 59 59 3 59 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 13 ]
- ML 60 59 3 62 2 -14.659 -0.000 1.348 -2.468 0.202 -3.024
- D 61 59 3 62 2 -8.617 -0.004
- IL 62 62 3 62 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ BIF 14 ]
- B 63 62 3 64 173
- [ BEGL 15 ]
- S 64 63 1 65 1 0.000
- [ BIF 16 ]
- B 65 64 1 66 116
- [ BEGL 17 ]
- S 66 65 1 67 4 -0.001 -12.021 -11.428 -12.068
- [ MATP 18 ]
- MP 67 66 1 71 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -11.606 -6.912 -12.457 -2.375 -11.305 -7.102 0.280 -10.922 -8.071 3.771 -7.538 -0.565 -2.126 -7.218 -7.324 -9.448
- ML 68 66 1 71 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 69 66 1 71 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 70 66 1 71 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 71 71 5 71 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 72 72 6 72 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 19 ]
- MP 73 72 6 77 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -9.240 -9.577 -7.207 -0.703 -6.953 -7.803 3.525 -7.976 -11.664 -2.259 -4.137 -7.040 1.735 -10.062 -2.061 -8.224
- ML 74 72 6 77 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 75 72 6 77 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 76 72 6 77 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 77 77 5 77 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 78 78 6 78 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 20 ]
- MP 79 78 6 83 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -7.115 -7.535 -7.452 -0.649 -6.118 -4.162 1.464 -7.553 -2.412 2.100 -7.790 -4.927 2.952 -7.255 -2.078 -6.220
- ML 80 78 6 83 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 81 78 6 83 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 82 78 6 83 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 83 83 5 83 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 84 84 6 84 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 21 ]
- MP 85 84 6 89 4 -13.101 -13.308 -0.001 -11.722 1.474 -8.224 -7.865 -1.561 -3.150 -8.836 3.078 -3.335 1.394 -6.594 -4.545 -6.996 -1.665 -7.647 -0.097 -1.864
- ML 86 84 6 89 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 87 84 6 89 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 88 84 6 89 4 -4.568 -4.250 -2.265 -0.520
- IL 89 89 5 89 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 90 90 6 90 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 22 ]
- ML 91 90 6 93 3 -14.012 -0.000 -12.666 1.969 -5.517 -5.623 -4.509
- D 92 90 6 93 3 -6.174 -1.687 -0.566
- IL 93 93 3 93 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 23 ]
- ML 94 93 3 96 3 -14.012 -0.028 -5.681 -0.099 -3.932 1.558 -4.175
- D 95 93 3 96 3 -6.174 -1.687 -0.566
- IL 96 96 3 96 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 24 ]
- ML 97 96 3 99 3 -13.984 -0.616 -1.525 -2.120 0.318 -3.020 1.263
- D 98 96 3 99 3 -9.856 -5.369 -0.037
- IL 99 99 3 99 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 25 ]
- ML 100 99 3 102 3 -2.893 -0.209 -12.022 -1.849 -0.318 -6.368 1.540
- D 101 99 3 102 3 -13.963 -0.005 -8.354
- IL 102 102 3 102 3 -3.488 -0.141 -8.069 0.000 0.000 0.000 0.000
- [ MATL 26 ]
- ML 103 102 3 105 3 -14.012 -0.000 -12.666 -7.659 -9.041 1.985 -4.890
- D 104 102 3 105 3 -6.174 -1.687 -0.566
- IL 105 105 3 105 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 27 ]
- ML 106 105 3 108 3 -14.012 -0.000 -12.666 -9.488 -10.488 1.999 -10.286
- D 107 105 3 108 3 -6.174 -1.687 -0.566
- IL 108 108 3 108 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 28 ]
- ML 109 108 3 111 3 -0.920 -1.085 -12.666 -1.932 -0.228 -2.234 1.418
- D 110 108 3 111 3 -6.174 -1.687 -0.566
- IL 111 111 3 111 3 -2.288 -0.332 -10.826 0.000 0.000 0.000 0.000
- [ MATL 29 ]
- ML 112 111 3 114 2 * 0.000 1.778 -6.312 -0.996 -4.154
- D 113 111 3 114 2 * 0.000
- IL 114 114 3 114 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 30 ]
- E 115 114 3 -1 0
- [ BEGR 31 ]
- S 116 65 1 117 3 -14.012 -0.017 -6.409
- IL 117 117 2 117 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 32 ]
- ML 118 117 2 120 5 -12.931 -0.001 -12.746 -12.959 -13.850 1.154 -3.089 0.613 -2.969
- D 119 117 2 120 5 -7.281 -0.129 -6.542 -4.917 -4.829
- IL 120 120 3 120 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 33 ]
- MP 121 120 3 125 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -7.037 -7.238 -7.181 1.483 -3.802 -7.756 2.890 -3.509 -2.786 0.308 -7.454 -0.163 1.498 -3.576 -1.631 -3.419
- ML 122 120 3 125 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 123 120 3 125 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 124 120 3 125 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 125 125 5 125 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 126 126 6 126 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 34 ]
- MP 127 126 6 131 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -7.562 -7.728 -7.698 1.296 -6.285 -8.282 2.986 -7.700 -8.021 0.253 -7.975 -0.964 1.796 -7.531 -2.098 -2.634
- ML 128 126 6 131 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 129 126 6 131 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 130 126 6 131 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 131 131 5 131 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 132 132 6 132 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 35 ]
- MP 133 132 6 137 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -3.770 -7.034 -8.756 1.366 -8.689 -8.741 1.613 -8.338 -8.095 2.514 -7.814 -3.330 2.142 -8.082 -5.249 -7.171
- ML 134 132 6 137 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 135 132 6 137 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 136 132 6 137 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 137 137 5 137 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 138 138 6 138 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 36 ]
- MP 139 138 6 143 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -12.633 -9.383 -12.525 -2.043 -11.426 -10.132 1.965 -11.177 -10.560 3.509 -10.096 -1.569 -5.642 -10.042 -7.160 -3.277
- ML 140 138 6 143 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 141 138 6 143 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 142 138 6 143 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 143 143 5 143 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 144 144 6 144 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 37 ]
- MP 145 144 6 149 4 -13.101 -13.308 -0.001 -11.722 -9.123 -2.953 -9.846 2.544 -9.260 -9.919 2.508 -9.301 -9.311 1.305 -8.992 -3.043 0.719 -9.306 -3.360 -8.095
- ML 146 144 6 149 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 147 144 6 149 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 148 144 6 149 4 -4.568 -4.250 -2.265 -0.520
- IL 149 149 5 149 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 150 150 6 150 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 38 ]
- ML 151 150 6 153 3 -14.012 -0.000 -12.666 -3.533 1.448 -7.551 0.238
- D 152 150 6 153 3 -6.174 -1.687 -0.566
- IL 153 153 3 153 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 39 ]
- ML 154 153 3 156 3 -14.012 -0.000 -12.666 -8.939 -9.084 -9.393 1.998
- D 155 153 3 156 3 -6.174 -1.687 -0.566
- IL 156 156 3 156 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 40 ]
- ML 157 156 3 159 3 -14.012 -0.000 -12.666 -2.883 -0.034 0.578 0.481
- D 158 156 3 159 3 -6.174 -1.687 -0.566
- IL 159 159 3 159 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 41 ]
- ML 160 159 3 162 3 -14.012 -0.000 -12.666 0.183 -0.085 -0.221 0.089
- D 161 159 3 162 3 -6.174 -1.687 -0.566
- IL 162 162 3 162 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 42 ]
- ML 163 162 3 165 3 -14.012 -0.000 -12.666 0.178 -0.228 -0.328 0.285
- D 164 162 3 165 3 -6.174 -1.687 -0.566
- IL 165 165 3 165 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 43 ]
- ML 166 165 3 168 3 -14.012 -0.000 -12.666 1.722 -9.712 -0.516 -9.399
- D 167 165 3 168 3 -6.174 -1.687 -0.566
- IL 168 168 3 168 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 44 ]
- ML 169 168 3 171 2 * 0.000 1.516 -0.515 -5.325 -1.267
- D 170 168 3 171 2 * 0.000
- IL 171 171 3 171 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 45 ]
- E 172 171 3 -1 0
- [ BEGR 46 ]
- S 173 63 1 174 3 -14.012 -0.000 -12.666
- IL 174 174 2 174 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 47 ]
- ML 175 174 2 177 3 -14.012 -0.347 -2.226 0.255 -0.169 -0.179 0.048
- D 176 174 2 177 3 -6.174 -1.687 -0.566
- IL 177 177 3 177 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 48 ]
- ML 178 177 3 180 2 -5.757 -0.027 -0.282 -3.163 1.294 -0.705
- D 179 177 3 180 2 -11.596 -0.000
- IL 180 180 3 180 2 -4.108 -0.086 0.000 0.000 0.000 0.000
- [ BIF 49 ]
- B 181 180 3 182 238
- [ BEGL 50 ]
- S 182 181 1 183 4 -1.839 -7.503 -11.428 -0.485
- [ MATP 51 ]
- MP 183 182 1 187 6 -12.101 -12.040 -0.003 -10.817 -11.097 -11.492 -5.896 -4.895 -1.135 1.822 -7.689 -6.694 -0.351 -6.364 -6.013 2.709 0.199 0.771 0.011 -6.051 -0.531 -5.246
- ML 184 182 1 187 6 -7.801 -8.147 -2.861 -2.556 -7.997 -0.556 -0.705 1.288 -1.533 -0.738
- MR 185 182 1 187 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 186 182 1 187 6 -17.432 -16.131 -11.928 -12.610 -12.627 -0.001
- IL 187 187 5 187 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 188 188 6 188 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 52 ]
- MP 189 188 6 193 6 -12.101 -12.040 -0.030 -10.817 -11.097 -5.733 -6.042 -5.966 -6.292 0.490 -4.985 -6.803 2.313 -6.238 -6.447 2.197 -2.045 -3.144 2.130 -6.059 -2.718 -4.898
- ML 190 188 6 193 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 191 188 6 193 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 192 188 6 193 6 -17.443 -16.141 -11.938 -12.620 -12.638 -0.001
- IL 193 193 5 193 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 194 194 6 194 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 53 ]
- MP 195 194 6 199 6 -12.074 -12.013 -0.441 -10.790 -11.070 -1.934 -5.425 -5.569 -5.574 0.769 -4.218 -2.004 2.789 -5.599 -5.868 1.249 -2.214 -0.790 1.274 -5.392 0.395 -4.246
- ML 196 194 6 199 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 197 194 6 199 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 198 194 6 199 6 -17.454 -16.152 -11.949 -12.631 -12.648 -0.001
- IL 199 199 5 199 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 200 200 6 200 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 54 ]
- MP 201 200 6 205 6 -11.637 -11.576 -0.549 -10.353 -10.633 -1.669 -1.416 -5.275 -5.261 0.796 -1.392 -5.837 2.611 -5.293 -5.525 1.880 -5.519 -2.505 1.348 -5.069 -0.390 -3.937
- ML 202 200 6 205 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 203 200 6 205 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 204 200 6 205 6 -17.594 -16.292 -12.089 -12.771 -12.789 -0.001
- IL 205 205 5 205 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 206 206 6 206 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 55 ]
- MP 207 206 6 211 6 -11.094 -11.033 -0.509 -9.809 -10.089 -1.763 -4.464 -3.752 -5.033 1.425 -0.401 -5.071 0.164 -4.728 -4.595 2.715 -4.442 1.415 -1.117 -0.314 -0.807 -3.966
- ML 208 206 6 211 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 209 206 6 211 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 210 206 6 211 6 -17.708 -16.406 -12.203 -12.885 -12.903 -0.001
- IL 211 211 5 211 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 212 212 6 212 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 56 ]
- MP 213 212 6 217 6 -10.592 -10.531 -0.786 -9.307 -9.587 -1.266 -4.520 -3.607 -5.395 1.492 -5.866 -5.313 1.117 -4.970 -0.766 2.781 -4.391 -1.218 -0.687 -4.663 1.092 -3.899
- ML 214 212 6 217 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 215 212 6 217 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 216 212 6 217 6 -17.776 -16.475 -12.272 -12.954 -12.971 -0.001
- IL 217 217 5 217 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 218 218 6 218 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 57 ]
- MP 219 218 6 223 4 -8.365 -0.471 -1.902 -6.986 -3.687 -4.181 -4.019 0.126 -2.770 -4.697 2.468 -4.147 -4.181 -0.010 -4.393 -1.619 2.199 -3.893 0.852 0.077
- ML 220 218 6 223 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 221 218 6 223 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 222 218 6 223 4 -13.264 -4.552 -2.325 -0.400
- IL 223 223 5 223 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 224 224 6 224 3 -4.956 -0.055 -7.657 0.000 0.000 0.000 0.000
- [ MATL 58 ]
- ML 225 224 6 227 3 -12.130 -0.001 -10.784 -1.552 -1.933 0.893 0.623
- D 226 224 6 227 3 -14.977 -10.490 -0.001
- IL 227 227 3 227 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 59 ]
- ML 228 227 3 230 3 -12.130 -0.001 -10.784 -0.009 -0.075 -3.569 0.980
- D 229 227 3 230 3 -14.977 -10.490 -0.001
- IL 230 230 3 230 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 60 ]
- ML 231 230 3 233 3 -4.478 -0.309 -2.759 1.306 -0.395 -2.943 -0.652
- D 232 230 3 233 3 -14.977 -10.490 -0.001
- IL 233 233 3 233 3 -2.958 -0.232 -5.659 0.000 0.000 0.000 0.000
- [ MATL 61 ]
- ML 234 233 3 236 2 * 0.000 0.963 -0.810 -0.300 -0.582
- D 235 233 3 236 2 * 0.000
- IL 236 236 3 236 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 62 ]
- E 237 236 3 -1 0
- [ BEGR 63 ]
- S 238 181 1 239 3 -14.012 -0.134 -3.491
- IL 239 239 2 239 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 64 ]
- ML 240 239 2 242 3 -0.527 -1.710 -12.532 -1.166 -3.477 1.564 -0.980
- D 241 239 2 242 3 -11.963 -0.018 -6.355
- IL 242 242 3 242 3 -8.059 -0.006 -10.759 0.000 0.000 0.000 0.000
- [ MATL 65 ]
- ML 243 242 3 245 5 -12.948 -0.001 -12.763 -12.975 -13.867 -4.810 1.566 -3.513 -0.127
- D 244 242 3 245 5 -4.959 -0.803 -4.221 -2.596 -2.508
- IL 245 245 3 245 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 66 ]
- MP 246 245 3 250 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -7.688 -6.681 -8.645 1.666 -9.459 -8.489 0.368 -8.152 -7.805 2.786 -7.490 2.090 -2.079 -7.846 -5.378 -3.561
- ML 247 245 3 250 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 248 245 3 250 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 249 245 3 250 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 250 250 5 250 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 251 251 6 251 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 67 ]
- MP 252 251 6 256 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -7.164 -3.930 -7.425 1.355 -6.165 -3.575 2.544 -7.386 -7.552 1.564 -7.449 0.499 1.030 -7.159 -0.127 -3.582
- ML 253 251 6 256 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 254 251 6 256 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 255 251 6 256 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 256 256 5 256 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 257 257 6 257 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 68 ]
- MP 258 257 6 262 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -7.629 -3.082 -8.585 1.776 -9.406 -8.429 1.804 -4.067 -7.746 2.629 -7.432 -0.249 0.686 -7.786 -2.088 -6.973
- ML 259 257 6 262 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 260 257 6 262 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 261 257 6 262 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 262 262 5 262 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 263 263 6 263 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 69 ]
- MP 264 263 6 268 6 -13.903 -13.842 -0.001 -12.619 -12.899 -13.294 -11.641 -3.835 -12.487 1.001 -11.420 -7.137 -3.552 -10.940 -8.101 3.781 -7.570 -4.706 -5.223 -7.252 -7.438 -9.487
- ML 265 263 6 268 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 266 263 6 268 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 267 263 6 268 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 268 268 5 268 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 269 269 6 269 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 70 ]
- MP 270 269 6 274 4 -13.101 -13.308 -0.001 -11.722 -11.596 -6.880 -12.474 -2.533 -11.371 -7.068 -5.211 -10.924 -8.038 3.960 -4.139 -3.060 -5.172 -7.185 -7.405 -9.447
- ML 271 269 6 274 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 272 269 6 274 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 273 269 6 274 4 -4.568 -4.250 -2.265 -0.520
- IL 274 274 5 274 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 275 275 6 275 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 71 ]
- ML 276 275 6 278 3 -14.012 -0.002 -9.561 -8.939 -9.084 -9.393 1.998
- D 277 275 6 278 3 -6.174 -1.687 -0.566
- IL 278 278 3 278 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 72 ]
- ML 279 278 3 281 3 -14.010 -0.000 -12.664 -8.937 -9.081 -9.390 1.998
- D 280 278 3 281 3 -6.953 -0.742 -1.344
- IL 281 281 3 281 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 73 ]
- ML 282 281 3 284 3 -14.012 -0.000 -12.666 -9.158 1.998 -9.627 -9.349
- D 283 281 3 284 3 -6.174 -1.687 -0.566
- IL 284 284 3 284 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 74 ]
- ML 285 284 3 287 3 -14.012 -0.000 -12.666 0.321 -8.969 1.457 -8.325
- D 286 284 3 287 3 -6.174 -1.687 -0.566
- IL 287 287 3 287 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 75 ]
- ML 288 287 3 290 3 -14.012 -0.002 -9.561 1.997 -8.633 -8.089 -8.568
- D 289 287 3 290 3 -6.174 -1.687 -0.566
- IL 290 290 3 290 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 76 ]
- ML 291 290 3 293 3 -14.010 -0.013 -6.815 0.625 -2.188 0.582 -0.432
- D 292 290 3 293 3 -6.953 -0.742 -1.344
- IL 293 293 3 293 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 77 ]
- ML 294 293 3 296 2 * 0.000 -5.368 -0.963 -7.616 1.790
- D 295 293 3 296 2 * 0.000
- IL 296 296 3 296 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 78 ]
- E 297 296 3 -1 0
-//
diff --git a/TRNAinf-bact-ns-c.cm b/TRNAinf-bact-ns-c.cm
deleted file mode 100644
index 415ea5f..0000000
--- a/TRNAinf-bact-ns-c.cm
+++ /dev/null
@@ -1,416 +0,0 @@
-INFERNAL-1 [1.0]
-NAME tRNA1415G-bact-nostruct
-STATES 283
-NODES 95
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 249
-EFFNSEQ 249.000
-CLEN 93
-BCOM cmbuild --rf --enone -F TRNAinf-bact-ns-nc.cm trna1415G-bact-ns.sto
-BDATE Sun Feb 8 19:01:31 2009
-CCOM cmcalibrate --exp-hfile cmcalibrate_files/TRNAinf-bact-ns.hfile --exp-sfile cmcalibrate_files/TRNAinf-bact-ns.sfile --exp-qqfile cmcalibrate_files/TRNAinf-bact-ns.qqfile --exp-ffile cmcalibrate_files/TRNAinf-bact-ns.ffile --fil-dfile cmcalibrate_files/TRNAinf-bact-ns.dfile -s 208 TRNAinf-bact-ns-c.cm
-CDATE Sun Feb 8 20:09:03 2009
-NULL 0.000 0.000 0.000 0.000
-PART 1 0 100
-E-LC 0 0.70264 -10.82259 -1.38740 1500000 851757 0.001321
-E-GC 0 0.28941 -34.21287 -19.62910 1500000 25529 0.014689
-E-LI 0 0.67728 -10.43186 -0.86376 1500000 733642 0.001533
-E-GI 0 0.29780 -31.78663 -17.63305 1500000 25383 0.014774
-E-LV 0 0.73241 -3.92074 2.34835 15000000 110978 0.010137
-E-GV 0 0.33174 -29.02309 -11.88229 15000000 110546 0.003392
-E-LF 0 0.69034 -1.32503 5.32787 15000000 111111 0.010125
-E-GF 0 0.36826 -24.79156 -9.35237 15000000 110472 0.003395
-FT-LC 35 0.99500 10000 1500000 0
- 6755.17 6755.17 6589.94 6243.09 5097.19 5097.19 4121.57 4034.91 3448.66 2502.68 2486.75 2348.89 2318.76 2123.49 1842.51 1728.92 1523.79 1407.62 1221.04 1108.92 998.952 899.061 808.255 786.504 786.504 785.304 16.4974 15.8164 7.60229 6.67111 4.89523 4.3201 2.60093 2.07945 1.74401
- 5628.99 4954.11 4027.38 3613.71 3045.09 2574.82 2273.95 2046.02 1789.56 1395.78 1223.35 1087.14 947.594 784.286 454.282 405.935 363.987 315.519 283.697 250.72 223.883 199.504 173.536 154.214 131.029 130.366 75.478 67.3522 55.5144 42.7049 35.4429 25.3934 17.9935 16.1119 13.0366
-FT-LI 37 0.99500 10000 1500000 0
- 8453.39 6879.88 5537.3 5373.85 4651.59 4430.14 3979 3940.88 3379 2957.99 2659.64 2485.79 2426.45 1870.07 1581.5 1505.05 1435.57 1342.59 1281.56 1173.99 1145.21 1135.67 748.061 721.295 657.544 653.259 24.8213 17.4623 15.6529 9.27504 8.26042 6.04424 5.52297 4.43905 3.59112 2.76614 2.34579
- 5628.99 4954.11 4027.38 3613.71 3045.09 2574.82 2273.95 2046.02 1789.56 1395.78 1223.35 1087.14 947.594 784.286 454.282 405.935 363.987 315.519 283.697 250.72 223.883 199.504 173.536 154.214 131.029 130.366 115.002 85.4056 72.3656 47.8901 38.3449 28.8327 25.3934 18.459 15.5223 13.5767 13.0366
-FT-GC 1 0.99500 10000 1500000 1
- 0.0401648
- 10.6271
-FT-GI 1 0.99500 10000 1500000 1
- 0.0373644
- 10.6271
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 4 -4.210 -13.308 -0.097 -6.552
- IL 1 1 2 1 4 -5.839 -6.522 -0.044 -9.007 0.000 0.000 0.000 0.000
- IR 2 2 3 2 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 1 ]
- ML 3 2 3 5 3 -13.997 -0.000 -12.651 -2.433 -1.567 1.688 -1.970
- D 4 2 3 5 3 -9.048 -0.143 -3.439
- IL 5 5 3 5 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 2 ]
- ML 6 5 3 8 3 -14.012 -0.000 -12.666 -2.883 0.487 1.147 -2.015
- D 7 5 3 8 3 -6.174 -1.687 -0.566
- IL 8 8 3 8 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 3 ]
- ML 9 8 3 11 3 -14.012 -0.000 -12.666 -0.516 0.434 0.637 -1.343
- D 10 8 3 11 3 -6.174 -1.687 -0.566
- IL 11 11 3 11 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 4 ]
- ML 12 11 3 14 3 -14.012 -0.000 -12.666 -1.720 0.238 0.982 -0.885
- D 13 11 3 14 3 -6.174 -1.687 -0.566
- IL 14 14 3 14 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 5 ]
- ML 15 14 3 17 3 -14.012 -0.000 -12.666 -0.052 0.365 0.554 -1.840
- D 16 14 3 17 3 -6.174 -1.687 -0.566
- IL 17 17 3 17 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 6 ]
- ML 18 17 3 20 3 -8.201 -0.005 -12.666 -0.230 -0.137 0.012 0.298
- D 19 17 3 20 3 -6.174 -1.687 -0.566
- IL 20 20 3 20 3 -2.039 -0.476 -4.739 0.000 0.000 0.000 0.000
- [ MATL 7 ]
- ML 21 20 3 23 3 -14.012 -0.005 -8.162 0.201 -2.565 0.863 -0.212
- D 22 20 3 23 3 -6.174 -1.687 -0.566
- IL 23 23 3 23 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 8 ]
- ML 24 23 3 26 3 -14.007 -0.005 -8.118 -7.763 -7.499 -4.305 1.978
- D 25 23 3 26 3 -7.779 -0.371 -2.171
- IL 26 26 3 26 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 9 ]
- ML 27 26 3 29 3 -14.007 -0.000 -12.661 1.348 -2.468 0.202 -3.024
- D 28 26 3 29 3 -7.807 -0.363 -2.198
- IL 29 29 3 29 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 10 ]
- ML 30 29 3 32 3 -14.012 -0.000 -12.666 -4.334 -1.630 1.833 -3.960
- D 31 29 3 32 3 -6.174 -1.687 -0.566
- IL 32 32 3 32 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 11 ]
- ML 33 32 3 35 3 -14.012 -0.000 -12.666 -2.529 1.501 -3.830 -0.112
- D 34 32 3 35 3 -6.174 -1.687 -0.566
- IL 35 35 3 35 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 12 ]
- ML 36 35 3 38 3 -14.012 -0.000 -12.666 -2.627 -0.551 0.197 1.007
- D 37 35 3 38 3 -6.174 -1.687 -0.566
- IL 38 38 3 38 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 13 ]
- ML 39 38 3 41 3 -14.012 -0.000 -12.666 -0.336 1.105 -0.569 -1.387
- D 40 38 3 41 3 -6.174 -1.687 -0.566
- IL 41 41 3 41 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 14 ]
- ML 42 41 3 44 3 -14.012 -0.000 -12.666 1.969 -5.517 -5.623 -4.509
- D 43 41 3 44 3 -6.174 -1.687 -0.566
- IL 44 44 3 44 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 15 ]
- ML 45 44 3 47 3 -14.012 -0.028 -5.681 -0.099 -3.932 1.558 -4.175
- D 46 44 3 47 3 -6.174 -1.687 -0.566
- IL 47 47 3 47 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 16 ]
- ML 48 47 3 50 3 -13.984 -0.616 -1.525 -2.120 0.318 -3.020 1.263
- D 49 47 3 50 3 -9.856 -5.369 -0.037
- IL 50 50 3 50 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 17 ]
- ML 51 50 3 53 3 -2.893 -0.209 -12.022 -1.849 -0.318 -6.368 1.540
- D 52 50 3 53 3 -13.963 -0.005 -8.354
- IL 53 53 3 53 3 -3.488 -0.141 -8.069 0.000 0.000 0.000 0.000
- [ MATL 18 ]
- ML 54 53 3 56 3 -14.012 -0.000 -12.666 -7.659 -9.041 1.985 -4.890
- D 55 53 3 56 3 -6.174 -1.687 -0.566
- IL 56 56 3 56 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 19 ]
- ML 57 56 3 59 3 -14.012 -0.000 -12.666 -9.488 -10.488 1.999 -10.286
- D 58 56 3 59 3 -6.174 -1.687 -0.566
- IL 59 59 3 59 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 20 ]
- ML 60 59 3 62 3 -0.920 -1.085 -12.666 -1.932 -0.228 -2.234 1.418
- D 61 59 3 62 3 -6.174 -1.687 -0.566
- IL 62 62 3 62 3 -2.288 -0.332 -10.826 0.000 0.000 0.000 0.000
- [ MATL 21 ]
- ML 63 62 3 65 3 -14.012 -0.000 -12.666 1.778 -6.312 -0.996 -4.154
- D 64 62 3 65 3 -6.174 -1.687 -0.566
- IL 65 65 3 65 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 22 ]
- ML 66 65 3 68 3 -14.012 -0.000 -12.666 0.495 -7.283 1.268 -2.501
- D 67 65 3 68 3 -6.174 -1.687 -0.566
- IL 68 68 3 68 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 23 ]
- ML 69 68 3 71 3 -14.012 -0.000 -12.666 1.008 0.156 -0.487 -2.631
- D 70 68 3 71 3 -6.174 -1.687 -0.566
- IL 71 71 3 71 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 24 ]
- ML 72 71 3 74 3 -14.012 -0.000 -12.666 -0.212 -4.233 1.545 -2.604
- D 73 71 3 74 3 -6.174 -1.687 -0.566
- IL 74 74 3 74 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 25 ]
- ML 75 74 3 77 3 -14.012 -0.017 -6.409 -3.990 1.768 -1.650 -2.228
- D 76 74 3 77 3 -6.174 -1.687 -0.566
- IL 77 77 3 77 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 26 ]
- ML 78 77 3 80 3 -13.995 -0.000 -12.649 1.154 -3.089 0.613 -2.969
- D 79 77 3 80 3 -9.193 -0.128 -3.584
- IL 80 80 3 80 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 27 ]
- ML 81 80 3 83 3 -14.012 -0.000 -12.666 -0.462 0.948 -0.818 -0.362
- D 82 80 3 83 3 -6.174 -1.687 -0.566
- IL 83 83 3 83 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 28 ]
- ML 84 83 3 86 3 -14.012 -0.000 -12.666 -0.660 1.007 -1.254 -0.091
- D 85 83 3 86 3 -6.174 -1.687 -0.566
- IL 86 86 3 86 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 29 ]
- ML 87 86 3 89 3 -14.012 -0.000 -12.666 -0.595 -0.363 0.514 0.180
- D 88 86 3 89 3 -6.174 -1.687 -0.566
- IL 89 89 3 89 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 30 ]
- ML 90 89 3 92 3 -14.012 -0.000 -12.666 -3.824 -0.081 1.560 -4.819
- D 91 89 3 92 3 -6.174 -1.687 -0.566
- IL 92 92 3 92 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 31 ]
- ML 93 92 3 95 3 -14.012 -0.000 -12.666 0.588 0.514 -0.671 -1.181
- D 94 92 3 95 3 -6.174 -1.687 -0.566
- IL 95 95 3 95 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 32 ]
- ML 96 95 3 98 3 -14.012 -0.000 -12.666 -3.533 1.448 -7.551 0.238
- D 97 95 3 98 3 -6.174 -1.687 -0.566
- IL 98 98 3 98 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 33 ]
- ML 99 98 3 101 3 -14.012 -0.000 -12.666 -8.939 -9.084 -9.393 1.998
- D 100 98 3 101 3 -6.174 -1.687 -0.566
- IL 101 101 3 101 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 34 ]
- ML 102 101 3 104 3 -14.012 -0.000 -12.666 -2.883 -0.034 0.578 0.481
- D 103 101 3 104 3 -6.174 -1.687 -0.566
- IL 104 104 3 104 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 35 ]
- ML 105 104 3 107 3 -14.012 -0.000 -12.666 0.183 -0.085 -0.221 0.089
- D 106 104 3 107 3 -6.174 -1.687 -0.566
- IL 107 107 3 107 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 36 ]
- ML 108 107 3 110 3 -14.012 -0.000 -12.666 0.178 -0.228 -0.328 0.285
- D 109 107 3 110 3 -6.174 -1.687 -0.566
- IL 110 110 3 110 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 37 ]
- ML 111 110 3 113 3 -14.012 -0.000 -12.666 1.722 -9.712 -0.516 -9.399
- D 112 110 3 113 3 -6.174 -1.687 -0.566
- IL 113 113 3 113 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 38 ]
- ML 114 113 3 116 3 -14.012 -0.000 -12.666 1.516 -0.515 -5.325 -1.267
- D 115 113 3 116 3 -6.174 -1.687 -0.566
- IL 116 116 3 116 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 39 ]
- ML 117 116 3 119 3 -14.012 -0.000 -12.666 -1.242 -0.648 0.530 0.581
- D 118 116 3 119 3 -6.174 -1.687 -0.566
- IL 119 119 3 119 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 40 ]
- ML 120 119 3 122 3 -14.012 -0.000 -12.666 -7.294 1.520 -0.061 -2.575
- D 121 119 3 122 3 -6.174 -1.687 -0.566
- IL 122 122 3 122 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 41 ]
- ML 123 122 3 125 3 -14.012 -0.000 -12.666 0.203 0.502 -0.368 -0.603
- D 124 122 3 125 3 -6.174 -1.687 -0.566
- IL 125 125 3 125 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 42 ]
- ML 126 125 3 128 3 -14.012 -0.000 -12.666 -0.230 -1.753 1.041 -0.333
- D 127 125 3 128 3 -6.174 -1.687 -0.566
- IL 128 128 3 128 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 43 ]
- ML 129 128 3 131 3 -14.012 -0.000 -12.666 -0.471 -1.613 0.970 -0.011
- D 130 128 3 131 3 -6.174 -1.687 -0.566
- IL 131 131 3 131 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 44 ]
- ML 132 131 3 134 3 -14.012 -0.347 -2.226 0.255 -0.169 -0.179 0.048
- D 133 131 3 134 3 -6.174 -1.687 -0.566
- IL 134 134 3 134 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 45 ]
- ML 135 134 3 137 3 -5.759 -4.024 -0.120 -0.282 -3.163 1.294 -0.705
- D 136 134 3 137 3 -13.215 -0.008 -7.607
- IL 137 137 3 137 3 -3.129 -0.204 -5.829 0.000 0.000 0.000 0.000
- [ MATL 46 ]
- ML 138 137 3 140 3 -12.158 -0.029 -5.654 -0.068 -1.916 1.228 -1.187
- D 139 137 3 140 3 -14.967 -10.480 -0.001
- IL 140 140 3 140 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 47 ]
- ML 141 140 3 143 3 -12.130 -0.030 -5.608 -1.425 0.318 0.352 0.144
- D 142 140 3 143 3 -14.977 -10.490 -0.001
- IL 143 143 3 143 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 48 ]
- ML 144 143 3 146 3 -12.101 -0.481 -1.820 -1.125 0.931 -0.271 -0.312
- D 145 143 3 146 3 -14.988 -10.501 -0.001
- IL 146 146 3 146 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 49 ]
- ML 147 146 3 149 3 -11.622 -0.623 -1.513 -0.750 0.772 0.093 -0.664
- D 148 146 3 149 3 -15.128 -10.641 -0.001
- IL 149 149 3 149 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 50 ]
- ML 150 149 3 152 3 -11.001 -0.615 -1.529 -0.778 -1.016 1.291 -1.072
- D 151 149 3 152 3 -15.242 -10.755 -0.001
- IL 152 152 3 152 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 51 ]
- ML 153 152 3 155 3 -10.390 -1.083 -0.923 -0.617 -0.560 0.837 -0.179
- D 154 152 3 155 3 -15.311 -10.824 -0.001
- IL 155 155 3 155 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 52 ]
- ML 156 155 3 158 3 -9.315 -0.008 -7.969 -1.416 0.193 -2.236 1.183
- D 157 155 3 158 3 -15.376 -2.046 -0.400
- IL 158 158 3 158 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 53 ]
- ML 159 158 3 161 3 -12.130 -0.001 -10.784 -1.552 -1.933 0.893 0.623
- D 160 158 3 161 3 -14.977 -10.490 -0.001
- IL 161 161 3 161 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 54 ]
- ML 162 161 3 164 3 -12.130 -0.001 -10.784 -0.009 -0.075 -3.569 0.980
- D 163 161 3 164 3 -14.977 -10.490 -0.001
- IL 164 164 3 164 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 55 ]
- ML 165 164 3 167 3 -4.478 -0.309 -2.759 1.306 -0.395 -2.943 -0.652
- D 166 164 3 167 3 -14.977 -10.490 -0.001
- IL 167 167 3 167 3 -2.958 -0.232 -5.659 0.000 0.000 0.000 0.000
- [ MATL 56 ]
- ML 168 167 3 170 3 -1.768 -4.343 -0.606 0.963 -0.810 -0.300 -0.582
- D 169 167 3 170 3 -15.054 -10.567 -0.001
- IL 170 170 3 170 3 -4.956 -1.278 -0.848 0.000 0.000 0.000 0.000
- [ MATL 57 ]
- ML 171 170 3 173 3 -9.315 -0.008 -7.969 0.011 -2.096 1.092 -0.676
- D 172 170 3 173 3 -15.376 -4.479 -0.066
- IL 173 173 3 173 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 58 ]
- ML 174 173 3 176 3 -10.390 -0.004 -9.044 -1.125 0.661 0.378 -0.598
- D 175 173 3 176 3 -15.311 -4.409 -0.070
- IL 176 176 3 176 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 59 ]
- ML 177 176 3 179 3 -11.001 -0.002 -9.655 -1.259 0.839 -1.192 0.438
- D 178 176 3 179 3 -15.242 -3.707 -0.115
- IL 179 179 3 179 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 60 ]
- ML 180 179 3 182 3 -11.622 -0.002 -10.276 -0.552 0.104 0.819 -1.061
- D 181 179 3 182 3 -15.128 -3.421 -0.141
- IL 182 182 3 182 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 61 ]
- ML 183 182 3 185 3 -12.101 -0.001 -10.755 -1.133 -0.519 1.185 -0.806
- D 184 182 3 185 3 -14.988 -6.958 -0.012
- IL 185 185 3 185 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 62 ]
- ML 186 185 3 188 3 -12.130 -0.001 -10.784 0.145 0.288 0.381 -1.430
- D 187 185 3 188 3 -14.977 -10.490 -0.001
- IL 188 188 3 188 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 63 ]
- ML 189 188 3 191 3 -12.130 -0.573 -1.609 -1.703 0.654 -0.301 0.387
- D 190 188 3 191 3 -14.977 -0.002 -9.369
- IL 191 191 3 191 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 64 ]
- ML 192 191 3 194 3 -0.527 -1.710 -12.532 -1.166 -3.477 1.564 -0.980
- D 193 191 3 194 3 -11.963 -0.018 -6.355
- IL 194 194 3 194 3 -8.059 -0.006 -10.759 0.000 0.000 0.000 0.000
- [ MATL 65 ]
- ML 195 194 3 197 3 -14.012 -0.000 -12.666 -4.810 1.566 -3.513 -0.127
- D 196 194 3 197 3 -6.174 -1.687 -0.566
- IL 197 197 3 197 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 66 ]
- ML 198 197 3 200 3 -14.012 -0.000 -12.666 -0.392 -1.681 1.513 -3.788
- D 199 197 3 200 3 -6.174 -1.687 -0.566
- IL 200 200 3 200 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 67 ]
- ML 201 200 3 203 3 -14.012 -0.000 -12.666 -0.577 0.585 0.144 -0.465
- D 202 200 3 203 3 -6.174 -1.687 -0.566
- IL 203 203 3 203 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 68 ]
- ML 204 203 3 206 3 -14.012 -0.000 -12.666 -0.179 -0.131 0.789 -1.071
- D 205 203 3 206 3 -6.174 -1.687 -0.566
- IL 206 206 3 206 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 69 ]
- ML 207 206 3 209 3 -14.012 -0.000 -12.666 -0.865 -5.525 1.774 -6.634
- D 208 206 3 209 3 -6.174 -1.687 -0.566
- IL 209 209 3 209 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 70 ]
- ML 210 209 3 212 3 -14.012 -0.000 -12.666 -4.940 -9.009 1.986 -8.371
- D 211 209 3 212 3 -6.174 -1.687 -0.566
- IL 212 212 3 212 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 71 ]
- ML 213 212 3 215 3 -14.012 -0.002 -9.561 -8.939 -9.084 -9.393 1.998
- D 214 212 3 215 3 -6.174 -1.687 -0.566
- IL 215 215 3 215 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 72 ]
- ML 216 215 3 218 3 -14.010 -0.000 -12.664 -8.937 -9.081 -9.390 1.998
- D 217 215 3 218 3 -6.953 -0.742 -1.344
- IL 218 218 3 218 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 73 ]
- ML 219 218 3 221 3 -14.012 -0.000 -12.666 -9.158 1.998 -9.627 -9.349
- D 220 218 3 221 3 -6.174 -1.687 -0.566
- IL 221 221 3 221 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 74 ]
- ML 222 221 3 224 3 -14.012 -0.000 -12.666 0.321 -8.969 1.457 -8.325
- D 223 221 3 224 3 -6.174 -1.687 -0.566
- IL 224 224 3 224 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 75 ]
- ML 225 224 3 227 3 -14.012 -0.002 -9.561 1.997 -8.633 -8.089 -8.568
- D 226 224 3 227 3 -6.174 -1.687 -0.566
- IL 227 227 3 227 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 76 ]
- ML 228 227 3 230 3 -14.010 -0.013 -6.815 0.625 -2.188 0.582 -0.432
- D 229 227 3 230 3 -6.953 -0.742 -1.344
- IL 230 230 3 230 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 77 ]
- ML 231 230 3 233 3 -13.999 -0.000 -12.653 -5.368 -0.963 -7.616 1.790
- D 232 230 3 233 3 -8.837 -0.166 -3.228
- IL 233 233 3 233 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 78 ]
- ML 234 233 3 236 3 -14.012 -0.000 -12.666 -6.839 1.969 -5.804 -4.065
- D 235 233 3 236 3 -6.174 -1.687 -0.566
- IL 236 236 3 236 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 79 ]
- ML 237 236 3 239 3 -14.012 -0.000 -12.666 -6.827 1.786 -5.646 -0.936
- D 238 236 3 239 3 -6.174 -1.687 -0.566
- IL 239 239 3 239 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 80 ]
- ML 240 239 3 242 3 -14.012 -0.000 -12.666 -1.244 0.637 -0.073 0.101
- D 241 239 3 242 3 -6.174 -1.687 -0.566
- IL 242 242 3 242 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 81 ]
- ML 243 242 3 245 3 -14.012 -0.000 -12.666 -1.057 -0.352 0.768 0.047
- D 244 242 3 245 3 -6.174 -1.687 -0.566
- IL 245 245 3 245 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 82 ]
- ML 246 245 3 248 3 -14.012 -0.000 -12.666 -3.868 0.774 -1.607 0.921
- D 247 245 3 248 3 -6.174 -1.687 -0.566
- IL 248 248 3 248 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 83 ]
- ML 249 248 3 251 3 -14.012 -0.000 -12.666 -0.210 0.752 -2.586 0.362
- D 250 248 3 251 3 -6.174 -1.687 -0.566
- IL 251 251 3 251 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 84 ]
- ML 252 251 3 254 3 -14.012 -0.000 -12.666 0.041 0.034 0.108 -0.202
- D 253 251 3 254 3 -6.174 -1.687 -0.566
- IL 254 254 3 254 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 85 ]
- ML 255 254 3 257 3 -14.012 -0.000 -12.666 -2.431 0.491 0.458 0.050
- D 256 254 3 257 3 -6.174 -1.687 -0.566
- IL 257 257 3 257 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 86 ]
- ML 258 257 3 260 3 -14.012 -0.000 -12.666 -1.076 0.939 0.318 -1.466
- D 259 257 3 260 3 -6.174 -1.687 -0.566
- IL 260 260 3 260 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 87 ]
- ML 261 260 3 263 3 -14.012 -0.000 -12.666 -1.376 0.490 0.441 -0.230
- D 262 260 3 263 3 -6.174 -1.687 -0.566
- IL 263 263 3 263 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 88 ]
- ML 264 263 3 266 3 -14.012 -0.000 -12.666 -2.471 1.051 0.590 -2.043
- D 265 263 3 266 3 -6.174 -1.687 -0.566
- IL 266 266 3 266 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 89 ]
- ML 267 266 3 269 3 -6.360 -0.037 -6.213 -1.614 1.560 -1.917 -1.121
- D 268 266 3 269 3 -6.174 -1.687 -0.566
- IL 269 269 3 269 3 -2.958 -0.232 -5.659 0.000 0.000 0.000 0.000
- [ MATL 90 ]
- ML 270 269 3 272 3 -13.993 -0.264 -2.580 1.183 -2.858 0.062 -0.868
- D 271 269 3 272 3 -9.368 -4.881 -0.052
- IL 272 272 3 272 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 91 ]
- ML 273 272 3 275 3 -13.729 -0.000 -12.383 -8.745 1.998 -9.265 -8.847
- D 274 272 3 275 3 -12.955 -8.468 -0.004
- IL 275 275 3 275 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 92 ]
- ML 276 275 3 278 3 -13.729 -0.000 -12.383 -8.745 1.998 -9.265 -8.847
- D 277 275 3 278 3 -12.955 -8.468 -0.004
- IL 278 278 3 278 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 93 ]
- ML 279 278 3 281 2 * 0.000 1.996 -8.236 -7.705 -8.011
- D 280 278 3 281 2 * 0.000
- IL 281 281 3 281 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 94 ]
- E 282 281 3 -1 0
-//
diff --git a/TRNAinf-c.cm b/TRNAinf-c.cm
deleted file mode 100644
index 650a664..0000000
--- a/TRNAinf-c.cm
+++ /dev/null
@@ -1,403 +0,0 @@
-INFERNAL-1 [1.0]
-NAME tRNA1415G
-STATES 289
-NODES 76
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 1415
-EFFNSEQ 1415.000
-CLEN 90
-BCOM cmbuild --rf --enone TRNAinf.cm trna1415G.sto
-BDATE Sun Feb 8 16:42:04 2009
-CCOM cmcalibrate --exp-hfile cmcalibrate_files/TRNAinf.hfile --exp-sfile cmcalibrate_files/TRNAinf.sfile --exp-qqfile cmcalibrate_files/TRNAinf.qqfile --exp-ffile cmcalibrate_files/TRNAinf.ffile --fil-dfile cmcalibrate_files/TRNAinf.dfile -s 208 TRNAinf-c.cm
-CDATE Sun Feb 8 20:33:25 2009
-NULL 0.000 0.000 0.000 0.000
-PART 1 0 100
-E-LC 0 0.81122 -5.88321 1.22345 1500000 358822 0.003135
-E-GC 0 0.33246 -23.80877 -11.44044 1500000 22900 0.016376
-E-LI 0 0.70671 -5.92548 2.03289 1500000 311704 0.003609
-E-GI 0 0.33394 -22.04403 -9.70721 1500000 23079 0.016249
-E-LV 0 0.48454 -2.90587 4.34254 49520000 124497 0.029832
-E-GV 0 0.46613 -4.01423 5.85082 49520000 122964 0.010068
-E-LF 0 0.56706 1.45970 7.65260 49520000 124445 0.029845
-E-GF 0 0.47996 -1.92556 7.65678 49520000 123054 0.010061
-FT-LC 44 0.99500 10000 1500000 0
- 5.57553e-07 2.16687e-07 9.52295e-08 6.87971e-08 5.62574e-08 3.03739e-08 1.62142e-08 8.43269e-09 4.94182e-09 2.50475e-09 1.79964e-09 1.42675e-09 9.96612e-10 6.81506e-10 3.97576e-10 3.22726e-10 2.59854e-10 1.68466e-10 7.88383e-11 6.46629e-11 4.16314e-11 2.70369e-11 2.35029e-11 1.63449e-11 1.52098e-11 1.12244e-11 7.31163e-12 7.08743e-12 5.09621e-12 3.35466e-12 2.82909e-12 2.16847e-12 1.73177e-12 1.73143e-12 1.40412e-12 1.2231e-12 1.07635e-12 6.44585e-13 5.14461e-13 4.07215e-13 2.46 [...]
- 1295.06 1146.42 1029.32 880.198 729.98 652.453 581.179 523.002 453.874 400.641 359.72 320.788 287.696 254.674 215.934 190.5 169.786 151.84 136.64 122.129 109.406 97.953 85.9756 77.1065 68.5667 61.2846 52.8836 47.2671 42.0798 34.8192 30.718 26.9313 23.935 21.1517 18.4395 15.8128 14.0694 12.6467 11.2652 10.1486 7.40874 4.12192 1.53321 1.01486
-FT-LI 46 0.99500 10000 1500000 0
- 6.89922e-06 3.06551e-06 1.57661e-06 1.49394e-06 6.04001e-07 4.45103e-07 3.26106e-07 2.32644e-07 1.27765e-07 7.47124e-08 5.71024e-08 5.43605e-08 3.49974e-08 2.45767e-08 1.51903e-08 9.20428e-09 8.18388e-09 7.08352e-09 4.38e-09 3.50359e-09 2.08868e-09 1.80038e-09 1.66966e-09 1.08623e-09 9.40417e-10 6.827e-10 5.77718e-10 5.19002e-10 3.53504e-10 2.6564e-10 2.31906e-10 2.0578e-10 1.64723e-10 1.63555e-10 1.49853e-10 1.33499e-10 1.02591e-10 7.52308e-11 5.35186e-11 4.66752e-11 8.5792e [...]
- 1295.06 1146.42 1029.32 880.198 729.98 652.453 581.179 523.002 453.874 400.641 359.72 320.788 287.696 254.674 215.934 190.5 169.786 151.84 136.64 122.129 109.406 97.953 85.9756 77.1065 68.5667 61.2846 52.8836 47.2671 42.0798 34.8192 30.718 27.3779 24.4148 21.1517 18.4395 15.8038 14.0694 12.6467 11.2652 10.1486 7.40874 4.12192 1.53321 1.35109 [...]
-FT-GC 43 0.99500 10000 1500000 0
- 0.00212796 0.00142322 0.000817938 0.000580356 0.00051241 0.000356634 0.000276589 0.000228027 0.00016251 0.000141133 0.000135338 0.000126419 0.000112685 0.000100657 8.43962e-05 7.21917e-05 6.68068e-05 6.34907e-05 5.27774e-05 3.64472e-05 3.35322e-05 2.05204e-05 1.86393e-05 1.79424e-05 1.61423e-05 1.42128e-05 1.06091e-05 9.80572e-06 9.07388e-06 7.43298e-06 7.25012e-06 6.6924e-06 5.9947e-06 5.67473e-06 5.34725e-06 5.01684e-06 4.21121e-06 3.78684e-06 3.61696e-06 3.12791e-06 6.29451e- [...]
- 1343.7 1191.19 1052.96 928.984 832.29 744.231 628.242 540.351 470.14 397.822 344.97 300.579 269.422 239.073 214.292 187.885 167.845 147.374 129.337 111.35 99.9514 79.6135 70.1724 62.8986 55.4929 49.1711 42.6181 37.6363 33.8649 29.3658 25.1124 22.0708 19.5283 17.5546 15.5547 13.5271 11.8545 10.2895 8.91819 7.84071 2.7162 1.41003 0.784071
-FT-GI 43 0.99500 10000 1500000 0
- 0.00252739 0.00166999 0.00117539 0.000705901 0.000608685 0.0004661 0.000396784 0.000266913 0.000232868 0.000213123 0.00020136 0.000176415 0.000154849 0.000124641 0.000113922 9.76335e-05 8.7818e-05 8.03046e-05 5.66026e-05 5.31501e-05 4.0909e-05 2.82436e-05 2.59482e-05 2.34735e-05 2.21661e-05 1.80153e-05 1.44263e-05 1.3675e-05 1.23961e-05 1.06437e-05 9.5988e-06 9.20984e-06 8.33912e-06 8.05843e-06 7.57917e-06 6.70309e-06 5.78847e-06 5.21944e-06 4.93228e-06 4.56416e-06 7.25273e-08 [...]
- 1343.7 1191.19 1052.96 928.984 832.29 744.231 628.242 540.351 470.14 397.822 344.97 300.579 269.422 239.073 214.292 187.885 167.845 147.374 129.337 111.35 99.9514 79.6135 70.1724 62.8986 55.4929 49.1711 42.6181 37.6363 33.8649 29.3658 25.1124 22.0708 19.5283 17.5546 15.5547 13.5271 11.657 10.2895 8.91819 7.84071 2.7162 1.41003 0.784071
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 4 -5.648 -2.579 -0.319 -6.501
- IL 1 1 2 1 4 -7.563 -1.162 -0.883 -7.444 0.000 0.000 0.000 0.000
- IR 2 2 3 2 3 -0.590 -1.575 -13.397 0.000 0.000 0.000 0.000
- [ MATR 1 ]
- MR 3 2 3 5 5 -8.975 -0.004 -15.243 -10.019 -16.346 1.100 -2.060 -0.143 -0.494
- D 4 2 3 5 5 -9.586 -0.666 -7.212 -1.507 -6.638
- IR 5 5 3 5 5 -3.882 -0.160 -7.394 -5.561 -6.667 0.000 0.000 0.000 0.000
- [ MATP 2 ]
- MP 6 5 3 10 6 -16.368 -16.308 -0.000 -15.084 -15.364 -15.759 -6.525 -3.792 -3.521 1.443 -3.625 -4.783 0.563 -6.319 -9.800 3.068 -7.050 0.583 0.501 -9.830 -6.513 -2.432
- ML 7 5 3 10 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 8 5 3 10 6 -10.281 -9.010 -0.103 -8.988 -4.122 -7.202 -1.923 -0.767 -2.731 1.584
- D 9 5 3 10 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 10 10 5 10 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 11 11 6 11 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 3 ]
- MP 12 11 6 16 6 -16.375 -16.315 -0.000 -15.091 -15.371 -15.766 -9.524 -9.538 -9.735 1.448 -4.029 -5.545 2.274 -4.561 -5.315 2.386 -5.710 -0.523 1.085 -7.201 -2.529 -4.652
- ML 13 11 6 16 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 14 11 6 16 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 15 11 6 16 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 16 16 5 16 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 17 17 6 17 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 4 ]
- MP 18 17 6 22 6 -16.375 -16.315 -0.000 -15.091 -15.371 -15.766 -4.541 -5.056 -5.214 1.547 -4.251 -5.755 2.045 -4.937 -9.891 2.122 -4.743 -0.609 1.740 -6.039 -1.771 -4.282
- ML 19 17 6 22 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 20 17 6 22 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 21 17 6 22 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 22 22 5 22 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 23 23 6 23 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 5 ]
- MP 24 23 6 28 6 -9.206 -16.315 -0.003 -15.091 -10.765 -15.766 -3.151 -4.461 -6.395 1.752 -3.365 -4.465 1.711 -5.161 -6.037 2.234 -5.802 -0.546 1.499 -9.381 -0.431 -5.277
- ML 25 23 6 28 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 26 23 6 28 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 27 23 6 28 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 28 28 5 28 6 -4.405 -4.668 -0.177 -6.323 -7.099 -6.759 0.000 0.000 0.000 0.000
- IR 29 29 6 29 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 6 ]
- MP 30 29 6 34 6 -16.375 -16.314 -0.000 -15.090 -15.370 -15.765 -4.149 -3.448 -5.046 2.230 -3.502 -5.433 1.788 -4.536 -5.589 1.709 -5.018 -0.348 1.398 -7.202 -0.564 -3.383
- ML 31 29 6 34 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 32 29 6 34 6 -7.974 -6.703 -0.602 -6.681 -1.815 -4.895 -0.178 0.869 -1.029 -0.324
- D 33 29 6 34 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 34 34 5 34 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 35 35 6 35 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 7 ]
- MP 36 35 6 40 6 -10.854 -16.315 -0.003 -9.744 -15.371 -15.766 -5.207 -4.740 -5.197 1.814 -3.776 -5.987 1.514 -4.949 -9.895 1.580 -9.857 -1.028 2.158 -4.964 0.081 -1.393
- ML 37 35 6 40 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 38 35 6 40 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 39 35 6 40 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 40 40 5 40 6 -3.427 -3.690 -0.373 -5.345 -6.121 -5.782 0.000 0.000 0.000 0.000
- IR 41 41 6 41 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 8 ]
- MP 42 41 6 46 4 -15.599 -7.747 -0.011 -8.592 -10.069 -5.487 -11.029 2.479 -11.887 -10.869 -0.898 -10.539 -6.032 2.548 -9.870 -0.551 1.705 -10.226 -5.615 -4.833
- ML 43 41 6 46 4 -5.210 -5.393 -0.165 -4.122 -0.855 -1.359 -1.638 1.452
- MR 44 41 6 46 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 45 41 6 46 4 -4.568 -4.250 -2.265 -0.520
- IL 46 46 5 46 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 47 47 6 47 3 -3.769 -0.128 -6.469 0.000 0.000 0.000 0.000
- [ MATL 9 ]
- ML 48 47 6 50 3 -7.229 -0.022 -6.842 -2.035 -4.901 -2.973 1.846
- D 49 47 6 50 3 -9.461 -0.106 -3.853
- IL 50 50 3 50 3 -4.199 -0.094 -6.899 0.000 0.000 0.000 0.000
- [ MATL 10 ]
- ML 51 50 3 53 2 -6.781 -0.013 1.370 -2.907 0.244 -3.366
- D 52 50 3 53 2 -9.934 -0.001
- IL 53 53 3 53 2 -5.693 -0.028 0.000 0.000 0.000 0.000
- [ BIF 11 ]
- B 54 53 3 55 164
- [ BEGL 12 ]
- S 55 54 1 56 1 0.000
- [ BIF 13 ]
- B 56 55 1 57 107
- [ BEGL 14 ]
- S 57 56 1 58 4 -0.000 -14.504 -13.911 -14.551
- [ MATP 15 ]
- MP 58 57 1 62 6 -16.375 -16.315 -0.000 -15.091 -15.371 -15.766 -4.982 -5.279 -3.473 0.151 -5.638 -4.923 -0.527 -5.338 -4.119 3.473 -5.094 1.108 -0.938 -10.116 -4.101 -4.610
- ML 59 57 1 62 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 60 57 1 62 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 61 57 1 62 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 62 62 5 62 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 63 63 6 63 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 16 ]
- MP 64 63 6 68 6 -16.375 -16.315 -0.000 -15.091 -15.371 -15.766 -9.445 -4.818 -7.218 -1.008 -5.649 -10.166 3.101 -9.620 -9.900 -0.074 -6.604 -4.832 2.450 -3.763 -1.743 -5.491
- ML 65 63 6 68 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 66 63 6 68 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 67 63 6 68 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 68 68 5 68 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 69 69 6 69 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 17 ]
- MP 70 69 6 74 6 -16.375 -16.315 -0.000 -15.091 -15.371 -15.766 -3.216 -4.370 -9.589 0.965 -3.416 -6.636 1.533 -6.131 -4.906 1.423 -9.862 -3.559 2.957 -7.218 -1.772 -5.940
- ML 71 69 6 74 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 72 69 6 74 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 73 69 6 74 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 74 74 5 74 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 75 75 6 75 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 18 ]
- MP 76 75 6 80 4 -15.600 -15.807 -0.004 -8.390 0.578 -3.706 -2.865 -0.125 -2.517 -3.878 2.050 -5.093 1.038 -2.011 -3.551 -1.815 1.845 -3.332 0.894 -0.433
- ML 77 75 6 80 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 78 75 6 80 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 79 75 6 80 4 -4.568 -4.250 -2.265 -0.520
- IL 80 80 5 80 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 81 81 6 81 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 19 ]
- ML 82 81 6 84 3 -16.505 -0.017 -6.438 1.873 -5.019 -3.121 -2.389
- D 83 81 6 84 3 -9.649 -5.162 -0.043
- IL 84 84 3 84 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 20 ]
- ML 85 84 3 87 3 -16.489 -0.260 -2.602 0.760 -2.963 0.888 -1.611
- D 86 84 3 87 3 -11.840 -7.353 -0.009
- IL 87 87 3 87 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 21 ]
- ML 88 87 3 90 3 -16.229 -1.139 -0.873 -0.871 -0.362 -2.505 1.321
- D 89 87 3 90 3 -15.430 -10.943 -0.001
- IL 90 90 3 90 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 22 ]
- ML 91 90 3 93 3 -2.064 -0.410 -6.932 -1.344 0.043 -3.899 1.327
- D 92 90 3 93 3 -17.254 -0.140 -3.439
- IL 93 93 3 93 3 -4.644 -0.060 -10.489 0.000 0.000 0.000 0.000
- [ MATL 23 ]
- ML 94 93 3 96 3 -16.419 -0.000 -15.073 -1.181 -2.707 1.649 -1.886
- D 95 93 3 96 3 -13.891 -9.404 -0.002
- IL 96 96 3 96 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 24 ]
- ML 97 96 3 99 3 -16.419 -0.319 -2.335 -1.565 -2.573 1.615 -1.218
- D 98 96 3 99 3 -13.891 -9.404 -0.002
- IL 99 99 3 99 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 25 ]
- ML 100 99 3 102 3 -0.979 -1.031 -8.141 -1.478 -1.029 -2.625 1.580
- D 101 99 3 102 3 -5.311 -0.057 -6.216
- IL 102 102 3 102 3 -2.215 -0.364 -7.102 0.000 0.000 0.000 0.000
- [ MATL 26 ]
- ML 103 102 3 105 2 * 0.000 1.761 -3.648 -1.627 -2.270
- D 104 102 3 105 2 * 0.000
- IL 105 105 3 105 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 27 ]
- E 106 105 3 -1 0
- [ BEGR 28 ]
- S 107 56 1 108 3 -16.510 -0.006 -7.945
- IL 108 108 2 108 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 29 ]
- ML 109 108 2 111 5 -7.291 -0.010 -10.711 -15.465 -16.356 0.871 -2.591 0.703 -1.403
- D 110 108 2 111 5 -8.103 -0.071 -7.364 -5.739 -5.652
- IL 111 111 3 111 5 -5.174 -0.316 -2.622 -8.685 -7.958 0.000 0.000 0.000 0.000
- [ MATP 30 ]
- MP 112 111 3 116 6 -10.027 -10.988 -0.002 -15.089 -15.369 -15.764 -2.275 -4.519 -5.191 1.364 -2.449 -3.128 2.152 -2.093 -3.346 -0.037 -9.507 -0.054 2.317 -2.913 -0.382 -1.999
- ML 113 111 3 116 6 -8.418 -8.764 -0.206 -3.173 -8.614 -6.144 -0.633 -0.349 0.997 -0.800
- MR 114 111 3 116 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 115 111 3 116 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 116 116 5 116 6 -3.860 -4.123 -0.266 -5.778 -6.555 -6.215 0.000 0.000 0.000 0.000
- IR 117 117 6 117 5 -2.935 -0.326 -6.446 -4.614 -5.719 0.000 0.000 0.000 0.000
- [ MATP 31 ]
- MP 118 117 6 122 6 -16.375 -16.315 -0.000 -15.091 -15.371 -15.766 -9.444 -9.644 -9.587 1.469 -8.195 -5.438 2.423 -3.814 -9.898 0.212 -9.860 -1.084 2.434 -9.404 -0.984 -2.166
- ML 119 117 6 122 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 120 117 6 122 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 121 117 6 122 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 122 122 5 122 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 123 123 6 123 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 32 ]
- MP 124 123 6 128 6 -16.375 -16.315 -0.001 -15.091 -10.136 -15.766 -5.455 -2.800 -10.463 2.102 -4.795 -5.771 0.873 -10.218 -10.099 2.373 -7.377 -3.302 2.056 -7.863 -3.353 -3.249
- ML 125 123 6 128 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 126 123 6 128 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 127 123 6 128 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 128 128 5 128 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 129 129 6 129 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 33 ]
- MP 130 129 6 134 6 -16.374 -16.313 -0.000 -15.090 -15.370 -15.765 -5.626 -5.061 -11.029 1.022 -6.809 -10.870 1.567 -5.910 -10.185 3.199 -9.871 0.030 -1.500 -5.947 -2.003 -3.280
- ML 131 129 6 134 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 132 129 6 134 6 -8.333 -7.062 -0.446 -7.040 -2.174 -5.253 -0.561 -1.145 -1.345 1.308
- D 133 129 6 134 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 134 134 5 134 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 135 135 6 135 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 34 ]
- MP 136 135 6 140 4 -15.600 -15.807 -0.000 -14.221 -4.643 -3.598 -4.445 2.520 -5.324 -10.061 1.891 -5.575 -5.849 1.582 -4.152 -1.774 1.115 -5.848 -0.751 -2.312
- ML 137 135 6 140 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 138 135 6 140 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 139 135 6 140 4 -4.568 -4.250 -2.265 -0.520
- IL 140 140 5 140 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 141 141 6 141 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 35 ]
- ML 142 141 6 144 3 -8.892 -0.003 -15.164 -3.426 1.205 -4.796 0.646
- D 143 141 6 144 3 -6.174 -1.687 -0.566
- IL 144 144 3 144 3 -2.936 -0.236 -5.636 0.000 0.000 0.000 0.000
- [ MATL 36 ]
- ML 145 144 3 147 3 -16.510 -0.000 -15.164 -9.794 -3.318 -10.511 1.963
- D 146 144 3 147 3 -6.174 -1.687 -0.566
- IL 147 147 3 147 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 37 ]
- ML 148 147 3 150 3 -16.510 -0.000 -15.164 -2.395 -0.665 0.411 0.887
- D 149 147 3 150 3 -6.174 -1.687 -0.566
- IL 150 150 3 150 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 38 ]
- ML 151 150 3 153 3 -16.510 -0.000 -15.164 0.200 -0.175 -0.316 0.217
- D 152 150 3 153 3 -6.174 -1.687 -0.566
- IL 153 153 3 153 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 39 ]
- ML 154 153 3 156 3 -16.510 -0.000 -15.164 0.119 -0.102 -0.270 0.205
- D 155 153 3 156 3 -6.174 -1.687 -0.566
- IL 156 156 3 156 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 40 ]
- ML 157 156 3 159 3 -5.040 -0.045 -15.164 1.609 -7.196 -0.129 -5.136
- D 158 156 3 159 3 -6.174 -1.687 -0.566
- IL 159 159 3 159 3 -0.077 -4.263 -13.157 0.000 0.000 0.000 0.000
- [ MATL 41 ]
- ML 160 159 3 162 2 * 0.000 1.421 -0.510 -2.807 -1.067
- D 161 159 3 162 2 * 0.000
- IL 162 162 3 162 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 42 ]
- E 163 162 3 -1 0
- [ BEGR 43 ]
- S 164 54 1 165 3 -16.510 -0.000 -15.164
- IL 165 165 2 165 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 44 ]
- ML 166 165 2 168 3 -16.510 -0.213 -2.864 0.945 -0.909 -1.101 0.105
- D 167 165 2 168 3 -6.174 -1.687 -0.566
- IL 168 168 3 168 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 45 ]
- ML 169 168 3 171 2 -8.437 -0.004 0.209 -2.944 1.009 -0.511
- D 170 168 3 171 2 -13.333 -0.000
- IL 171 171 3 171 2 -4.072 -0.088 0.000 0.000 0.000 0.000
- [ BIF 46 ]
- B 172 171 3 173 229
- [ BEGL 47 ]
- S 173 172 1 174 4 -2.739 -7.052 -13.911 -0.247
- [ MATP 48 ]
- MP 174 173 1 178 6 -13.651 -13.590 -0.001 -12.367 -12.646 -13.042 -7.378 -3.262 -2.664 1.401 -9.191 -8.178 0.916 -7.848 -7.494 2.950 -1.326 0.241 0.599 -2.960 -2.133 -6.726
- ML 175 173 1 178 6 -10.279 -10.625 -5.340 -2.063 -10.475 -0.447 -1.323 -0.765 0.179 0.911
- MR 176 173 1 178 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 177 173 1 178 6 -20.150 -18.848 -14.645 -15.327 -15.345 -0.000
- IL 178 178 5 178 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 179 179 6 179 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 49 ]
- MP 180 179 6 184 6 -13.651 -13.590 -0.066 -12.367 -12.646 -4.502 -6.818 -2.333 -6.978 1.203 -2.760 -7.540 2.220 -6.998 -7.263 2.149 -3.605 -3.587 1.847 -6.783 -2.348 -1.991
- ML 181 179 6 184 6 -8.391 -8.737 -3.451 -0.174 -8.587 -6.116 -1.508 -2.625 1.693 -1.979
- MR 182 179 6 184 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 183 179 6 184 6 -20.160 -18.858 -14.655 -15.337 -15.355 -0.000
- IL 184 184 5 184 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 185 185 6 185 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 50 ]
- MP 186 185 6 190 6 -5.550 -7.140 -0.646 -12.302 -12.582 -1.590 -2.978 -6.926 -6.872 1.351 -1.939 -2.601 2.503 -2.814 -7.180 1.357 -3.580 -1.004 1.542 -6.687 -0.240 -2.743
- ML 187 185 6 190 6 -8.391 -8.737 -3.451 -0.174 -8.587 -6.116 -1.508 -2.625 1.693 -1.979
- MR 188 185 6 190 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 189 185 6 190 6 -20.171 -18.869 -14.666 -15.348 -15.366 -0.000
- IL 190 190 5 190 6 -5.078 -5.341 -0.109 -6.996 -7.772 -7.433 0.000 0.000 0.000 0.000
- IR 191 191 6 191 5 -3.357 -0.236 -6.868 -5.036 -6.142 0.000 0.000 0.000 0.000
- [ MATP 51 ]
- MP 192 191 6 196 6 -13.004 -12.943 -0.862 -11.720 -12.000 -1.155 -2.675 -6.404 -6.348 0.030 -2.186 -6.923 2.431 -6.376 -6.658 1.555 -6.621 -1.547 1.902 -1.179 0.569 -2.313
- ML 193 191 6 196 6 -8.391 -8.737 -3.451 -0.174 -8.587 -6.116 -1.356 -1.735 -2.137 1.624
- MR 194 191 6 196 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 195 191 6 196 6 -20.250 -18.948 -14.745 -15.427 -15.445 -0.000
- IL 196 196 5 196 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 197 197 6 197 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 52 ]
- MP 198 197 6 202 6 -12.145 -12.084 -0.644 -10.860 -11.140 -1.480 -5.488 -5.309 -5.782 1.654 -0.421 -6.196 1.066 -5.713 -5.833 1.703 -5.746 1.008 1.654 -1.415 0.063 -4.481
- ML 199 197 6 202 6 -8.391 -8.737 -0.210 -3.146 -8.587 -6.116 1.778 -2.623 -2.546 -2.083
- MR 200 197 6 202 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 201 197 6 202 6 -20.318 -19.016 -14.813 -15.495 -15.513 -0.000
- IL 202 202 5 202 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 203 203 6 203 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 53 ]
- MP 204 203 6 208 6 -11.574 -11.513 -0.890 -10.289 -10.569 -1.126 -4.895 -4.674 -5.193 1.765 -4.209 -5.561 1.609 -5.102 -1.734 1.630 -1.867 -2.226 1.414 -4.868 0.796 0.041
- ML 205 203 6 208 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 206 203 6 208 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 207 203 6 208 6 -20.346 -19.045 -14.842 -15.524 -15.541 -0.000
- IL 208 208 5 208 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 209 209 6 209 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 54 ]
- MP 210 209 6 214 4 -9.587 -0.703 -1.392 -8.209 -4.042 -4.606 -4.454 -0.413 -3.162 -5.149 2.248 -4.598 -1.338 -0.611 -4.856 -0.859 2.459 -4.254 1.259 -0.760
- ML 211 209 6 214 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 212 209 6 214 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 213 209 6 214 4 -15.793 -5.734 -3.090 -0.211
- IL 214 214 5 214 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 215 215 6 215 3 -6.101 -0.024 -8.801 0.000 0.000 0.000 0.000
- [ MATL 55 ]
- ML 216 215 6 218 3 -13.770 -0.010 -7.152 -0.289 -1.583 0.139 0.804
- D 217 215 6 218 3 -17.695 -13.208 -0.000
- IL 218 218 3 218 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 56 ]
- ML 219 218 3 221 3 -13.760 -0.088 -4.086 0.094 -0.451 -1.987 0.963
- D 220 218 3 221 3 -17.697 -13.210 -0.000
- IL 221 221 3 221 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 57 ]
- ML 222 221 3 224 3 -5.013 -0.584 -1.729 0.935 -0.852 -2.754 0.471
- D 223 221 3 224 3 -17.711 -13.224 -0.000
- IL 224 224 3 224 3 -2.268 -0.355 -6.610 0.000 0.000 0.000 0.000
- [ MATL 58 ]
- ML 225 224 3 227 2 * 0.000 0.723 -1.172 0.113 -0.280
- D 226 224 3 227 2 * 0.000
- IL 227 227 3 227 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 59 ]
- E 228 227 3 -1 0
- [ BEGR 60 ]
- S 229 172 1 230 3 -16.510 -0.070 -4.391
- IL 230 230 2 230 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 61 ]
- ML 231 230 2 233 3 -1.100 -0.910 -9.578 0.539 -3.489 0.896 -0.742
- D 232 230 2 233 3 -5.057 -0.050 -7.937
- IL 233 233 3 233 3 -5.401 -0.035 -12.774 0.000 0.000 0.000 0.000
- [ MATL 62 ]
- ML 234 233 3 236 5 -15.441 -0.000 -15.257 -15.469 -16.360 -1.725 0.910 -2.834 0.747
- D 235 233 3 236 5 -6.712 -0.196 -5.973 -4.348 -4.260
- IL 236 236 3 236 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 63 ]
- MP 237 236 3 241 6 -16.375 -8.028 -0.006 -15.091 -15.371 -15.766 -4.363 -5.904 -4.951 2.195 -5.887 -10.865 1.261 -7.646 -10.183 2.553 -7.261 0.855 -0.188 -2.969 -2.582 -4.438
- ML 238 236 3 241 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 239 236 3 241 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 240 236 3 241 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 241 241 5 241 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 242 242 6 242 5 -4.580 -0.096 -8.091 -6.259 -7.365 0.000 0.000 0.000 0.000
- [ MATP 64 ]
- MP 243 242 6 247 6 -16.375 -16.315 -0.000 -15.091 -15.371 -15.766 -9.443 -4.760 -9.587 1.719 -4.752 -5.369 2.210 -6.231 -9.897 1.303 -9.860 -0.406 1.985 -4.679 -0.783 -2.597
- ML 244 242 6 247 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 245 242 6 247 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 246 242 6 247 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 247 247 5 247 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 248 248 6 248 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 65 ]
- MP 249 248 6 253 6 -8.053 -9.845 -0.025 -15.091 -15.371 -6.379 -10.069 -2.783 -11.026 2.249 -11.860 -10.869 1.059 -6.596 -7.201 2.500 -5.368 -1.059 1.201 -10.226 -1.256 -3.093
- ML 250 248 6 253 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 251 248 6 253 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 252 248 6 253 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 253 253 5 253 6 -5.319 -5.582 -0.091 -7.237 -8.013 -7.674 0.000 0.000 0.000 0.000
- IR 254 254 6 254 5 -3.399 -0.228 -6.910 -5.078 -6.184 0.000 0.000 0.000 0.000
- [ MATP 66 ]
- MP 255 254 6 259 6 -16.358 -16.297 -0.099 -11.314 -10.478 -3.945 -10.053 -2.531 -11.013 1.762 -4.682 -7.764 -1.490 -4.833 -4.809 3.412 -9.855 -2.099 -0.242 -5.823 -2.336 -5.371
- ML 256 254 6 259 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 257 254 6 259 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 258 254 6 259 6 -14.063 -12.761 -8.558 -9.240 -9.258 -0.009
- IL 259 259 5 259 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 260 260 6 260 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 67 ]
- MP 261 260 6 265 4 -15.484 -15.691 -0.061 -4.602 -13.326 -2.480 -14.240 -0.224 -2.730 -4.165 -3.425 -4.997 -10.239 3.806 -6.447 -2.361 -2.185 -4.262 -3.341 -3.952
- ML 262 260 6 265 4 -4.389 -4.572 -0.306 -3.301 0.095 0.542 -0.787 -0.158
- MR 263 260 6 265 4 -6.056 -5.085 -0.499 -2.013 -0.341 1.024 -1.181 -0.443
- D 264 260 6 265 4 -12.113 -11.794 -0.905 -1.103
- IL 265 265 5 265 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 266 266 6 266 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 68 ]
- ML 267 266 6 269 3 -10.928 -0.001 -12.013 -1.929 -2.701 -3.856 1.813
- D 268 266 6 269 3 -14.166 -0.088 -4.081
- IL 269 269 3 269 3 -1.931 -0.520 -4.631 0.000 0.000 0.000 0.000
- [ MATL 69 ]
- ML 270 269 3 272 3 -16.503 -0.003 -8.936 -2.119 -3.122 -1.967 1.765
- D 271 269 3 272 3 -10.178 -0.063 -4.570
- IL 272 272 3 272 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 70 ]
- ML 273 272 3 275 3 -16.507 -0.002 -9.836 -0.819 1.547 -3.433 -1.258
- D 274 272 3 275 3 -9.161 -0.131 -3.553
- IL 275 275 3 275 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 71 ]
- ML 276 275 3 278 3 -7.363 -0.027 -6.334 0.774 -2.691 0.903 -1.915
- D 277 275 3 278 3 -8.400 -0.230 -2.791
- IL 278 278 3 278 3 -4.087 -0.101 -6.787 0.000 0.000 0.000 0.000
- [ MATL 72 ]
- ML 279 278 3 281 3 -16.492 -0.081 -4.192 1.833 -3.456 -3.499 -1.953
- D 280 278 3 281 3 -11.623 -7.136 -0.011
- IL 281 281 3 281 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 73 ]
- ML 282 281 3 284 3 -6.078 -0.150 -3.576 0.776 -1.355 -0.284 0.105
- D 283 281 3 284 3 -14.021 -5.762 -0.027
- IL 284 284 3 284 3 -2.594 -0.268 -8.060 0.000 0.000 0.000 0.000
- [ MATL 74 ]
- ML 285 284 3 287 2 * 0.000 -2.332 -0.701 -3.752 1.638
- D 286 284 3 287 2 * 0.000
- IL 287 287 3 287 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 75 ]
- E 288 287 3 -1 0
-//
diff --git a/TRNAinf-euk-c.cm b/TRNAinf-euk-c.cm
deleted file mode 100644
index 7773d53..0000000
--- a/TRNAinf-euk-c.cm
+++ /dev/null
@@ -1,403 +0,0 @@
-INFERNAL-1 [1.0]
-NAME tRNA1415G-euk
-STATES 289
-NODES 76
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 242
-EFFNSEQ 242.000
-CLEN 90
-BCOM cmbuild --rf --enone TRNAinf-euk-nc.cm trna1415G-euk.sto
-BDATE Sun Feb 8 16:45:07 2009
-CCOM cmcalibrate --exp-hfile cmcalibrate_files/TRNAinf-euk.hfile --exp-sfile cmcalibrate_files/TRNAinf-euk.sfile --exp-qqfile cmcalibrate_files/TRNAinf-euk.qqfile --exp-ffile cmcalibrate_files/TRNAinf-euk.ffile --fil-dfile cmcalibrate_files/TRNAinf-euk.dfile -s 208 TRNAinf-euk-c.cm
-CDATE Sun Feb 8 20:17:13 2009
-NULL 0.000 0.000 0.000 0.000
-PART 1 0 100
-E-LC 0 0.76843 -6.06830 1.50607 1500000 379229 0.002967
-E-GC 0 0.31017 -37.23547 -23.26641 1500000 28559 0.013131
-E-LI 0 0.75566 -5.52100 2.04710 1500000 342653 0.003283
-E-GI 0 0.34662 -32.61214 -20.13224 1500000 28360 0.013223
-E-LV 0 0.61855 -3.23047 2.28875 52460000 119544 0.032913
-E-GV 0 0.32711 -20.34928 -6.58891 52460000 118201 0.011096
-E-LF 0 0.54692 -1.88983 4.35276 52460000 119583 0.032902
-E-GF 0 0.34336 -17.51106 -4.39714 52460000 118391 0.011078
-FT-LC 32 0.99500 10000 1500000 0
- 57.7841 27.6065 13.7544 11.7235 8.38107 6.9866 4.4655 1.96541 1.59935 1.47049 1.26106 0.695894 0.459069 0.39849 0.291953 0.286399 0.275243 0.208035 0.189464 0.0913739 0.0703285 0.0668557 0.0511794 0.0415699 0.030963 0.0305614 0.0265798 0.0195762 0.0140099 2.0808e-14 8.3107e-15 8.23131e-16
- 1204.97 1040.69 891.455 774.984 597.025 513.095 408.683 349.315 276.562 212.474 177.97 156.248 121.96 99.3445 86.4121 74.2236 59.9991 48.9536 39.8543 29.0049 24.7237 21.993 19.2454 17.073 15.2455 12.27 10.3225 9.06261 8.18283 3.95299 0.932945 0.818283
-FT-LI 32 0.99500 10000 1500000 0
- 85.0841 69.0915 22.821 16.6573 13.6159 11.0926 7.3314 4.34707 2.68071 2.46422 1.86831 1.17931 1.13206 0.742786 0.682715 0.501591 0.475347 0.420293 0.339539 0.223038 0.137836 0.116618 0.11013 0.0737188 0.0596709 0.0554012 0.0477154 0.0428326 0.0236209 4.73377e-14 1.11282e-14 2.4015e-15
- 1204.97 1040.69 891.455 774.984 597.025 513.095 408.683 349.315 276.562 212.474 177.97 156.248 121.96 99.3445 86.4121 74.2236 59.9991 48.9536 39.8543 29.0049 24.7237 21.993 19.2454 17.073 15.2455 12.27 10.3225 9.06261 8.18283 3.95299 0.932945 0.818283
-FT-GC 6 0.99500 10000 1500000 1
- 0.000442832 1.53871e-05 5.87019e-06 5.60247e-07 4.47987e-07 1.78587e-07
- 6.31656 1.87784 1.68418 1.0066 0.78128 0.631656
-FT-GI 5 0.99500 10000 1500000 1
- 0.000164001 2.82835e-06 8.61323e-07 1.17306e-07 3.65116e-08
- 6.31656 1.87784 1.68418 0.78128 0.631656
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 4 -12.856 -6.848 -0.033 -6.208
- IL 1 1 2 1 4 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000
- IR 2 2 3 2 3 -0.736 -1.357 -6.767 0.000 0.000 0.000 0.000
- [ MATR 1 ]
- MR 3 2 3 5 5 -12.888 -0.001 -12.704 -12.916 -13.808 1.039 -3.030 0.513 -1.334
- D 4 2 3 5 5 -7.557 -0.127 -5.184 -6.615 -4.609
- IR 5 5 3 5 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 2 ]
- MP 6 5 3 10 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -10.456 -7.706 -11.141 -0.956 -10.214 -8.190 -0.166 -10.242 -8.899 3.541 -8.406 -0.049 0.965 -8.222 -6.081 -8.961
- ML 7 5 3 10 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 8 5 3 10 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 9 5 3 10 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 10 10 5 10 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 11 11 6 11 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 3 ]
- MP 12 11 6 16 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -7.453 -7.583 -7.613 0.108 -3.582 -8.183 2.743 -2.968 -7.901 1.951 -7.855 0.608 1.278 -7.430 -2.706 -6.246
- ML 13 11 6 16 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 14 11 6 16 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 15 11 6 16 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 16 16 5 16 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 17 17 6 17 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 4 ]
- MP 18 17 6 22 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -7.221 -7.406 -7.358 0.542 -5.962 -7.936 2.993 -7.379 -7.677 0.738 -5.039 -0.095 1.817 -7.185 -1.512 -6.009
- ML 19 17 6 22 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 20 17 6 22 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 21 17 6 22 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 22 22 5 22 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 23 23 6 23 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 5 ]
- MP 24 23 6 28 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -7.002 -7.198 -7.147 1.211 -3.082 -7.721 2.354 -3.330 -7.455 1.520 -3.212 -0.725 1.554 -6.963 0.833 -5.803
- ML 25 23 6 28 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 26 23 6 28 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 27 23 6 28 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 28 28 5 28 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 29 29 6 29 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 6 ]
- MP 30 29 6 34 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -7.073 -3.328 -7.284 1.022 -5.966 -7.799 2.484 -7.274 -3.001 1.639 -2.504 0.339 1.291 -7.052 -0.103 -2.567
- ML 31 29 6 34 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 32 29 6 34 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 33 29 6 34 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 34 34 5 34 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 35 35 6 35 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 7 ]
- MP 36 35 6 40 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -7.032 -7.157 -2.626 1.002 -5.838 -7.755 2.272 -4.949 -7.471 1.711 -7.418 0.311 1.174 -7.001 0.645 -0.780
- ML 37 35 6 40 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 38 35 6 40 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 39 35 6 40 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 40 40 5 40 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 41 41 6 41 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 8 ]
- MP 42 41 6 46 4 -13.060 -13.267 -0.001 -11.681 -7.604 -3.932 -8.563 2.423 -9.408 -8.404 -0.790 -8.072 -7.720 2.630 -7.405 -1.208 1.724 -7.761 -5.329 -6.949
- ML 43 41 6 46 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 44 41 6 46 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 45 41 6 46 4 -4.568 -4.250 -2.265 -0.520
- IL 46 46 5 46 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 47 47 6 47 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 9 ]
- ML 48 47 6 50 3 -5.350 -0.049 -6.847 -8.878 -9.011 -9.336 1.998
- D 49 47 6 50 3 -6.174 -1.687 -0.566
- IL 50 50 3 50 3 -3.659 -0.138 -6.359 0.000 0.000 0.000 0.000
- [ MATL 10 ]
- ML 51 50 3 53 2 -5.335 -0.036 0.772 -4.220 1.142 -4.951
- D 52 50 3 53 2 -8.830 -0.003
- IL 53 53 3 53 2 -4.704 -0.056 0.000 0.000 0.000 0.000
- [ BIF 11 ]
- B 54 53 3 55 164
- [ BEGL 12 ]
- S 55 54 1 56 1 0.000
- [ BIF 13 ]
- B 56 55 1 57 107
- [ BEGL 14 ]
- S 57 56 1 58 4 -0.001 -11.981 -11.388 -12.028
- [ MATP 15 ]
- MP 58 57 1 62 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -11.276 -6.820 -12.174 -1.662 -11.241 -7.022 -0.830 -10.765 -7.977 3.616 -4.835 1.272 -1.425 -7.134 -7.284 -9.308
- ML 59 57 1 62 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 60 57 1 62 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 61 57 1 62 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 62 62 5 62 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 63 63 6 63 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 16 ]
- MP 64 63 6 68 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -9.302 -9.674 -7.661 -4.939 -3.433 -8.281 3.404 -8.359 -10.938 -1.588 -7.721 -6.781 2.218 -10.063 -1.859 -8.346
- ML 65 63 6 68 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 66 63 6 68 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 67 63 6 68 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 68 68 5 68 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 69 69 6 69 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 17 ]
- MP 70 69 6 74 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -7.143 -3.244 -7.294 1.163 -3.118 -7.869 2.120 -7.316 -7.596 2.021 -7.559 -4.493 2.227 -7.111 -1.514 -5.945
- ML 71 69 6 74 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 72 69 6 74 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 73 69 6 74 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 74 74 5 74 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 75 75 6 75 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 18 ]
- MP 76 75 6 80 4 -13.060 -13.267 -0.001 -11.681 -0.076 -5.815 -2.786 -2.455 -0.706 -3.164 2.524 -4.060 1.063 -2.375 -6.172 -1.880 -0.013 -5.584 1.123 1.271
- ML 77 75 6 80 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 78 75 6 80 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 79 75 6 80 4 -4.568 -4.250 -2.265 -0.520
- IL 80 80 5 80 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 81 81 6 81 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 19 ]
- ML 82 81 6 84 3 -13.971 -0.000 -12.625 1.971 -6.823 -4.307 -5.535
- D 83 81 6 84 3 -6.174 -1.687 -0.566
- IL 84 84 3 84 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 20 ]
- ML 85 84 3 87 3 -13.971 -0.011 -7.073 -0.530 -7.321 1.699 -4.177
- D 86 84 3 87 3 -6.174 -1.687 -0.566
- IL 87 87 3 87 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 21 ]
- ML 88 87 3 90 3 -13.961 -1.486 -0.637 -2.904 -1.035 -2.328 1.669
- D 89 87 3 90 3 -8.586 -4.099 -0.091
- IL 90 90 3 90 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 22 ]
- ML 91 90 3 93 3 -5.000 -0.046 -11.130 -2.808 0.243 -2.405 1.313
- D 92 90 3 93 3 -14.762 -0.003 -9.153
- IL 93 93 3 93 3 -2.845 -0.253 -5.545 0.000 0.000 0.000 0.000
- [ MATL 23 ]
- ML 94 93 3 96 3 -13.971 -0.000 -12.625 -9.436 -10.439 1.999 -10.233
- D 95 93 3 96 3 -6.174 -1.687 -0.566
- IL 96 96 3 96 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 24 ]
- ML 97 96 3 99 3 -13.971 -0.000 -12.625 -7.395 -8.802 1.979 -4.347
- D 98 96 3 99 3 -6.174 -1.687 -0.566
- IL 99 99 3 99 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 25 ]
- ML 100 99 3 102 3 -0.831 -1.230 -6.424 -1.226 -2.011 -2.555 1.657
- D 101 99 3 102 3 -6.174 -1.687 -0.566
- IL 102 102 3 102 3 -2.392 -0.313 -7.869 0.000 0.000 0.000 0.000
- [ MATL 26 ]
- ML 103 102 3 105 2 * 0.000 1.965 -5.091 -6.325 -4.210
- D 104 102 3 105 2 * 0.000
- IL 105 105 3 105 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 27 ]
- E 106 105 3 -1 0
- [ BEGR 28 ]
- S 107 56 1 108 3 -13.971 -0.000 -12.625
- IL 108 108 2 108 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 29 ]
- ML 109 108 2 111 5 -12.907 -0.006 -8.059 -12.935 -13.826 -0.433 -2.838 1.309 -0.640
- D 110 108 2 111 5 -4.959 -0.803 -4.221 -2.596 -2.508
- IL 111 111 3 111 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 30 ]
- MP 112 111 3 116 6 -13.858 -13.797 -0.001 -12.574 -12.854 -13.249 -6.996 -7.198 -3.715 0.557 -5.748 -7.717 2.511 -7.170 -7.451 -0.581 -7.414 0.645 2.396 -3.033 0.085 -5.798
- ML 113 111 3 116 6 -7.432 -7.778 -0.440 -2.187 -7.628 -5.157 -0.273 0.962 -1.117 -0.391
- MR 114 111 3 116 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 115 111 3 116 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 116 116 5 116 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 117 117 6 117 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 31 ]
- MP 118 117 6 122 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -7.170 -7.360 -7.312 1.274 -5.913 -7.889 2.605 -7.333 -7.626 0.764 -7.586 -2.487 2.306 -7.133 -0.892 -3.768
- ML 119 117 6 122 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 120 117 6 122 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 121 117 6 122 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 122 122 5 122 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 123 123 6 123 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 32 ]
- MP 124 123 6 128 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -3.952 -6.902 -7.728 2.010 -6.709 -2.859 1.716 -7.609 -7.586 1.974 -7.456 -4.347 2.083 -7.342 -4.430 -2.484
- ML 125 123 6 128 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 126 123 6 128 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 127 123 6 128 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 128 128 5 128 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 129 129 6 129 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 33 ]
- MP 130 129 6 134 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -10.836 -3.585 -11.559 -2.332 -10.474 -7.539 1.408 -10.495 -8.417 3.580 -7.903 -0.846 -2.547 -7.627 -1.473 -9.127
- ML 131 129 6 134 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 132 129 6 134 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 133 129 6 134 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 134 134 5 134 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 135 135 6 135 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 34 ]
- MP 136 135 6 140 4 -13.060 -13.267 -0.001 -11.681 -7.574 -6.590 -2.830 2.646 -9.172 -8.376 1.798 -8.040 -7.698 2.065 -7.392 -2.387 0.156 -4.778 -1.765 -1.900
- ML 137 135 6 140 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 138 135 6 140 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 139 135 6 140 4 -4.568 -4.250 -2.265 -0.520
- IL 140 140 5 140 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 141 141 6 141 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 35 ]
- ML 142 141 6 144 3 -13.971 -0.000 -12.625 -7.441 1.640 -8.378 -0.194
- D 143 141 6 144 3 -6.174 -1.687 -0.566
- IL 144 144 3 144 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 36 ]
- ML 145 144 3 147 3 -13.971 -0.000 -12.625 -6.969 -3.213 -7.715 1.956
- D 146 144 3 147 3 -6.174 -1.687 -0.566
- IL 147 147 3 147 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 37 ]
- ML 148 147 3 150 3 -13.971 -0.000 -12.625 -0.259 0.036 0.052 0.141
- D 149 147 3 150 3 -6.174 -1.687 -0.566
- IL 150 150 3 150 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 38 ]
- ML 151 150 3 153 3 -13.971 -0.000 -12.625 -0.015 -0.285 -0.172 0.381
- D 152 150 3 153 3 -6.174 -1.687 -0.566
- IL 153 153 3 153 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 39 ]
- ML 154 153 3 156 3 -13.971 -0.000 -12.625 0.299 -0.166 -0.594 0.282
- D 155 153 3 156 3 -6.174 -1.687 -0.566
- IL 156 156 3 156 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 40 ]
- ML 157 156 3 159 3 -2.692 -0.243 -12.625 1.556 -4.613 0.015 -6.898
- D 158 156 3 159 3 -6.174 -1.687 -0.566
- IL 159 159 3 159 3 -0.077 -4.265 -12.972 0.000 0.000 0.000 0.000
- [ MATL 41 ]
- ML 160 159 3 162 2 * 0.000 1.436 -0.207 -6.051 -1.277
- D 161 159 3 162 2 * 0.000
- IL 162 162 3 162 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 42 ]
- E 163 162 3 -1 0
- [ BEGR 43 ]
- S 164 54 1 165 3 -13.971 -0.000 -12.625
- IL 165 165 2 165 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 44 ]
- ML 166 165 2 168 3 -13.971 -0.323 -2.318 1.147 -1.400 -1.431 0.051
- D 167 165 2 168 3 -6.174 -1.687 -0.566
- IL 168 168 3 168 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 45 ]
- ML 169 168 3 171 2 -14.300 -0.000 -1.461 -3.767 1.768 -2.661
- D 170 168 3 171 2 -11.479 -0.001
- IL 171 171 3 171 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ BIF 46 ]
- B 172 171 3 173 229
- [ BEGL 47 ]
- S 173 172 1 174 4 -2.207 -6.770 -11.388 -0.370
- [ MATP 48 ]
- MP 174 173 1 178 6 -11.709 -11.648 -0.003 -10.424 -10.704 -11.099 -7.768 -6.678 -8.379 -0.061 -7.362 -8.562 2.319 -7.681 -7.986 2.912 -7.619 -0.894 0.870 -8.010 -3.261 -6.444
- ML 175 173 1 178 6 -8.311 -8.657 -3.371 -0.185 -8.507 -6.036 -1.429 -2.524 1.671 -1.884
- MR 176 173 1 178 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 177 173 1 178 6 -17.507 -16.205 -12.002 -12.684 -12.702 -0.001
- IL 178 178 5 178 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 179 179 6 179 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 49 ]
- MP 180 179 6 184 6 -11.709 -11.648 -0.120 -10.424 -10.704 -3.684 -5.406 -5.916 -5.801 -1.489 -0.765 -6.510 1.962 -5.912 -5.908 2.451 -6.200 -3.259 2.067 -5.622 -0.600 -0.740
- ML 181 179 6 184 6 -8.311 -8.657 -3.371 -0.185 -8.507 -6.036 -1.429 -2.524 1.671 -1.884
- MR 182 179 6 184 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 183 179 6 184 6 -17.507 -16.205 -12.002 -12.684 -12.702 -0.001
- IL 184 184 5 184 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 185 185 6 185 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 50 ]
- MP 186 185 6 190 6 -11.592 -11.532 -0.330 -10.308 -10.588 -2.305 -5.936 -5.324 -6.425 1.144 -5.617 -1.650 2.767 -6.209 -6.214 2.159 -5.947 -2.664 0.200 -6.063 -0.460 -5.003
- ML 187 185 6 190 6 -8.311 -8.657 -3.371 -0.185 -8.507 -6.036 -1.429 -2.524 1.671 -1.884
- MR 188 185 6 190 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 189 185 6 190 6 -17.539 -16.237 -12.034 -12.717 -12.734 -0.001
- IL 190 190 5 190 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 191 191 6 191 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 51 ]
- MP 192 191 6 196 6 -11.267 -11.206 -1.730 -9.983 -10.263 -0.523 -6.318 -6.496 -6.420 -1.439 -1.942 -7.112 2.840 -6.413 -6.857 1.932 -6.749 -3.203 1.457 -6.491 0.514 -5.133
- ML 193 191 6 196 6 -8.311 -8.657 -3.371 -0.185 -8.507 -6.036 -1.253 -1.658 -2.035 1.594
- MR 194 191 6 196 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 195 191 6 196 6 -17.614 -16.312 -12.109 -12.791 -12.809 -0.001
- IL 196 196 5 196 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 197 197 6 197 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 52 ]
- MP 198 197 6 202 6 -9.553 -9.492 -0.354 -8.269 -8.549 -2.259 -3.828 -4.414 -4.360 0.011 -3.061 -5.189 1.627 -4.443 -4.341 -0.008 -4.844 -1.613 2.641 -4.221 1.904 -3.235
- ML 199 197 6 202 6 -8.311 -8.657 -0.223 -3.066 -8.507 -6.036 1.762 -2.527 -2.451 -1.986
- MR 200 197 6 202 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 201 197 6 202 6 -17.801 -16.500 -12.297 -12.979 -12.996 -0.001
- IL 202 202 5 202 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 203 203 6 203 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 53 ]
- MP 204 203 6 208 6 -9.507 -9.446 -0.378 -8.222 -8.502 -2.176 -2.910 -3.433 -3.452 -0.971 -2.602 -4.146 -0.826 -3.528 -3.276 -1.206 2.699 -1.800 0.043 -3.185 -1.335 2.446
- ML 205 203 6 208 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 206 203 6 208 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 207 203 6 208 6 -17.817 -16.516 -12.313 -12.995 -13.012 -0.001
- IL 208 208 5 208 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 209 209 6 209 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 54 ]
- MP 210 209 6 214 4 -7.055 -0.769 -1.373 -5.677 -5.237 -5.143 -4.203 -0.508 -3.630 -4.854 3.578 -4.599 -5.956 -0.443 -4.232 -2.107 0.518 -5.604 -0.885 -4.143
- ML 211 209 6 214 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 212 209 6 214 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 213 209 6 214 4 -13.256 -5.912 -2.422 -0.328
- IL 214 214 5 214 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 215 215 6 215 3 -3.697 -0.134 -6.397 0.000 0.000 0.000 0.000
- [ MATL 55 ]
- ML 216 215 6 218 3 -11.762 -0.001 -10.417 -0.319 -1.578 -0.510 1.112
- D 217 215 6 218 3 -15.041 -10.554 -0.001
- IL 218 218 3 218 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 56 ]
- ML 219 218 3 221 3 -11.762 -0.145 -3.387 -1.361 0.234 -2.172 1.146
- D 220 218 3 221 3 -15.041 -10.554 -0.001
- IL 221 221 3 221 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 57 ]
- ML 222 221 3 224 3 -11.619 -0.798 -1.236 0.011 -0.849 -2.726 1.193
- D 223 221 3 224 3 -15.078 -10.591 -0.001
- IL 224 224 3 224 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 58 ]
- ML 225 224 3 227 2 * 0.000 0.107 -1.045 0.753 -0.409
- D 226 224 3 227 2 * 0.000
- IL 227 227 3 227 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 59 ]
- E 228 227 3 -1 0
- [ BEGR 60 ]
- S 229 172 1 230 3 -13.971 -0.029 -5.635
- IL 230 230 2 230 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 61 ]
- ML 231 230 2 233 3 -0.713 -1.360 -12.596 -0.131 -3.260 1.530 -3.396
- D 232 230 2 233 3 -9.860 -0.079 -4.252
- IL 233 233 3 233 3 -6.751 -0.014 -10.646 0.000 0.000 0.000 0.000
- [ MATL 62 ]
- ML 234 233 3 236 5 -12.907 -0.001 -12.723 -12.935 -13.826 -3.231 1.707 -4.784 -0.754
- D 235 233 3 236 5 -4.959 -0.803 -4.221 -2.596 -2.508
- IL 236 236 3 236 5 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000
- [ MATP 63 ]
- MP 237 236 3 241 6 -13.863 -5.381 -0.036 -12.579 -12.859 -13.254 -9.585 -8.508 -10.303 0.862 -4.812 -10.387 2.580 -9.640 -9.774 2.639 -9.420 -0.032 -0.745 -9.813 -1.521 -8.428
- ML 238 236 3 241 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 239 236 3 241 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 240 236 3 241 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 241 241 5 241 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 242 242 6 242 5 -4.686 -0.089 -8.197 -6.365 -7.471 0.000 0.000 0.000 0.000
- [ MATP 64 ]
- MP 243 242 6 247 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -7.007 -7.207 -7.150 0.363 -5.758 -7.726 3.046 -3.761 -7.461 0.875 -7.422 -1.290 1.773 -4.756 -0.718 -5.807
- ML 244 242 6 247 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 245 242 6 247 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 246 242 6 247 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 247 247 5 247 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 248 248 6 248 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 65 ]
- MP 249 248 6 253 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -8.223 -7.211 -9.135 1.737 -9.463 -9.029 0.920 -8.611 -8.355 3.029 -8.038 -4.659 0.497 -8.396 -0.039 -2.657
- ML 250 248 6 253 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 251 248 6 253 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 252 248 6 253 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 253 253 5 253 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 254 254 6 254 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 66 ]
- MP 255 254 6 259 6 -13.863 -13.802 -0.001 -12.579 -12.859 -13.254 -9.197 -3.944 -10.148 1.192 -10.482 -5.072 -1.950 -3.859 -4.145 3.625 -7.418 -2.043 -0.876 -3.478 -6.453 -8.213
- ML 256 254 6 259 6 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.660 -0.612 -0.293 -0.076
- MR 257 254 6 259 6 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.660 -0.612 -0.293 -0.076
- D 258 254 6 259 6 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319
- IL 259 259 5 259 6 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000
- IR 260 260 6 260 5 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000
- [ MATP 67 ]
- MP 261 260 6 265 4 -13.060 -13.267 -0.001 -11.681 -11.930 -7.279 -12.582 -2.660 -11.672 -7.500 -5.551 -11.017 -8.434 3.964 -7.907 -2.684 -5.482 -7.604 -7.598 -9.691
- ML 262 260 6 265 4 -3.758 -3.940 -0.507 -2.670 0.660 -0.612 -0.293 -0.076
- MR 263 260 6 265 4 -4.809 -3.838 -1.706 -0.766 0.660 -0.612 -0.293 -0.076
- D 264 260 6 265 4 -4.568 -4.250 -2.265 -0.520
- IL 265 265 5 265 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 266 266 6 266 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 68 ]
- ML 267 266 6 269 3 -13.971 -0.000 -12.625 -2.040 -6.999 -8.040 1.905
- D 268 266 6 269 3 -6.174 -1.687 -0.566
- IL 269 269 3 269 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 69 ]
- ML 270 269 3 272 3 -13.971 -0.000 -12.625 -8.878 -9.011 -9.336 1.998
- D 271 269 3 272 3 -6.174 -1.687 -0.566
- IL 272 272 3 272 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 70 ]
- ML 273 272 3 275 3 -13.971 -0.000 -12.625 -6.878 1.979 -5.714 -5.080
- D 274 272 3 275 3 -6.174 -1.687 -0.566
- IL 275 275 3 275 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 71 ]
- ML 276 275 3 278 3 -13.971 -0.000 -12.625 -0.336 -7.439 1.672 -6.007
- D 277 275 3 278 3 -6.174 -1.687 -0.566
- IL 278 278 3 278 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 72 ]
- ML 279 278 3 281 3 -13.971 -0.000 -12.625 1.997 -8.574 -8.032 -8.484
- D 280 278 3 281 3 -6.174 -1.687 -0.566
- IL 281 281 3 281 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 73 ]
- ML 282 281 3 284 3 -13.971 -0.004 -8.670 0.685 -1.627 -0.894 0.614
- D 283 281 3 284 3 -6.174 -1.687 -0.566
- IL 284 284 3 284 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 74 ]
- ML 285 284 3 287 2 * 0.000 -1.742 0.204 -5.128 1.334
- D 286 284 3 287 2 * 0.000
- IL 287 287 3 287 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 75 ]
- E 288 287 3 -1 0
-//
diff --git a/TRNAinf-euk-ns-c.cm b/TRNAinf-euk-ns-c.cm
deleted file mode 100644
index 95f4f93..0000000
--- a/TRNAinf-euk-ns-c.cm
+++ /dev/null
@@ -1,404 +0,0 @@
-INFERNAL-1 [1.0]
-NAME tRNA1415G-euk-nostruct
-STATES 274
-NODES 92
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 242
-EFFNSEQ 242.000
-CLEN 90
-BCOM cmbuild --rf --enone -F TRNAinf-euk-ns-nc.cm trna1415G-euk-ns.sto
-BDATE Sun Feb 8 18:17:36 2009
-CCOM cmcalibrate --exp-hfile cmcalibrate_files/TRNAinf-euk-ns.hfile --exp-sfile cmcalibrate_files/TRNAinf-euk-ns.sfile --exp-qqfile cmcalibrate_files/TRNAinf-euk-ns.qqfile --exp-ffile cmcalibrate_files/TRNAinf-euk-ns.ffile --fil-dfile cmcalibrate_files/TRNAinf-euk-ns.dfile -s 208 TRNAinf-euk-ns-c.cm
-CDATE Sun Feb 8 20:15:06 2009
-NULL 0.000 0.000 0.000 0.000
-PART 1 0 100
-E-LC 0 0.70749 -10.10603 -1.17107 1500000 625883 0.001797
-E-GC 0 0.30291 -28.62205 -14.69779 1500000 25455 0.014732
-E-LI 0 0.72725 -8.91211 -0.48093 1500000 517684 0.002173
-E-GI 0 0.31349 -26.12174 -12.69584 1500000 25229 0.014864
-E-LV 0 0.69978 -2.81485 2.07065 36610000 83834 0.032752
-E-GV 0 0.32667 -20.69246 -6.90066 36610000 82826 0.011050
-E-LF 0 0.68282 0.30845 5.31514 36610000 83825 0.032756
-E-GF 0 0.33805 -18.23904 -4.90963 36610000 82888 0.011042
-FT-LC 39 0.99500 10000 1500000 0
- 5681 5280.41 4644.93 4570.26 3355.48 2994.2 2261.39 2186.97 1692.58 1617.63 1120.82 696.014 507.426 486.68 434.051 366.268 365.75 272.777 233.883 193.729 158.017 137.078 128.997 104.092 92.0756 85.7562 68.0235 51.6656 46.5404 35.139 31.294 24.4254 2.00098 1.25647 1.09382 0.479996 0.435428 0.179204 0.159217
- 1195.64 953.773 788.331 685.825 566.862 484.475 420.33 350.756 310.614 275.065 237.184 197.925 164.939 147.063 120.974 101.711 77.0851 65.1659 57.3935 50.6518 43.9754 38.9426 34.4387 30.539 27.0624 23.7048 20.2319 17.892 15.7688 13.6997 11.8291 11.3102 10.0343 6.03747 4.19848 1.91847 1.58244 1.31962 1.13102
-FT-LI 46 0.99500 10000 1500000 0
- 6307.44 5344.87 4260.65 4020.78 3665.28 3442.32 2935.6 2510.92 1677.93 1557.44 937.972 653.107 521.362 394.051 366.59 339.314 337.424 274.474 264.939 200.634 183.478 135.063 129.628 88.6751 82.387 69.2743 60.1612 53.4605 46.3512 38.1965 27.4666 25.0516 2.12149 1.29888 1.226 1.216 0.710586 0.68173 0.519123 0.41151 0.354207 0.306908 0.261336 0.190096 [...]
- 1195.64 953.773 788.331 685.825 566.862 484.475 420.33 350.756 310.614 275.065 237.184 197.925 164.939 147.063 120.974 101.711 77.0851 65.1659 57.3935 50.6518 43.9754 38.9426 34.4387 30.539 27.0624 23.7048 20.2319 17.892 15.7688 13.6997 11.8291 11.3102 10.0343 8.65236 7.68833 5.98003 4.85575 4.09654 3.36521 2.92763 2.34979 1.91847 1.72344 1.38517 [...]
-FT-GC 2 0.99500 10000 1500000 1
- 1.08732 0.621571
- 1.1002 0.905077
-FT-GI 2 0.99500 10000 1500000 1
- 1.25441 0.559613
- 1.1002 0.905077
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 4 -13.060 -6.839 -0.013 -11.681
- IL 1 1 2 1 4 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000
- IR 2 2 3 2 3 -0.724 -1.384 -6.424 0.000 0.000 0.000 0.000
- [ MATL 1 ]
- ML 3 2 3 5 3 -13.971 -0.000 -12.625 -2.928 -2.199 1.659 -1.020
- D 4 2 3 5 3 -6.174 -1.687 -0.566
- IL 5 5 3 5 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 2 ]
- ML 6 5 3 8 3 -13.971 -0.000 -12.625 -1.873 0.800 0.466 -0.726
- D 7 5 3 8 3 -6.174 -1.687 -0.566
- IL 8 8 3 8 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 3 ]
- ML 9 8 3 11 3 -13.971 -0.000 -12.625 -1.430 1.022 -0.595 -0.095
- D 10 8 3 11 3 -6.174 -1.687 -0.566
- IL 11 11 3 11 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 4 ]
- ML 12 11 3 14 3 -13.971 -0.000 -12.625 -0.741 0.413 -0.128 0.208
- D 13 11 3 14 3 -6.174 -1.687 -0.566
- IL 14 14 3 14 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 5 ]
- ML 15 14 3 17 3 -13.971 -0.000 -12.625 -0.880 0.499 0.255 -0.235
- D 16 14 3 17 3 -6.174 -1.687 -0.566
- IL 17 17 3 17 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 6 ]
- ML 18 17 3 20 3 -13.971 -0.000 -12.625 -0.849 0.280 0.215 0.098
- D 19 17 3 20 3 -6.174 -1.687 -0.566
- IL 20 20 3 20 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 7 ]
- ML 21 20 3 23 3 -13.971 -0.000 -12.625 0.454 -2.756 0.699 -0.219
- D 22 20 3 23 3 -6.174 -1.687 -0.566
- IL 23 23 3 23 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 8 ]
- ML 24 23 3 26 3 -5.350 -0.049 -6.847 -8.878 -9.011 -9.336 1.998
- D 25 23 3 26 3 -6.174 -1.687 -0.566
- IL 26 26 3 26 3 -3.659 -0.138 -6.359 0.000 0.000 0.000 0.000
- [ MATL 9 ]
- ML 27 26 3 29 3 -5.338 -0.036 -12.613 0.772 -4.220 1.142 -4.951
- D 28 26 3 29 3 -8.776 -0.174 -3.167
- IL 29 29 3 29 3 -3.659 -0.138 -6.359 0.000 0.000 0.000 0.000
- [ MATL 10 ]
- ML 30 29 3 32 3 -13.971 -0.000 -12.625 -3.610 -2.739 1.874 -3.279
- D 31 29 3 32 3 -6.174 -1.687 -0.566
- IL 32 32 3 32 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 11 ]
- ML 33 32 3 35 3 -13.971 -0.000 -12.625 -6.965 1.409 -3.614 0.328
- D 34 32 3 35 3 -6.174 -1.687 -0.566
- IL 35 35 3 35 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 12 ]
- ML 36 35 3 38 3 -13.971 -0.000 -12.625 -0.727 0.141 0.073 0.312
- D 37 35 3 38 3 -6.174 -1.687 -0.566
- IL 38 38 3 38 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 13 ]
- ML 39 38 3 41 3 -13.971 -0.000 -12.625 -1.612 0.713 -0.660 0.486
- D 40 38 3 41 3 -6.174 -1.687 -0.566
- IL 41 41 3 41 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 14 ]
- ML 42 41 3 44 3 -13.971 -0.000 -12.625 1.971 -6.823 -4.307 -5.535
- D 43 41 3 44 3 -6.174 -1.687 -0.566
- IL 44 44 3 44 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 15 ]
- ML 45 44 3 47 3 -13.971 -0.011 -7.073 -0.530 -7.321 1.699 -4.177
- D 46 44 3 47 3 -6.174 -1.687 -0.566
- IL 47 47 3 47 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 16 ]
- ML 48 47 3 50 3 -13.961 -1.486 -0.637 -2.904 -1.035 -2.328 1.669
- D 49 47 3 50 3 -8.586 -4.099 -0.091
- IL 50 50 3 50 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 17 ]
- ML 51 50 3 53 3 -5.000 -0.046 -11.130 -2.808 0.243 -2.405 1.313
- D 52 50 3 53 3 -14.762 -0.003 -9.153
- IL 53 53 3 53 3 -2.845 -0.253 -5.545 0.000 0.000 0.000 0.000
- [ MATL 18 ]
- ML 54 53 3 56 3 -13.971 -0.000 -12.625 -9.436 -10.439 1.999 -10.233
- D 55 53 3 56 3 -6.174 -1.687 -0.566
- IL 56 56 3 56 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 19 ]
- ML 57 56 3 59 3 -13.971 -0.000 -12.625 -7.395 -8.802 1.979 -4.347
- D 58 56 3 59 3 -6.174 -1.687 -0.566
- IL 59 59 3 59 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 20 ]
- ML 60 59 3 62 3 -0.831 -1.230 -6.424 -1.226 -2.011 -2.555 1.657
- D 61 59 3 62 3 -6.174 -1.687 -0.566
- IL 62 62 3 62 3 -2.392 -0.313 -7.869 0.000 0.000 0.000 0.000
- [ MATL 21 ]
- ML 63 62 3 65 3 -13.951 -0.000 -12.605 1.965 -5.091 -6.325 -4.210
- D 64 62 3 65 3 -9.404 -0.110 -3.796
- IL 65 65 3 65 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 22 ]
- ML 66 65 3 68 3 -13.971 -0.000 -12.625 0.214 -3.713 1.024 -0.455
- D 67 65 3 68 3 -6.174 -1.687 -0.566
- IL 68 68 3 68 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 23 ]
- ML 69 68 3 71 3 -13.971 -0.000 -12.625 0.255 0.112 0.199 -0.792
- D 70 68 3 71 3 -6.174 -1.687 -0.566
- IL 71 71 3 71 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 24 ]
- ML 72 71 3 74 3 -13.971 -0.000 -12.625 0.274 -3.607 1.433 -6.726
- D 73 71 3 74 3 -6.174 -1.687 -0.566
- IL 74 74 3 74 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 25 ]
- ML 75 74 3 77 3 -13.971 -0.000 -12.625 -3.213 1.590 -2.644 -0.471
- D 76 74 3 77 3 -6.174 -1.687 -0.566
- IL 77 77 3 77 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 26 ]
- ML 78 77 3 80 3 -13.971 -0.000 -12.625 -0.433 -2.838 1.309 -0.640
- D 79 77 3 80 3 -6.174 -1.687 -0.566
- IL 80 80 3 80 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 27 ]
- ML 81 80 3 83 3 -13.971 -0.000 -12.625 -1.356 0.532 -0.849 0.686
- D 82 80 3 83 3 -6.174 -1.687 -0.566
- IL 83 83 3 83 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 28 ]
- ML 84 83 3 86 3 -13.971 -0.000 -12.625 -0.677 0.618 -1.111 0.461
- D 85 83 3 86 3 -6.174 -1.687 -0.566
- IL 86 86 3 86 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 29 ]
- ML 87 86 3 89 3 -13.971 -0.000 -12.625 0.065 -0.223 -0.030 0.160
- D 88 86 3 89 3 -6.174 -1.687 -0.566
- IL 89 89 3 89 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 30 ]
- ML 90 89 3 92 3 -13.971 -0.000 -12.625 -3.817 -0.548 1.636 -2.878
- D 91 89 3 92 3 -6.174 -1.687 -0.566
- IL 92 92 3 92 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 31 ]
- ML 93 92 3 95 3 -13.971 -0.000 -12.625 0.699 -0.160 0.061 -1.189
- D 94 92 3 95 3 -6.174 -1.687 -0.566
- IL 95 95 3 95 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 32 ]
- ML 96 95 3 98 3 -13.971 -0.000 -12.625 -7.441 1.640 -8.378 -0.194
- D 97 95 3 98 3 -6.174 -1.687 -0.566
- IL 98 98 3 98 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 33 ]
- ML 99 98 3 101 3 -13.971 -0.000 -12.625 -6.969 -3.213 -7.715 1.956
- D 100 98 3 101 3 -6.174 -1.687 -0.566
- IL 101 101 3 101 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 34 ]
- ML 102 101 3 104 3 -13.971 -0.000 -12.625 -0.259 0.036 0.052 0.141
- D 103 101 3 104 3 -6.174 -1.687 -0.566
- IL 104 104 3 104 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 35 ]
- ML 105 104 3 107 3 -13.971 -0.000 -12.625 -0.015 -0.285 -0.172 0.381
- D 106 104 3 107 3 -6.174 -1.687 -0.566
- IL 107 107 3 107 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 36 ]
- ML 108 107 3 110 3 -13.971 -0.000 -12.625 0.299 -0.166 -0.594 0.282
- D 109 107 3 110 3 -6.174 -1.687 -0.566
- IL 110 110 3 110 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 37 ]
- ML 111 110 3 113 3 -2.692 -0.243 -12.625 1.556 -4.613 0.015 -6.898
- D 112 110 3 113 3 -6.174 -1.687 -0.566
- IL 113 113 3 113 3 -0.077 -4.265 -12.972 0.000 0.000 0.000 0.000
- [ MATL 38 ]
- ML 114 113 3 116 3 -13.971 -0.000 -12.625 1.436 -0.207 -6.051 -1.277
- D 115 113 3 116 3 -6.174 -1.687 -0.566
- IL 116 116 3 116 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 39 ]
- ML 117 116 3 119 3 -13.971 -0.000 -12.625 -1.765 0.028 -0.004 0.756
- D 118 116 3 119 3 -6.174 -1.687 -0.566
- IL 119 119 3 119 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 40 ]
- ML 120 119 3 122 3 -13.971 -0.000 -12.625 -4.436 1.584 -0.374 -2.449
- D 121 119 3 122 3 -6.174 -1.687 -0.566
- IL 122 122 3 122 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 41 ]
- ML 123 122 3 125 3 -13.971 -0.000 -12.625 0.124 0.025 -0.288 0.103
- D 124 122 3 125 3 -6.174 -1.687 -0.566
- IL 125 125 3 125 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 42 ]
- ML 126 125 3 128 3 -13.971 -0.006 -8.052 0.307 -1.218 0.729 -0.565
- D 127 125 3 128 3 -6.174 -1.687 -0.566
- IL 128 128 3 128 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 43 ]
- ML 129 128 3 131 3 -13.966 -0.000 -12.620 0.401 -2.431 0.780 -0.363
- D 130 128 3 131 3 -7.828 -0.357 -2.220
- IL 131 131 3 131 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 44 ]
- ML 132 131 3 134 3 -13.971 -0.323 -2.318 1.147 -1.400 -1.431 0.051
- D 133 131 3 134 3 -6.174 -1.687 -0.566
- IL 134 134 3 134 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 45 ]
- ML 135 134 3 137 3 -13.648 -5.671 -0.029 -1.461 -3.767 1.768 -2.661
- D 136 134 3 137 3 -13.083 -0.008 -7.475
- IL 137 137 3 137 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 46 ]
- ML 138 137 3 140 3 -11.762 -0.001 -10.417 -1.903 0.220 1.068 -1.084
- D 139 137 3 140 3 -15.041 -10.554 -0.001
- IL 140 140 3 140 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 47 ]
- ML 141 140 3 143 3 -11.762 -0.125 -3.594 -3.146 0.057 0.660 0.342
- D 142 140 3 143 3 -15.041 -10.554 -0.001
- IL 143 143 3 143 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 48 ]
- ML 144 143 3 146 3 -11.639 -0.352 -2.210 -0.832 0.836 0.282 -1.194
- D 145 143 3 146 3 -15.074 -10.587 -0.001
- IL 146 146 3 146 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 49 ]
- ML 147 146 3 149 3 -11.289 -2.034 -0.405 -2.676 0.772 -0.064 0.238
- D 148 146 3 149 3 -15.148 -10.661 -0.001
- IL 149 149 3 149 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 50 ]
- ML 150 149 3 152 3 -9.264 -0.483 -1.822 0.193 -0.999 -1.893 1.062
- D 151 149 3 152 3 -15.336 -10.849 -0.001
- IL 152 152 3 152 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 51 ]
- ML 153 152 3 155 3 -8.792 -0.747 -1.315 -0.985 -1.661 0.875 0.427
- D 154 152 3 155 3 -15.352 -10.865 -0.001
- IL 155 155 3 155 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 52 ]
- ML 156 155 3 158 3 -8.064 -0.019 -6.718 -1.435 1.602 -2.265 -1.374
- D 157 155 3 158 3 -15.368 -2.299 -0.328
- IL 158 158 3 158 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 53 ]
- ML 159 158 3 161 3 -11.762 -0.001 -10.417 -0.319 -1.578 -0.510 1.112
- D 160 158 3 161 3 -15.041 -10.554 -0.001
- IL 161 161 3 161 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 54 ]
- ML 162 161 3 164 3 -11.762 -0.145 -3.387 -1.361 0.234 -2.172 1.146
- D 163 161 3 164 3 -15.041 -10.554 -0.001
- IL 164 164 3 164 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 55 ]
- ML 165 164 3 167 3 -11.619 -0.798 -1.236 0.011 -0.849 -2.726 1.193
- D 166 164 3 167 3 -15.078 -10.591 -0.001
- IL 167 167 3 167 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 56 ]
- ML 168 167 3 170 3 -2.155 -3.927 -0.495 0.107 -1.045 0.753 -0.409
- D 169 167 3 170 3 -15.220 -10.733 -0.001
- IL 170 170 3 170 3 -3.697 -1.311 -0.944 0.000 0.000 0.000 0.000
- [ MATL 57 ]
- ML 171 170 3 173 3 -8.064 -0.019 -6.718 -1.429 -2.524 1.671 -1.884
- D 172 170 3 173 3 -15.368 -6.425 -0.017
- IL 173 173 3 173 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 58 ]
- ML 174 173 3 176 3 -8.792 -0.589 -1.588 -0.985 -1.661 0.875 0.427
- D 175 173 3 176 3 -15.352 -6.444 -0.017
- IL 176 176 3 176 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 59 ]
- ML 177 176 3 179 3 -8.875 -0.011 -7.529 0.708 -1.955 0.785 -1.374
- D 178 176 3 179 3 -15.350 -3.042 -0.187
- IL 179 179 3 179 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 60 ]
- ML 180 179 3 182 3 -11.203 -0.002 -9.857 -0.543 -0.093 1.178 -3.128
- D 181 179 3 182 3 -15.164 -4.304 -0.075
- IL 182 182 3 182 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 61 ]
- ML 183 182 3 185 3 -11.572 -0.002 -10.226 -1.777 0.235 0.968 -0.799
- D 184 182 3 185 3 -15.090 -5.473 -0.033
- IL 185 185 3 185 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 62 ]
- ML 186 185 3 188 3 -11.701 -0.002 -10.355 0.247 0.569 0.076 -1.861
- D 187 185 3 188 3 -15.058 -10.571 -0.001
- IL 188 188 3 188 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 63 ]
- ML 189 188 3 191 3 -11.701 -0.080 -4.223 -0.977 0.902 0.292 -1.328
- D 190 188 3 191 3 -15.058 -0.019 -6.288
- IL 191 191 3 191 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 64 ]
- ML 192 191 3 194 3 -0.713 -1.360 -12.596 -0.131 -3.260 1.530 -3.396
- D 193 191 3 194 3 -9.860 -0.079 -4.252
- IL 194 194 3 194 3 -6.751 -0.014 -10.646 0.000 0.000 0.000 0.000
- [ MATL 65 ]
- ML 195 194 3 197 3 -13.971 -0.000 -12.625 -3.231 1.707 -4.784 -0.754
- D 196 194 3 197 3 -6.174 -1.687 -0.566
- IL 197 197 3 197 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 66 ]
- ML 198 197 3 200 3 -13.971 -0.000 -12.625 -1.111 0.589 0.841 -2.051
- D 199 197 3 200 3 -6.174 -1.687 -0.566
- IL 200 200 3 200 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 67 ]
- ML 201 200 3 203 3 -13.971 -0.000 -12.625 -1.625 1.096 -0.837 -0.032
- D 202 200 3 203 3 -6.174 -1.687 -0.566
- IL 203 203 3 203 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 68 ]
- ML 204 203 3 206 3 -13.971 -0.000 -12.625 -0.258 -1.063 1.027 -0.628
- D 205 203 3 206 3 -6.174 -1.687 -0.566
- IL 206 206 3 206 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 69 ]
- ML 207 206 3 209 3 -13.971 -0.000 -12.625 -0.725 -3.505 1.651 -2.591
- D 208 206 3 209 3 -6.174 -1.687 -0.566
- IL 209 209 3 209 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 70 ]
- ML 210 209 3 212 3 -13.971 -0.000 -12.625 -4.940 -8.954 1.986 -8.313
- D 211 209 3 212 3 -6.174 -1.687 -0.566
- IL 212 212 3 212 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 71 ]
- ML 213 212 3 215 3 -13.971 -0.000 -12.625 -2.040 -6.999 -8.040 1.905
- D 214 212 3 215 3 -6.174 -1.687 -0.566
- IL 215 215 3 215 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 72 ]
- ML 216 215 3 218 3 -13.971 -0.000 -12.625 -8.878 -9.011 -9.336 1.998
- D 217 215 3 218 3 -6.174 -1.687 -0.566
- IL 218 218 3 218 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 73 ]
- ML 219 218 3 221 3 -13.971 -0.000 -12.625 -6.878 1.979 -5.714 -5.080
- D 220 218 3 221 3 -6.174 -1.687 -0.566
- IL 221 221 3 221 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 74 ]
- ML 222 221 3 224 3 -13.971 -0.000 -12.625 -0.336 -7.439 1.672 -6.007
- D 223 221 3 224 3 -6.174 -1.687 -0.566
- IL 224 224 3 224 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 75 ]
- ML 225 224 3 227 3 -13.971 -0.000 -12.625 1.997 -8.574 -8.032 -8.484
- D 226 224 3 227 3 -6.174 -1.687 -0.566
- IL 227 227 3 227 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 76 ]
- ML 228 227 3 230 3 -13.971 -0.004 -8.670 0.685 -1.627 -0.894 0.614
- D 229 227 3 230 3 -6.174 -1.687 -0.566
- IL 230 230 3 230 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 77 ]
- ML 231 230 3 233 3 -13.968 -0.000 -12.622 -1.742 0.204 -5.128 1.334
- D 232 230 3 233 3 -7.417 -0.497 -1.808
- IL 233 233 3 233 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 78 ]
- ML 234 233 3 236 3 -13.971 -0.000 -12.625 -7.003 1.970 -8.011 -3.850
- D 235 233 3 236 3 -6.174 -1.687 -0.566
- IL 236 236 3 236 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 79 ]
- ML 237 236 3 239 3 -13.971 -0.000 -12.625 -2.652 1.642 -3.965 -0.609
- D 238 236 3 239 3 -6.174 -1.687 -0.566
- IL 239 239 3 239 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 80 ]
- ML 240 239 3 242 3 -13.971 -0.000 -12.625 -1.440 1.027 -0.477 -0.191
- D 241 239 3 242 3 -6.174 -1.687 -0.566
- IL 242 242 3 242 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 81 ]
- ML 243 242 3 245 3 -5.350 -0.036 -12.625 -0.280 -1.088 1.184 -1.204
- D 244 242 3 245 3 -6.174 -1.687 -0.566
- IL 245 245 3 245 3 -3.659 -0.138 -6.359 0.000 0.000 0.000 0.000
- [ MATL 82 ]
- ML 246 245 3 248 3 -13.971 -0.000 -12.625 -2.565 0.635 0.656 -0.509
- D 247 245 3 248 3 -6.174 -1.687 -0.566
- IL 248 248 3 248 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 83 ]
- ML 249 248 3 251 3 -13.971 -0.000 -12.625 -0.218 0.625 -2.782 0.539
- D 250 248 3 251 3 -6.174 -1.687 -0.566
- IL 251 251 3 251 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 84 ]
- ML 252 251 3 254 3 -13.971 -0.000 -12.625 -0.936 -0.241 0.717 -0.017
- D 253 251 3 254 3 -6.174 -1.687 -0.566
- IL 254 254 3 254 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 85 ]
- ML 255 254 3 257 3 -13.971 -0.000 -12.625 -0.709 -0.284 0.753 -0.182
- D 256 254 3 257 3 -6.174 -1.687 -0.566
- IL 257 257 3 257 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 86 ]
- ML 258 257 3 260 3 -13.971 -0.000 -12.625 -0.462 -0.431 0.816 -0.375
- D 259 257 3 260 3 -6.174 -1.687 -0.566
- IL 260 260 3 260 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 87 ]
- ML 261 260 3 263 3 -13.971 -0.000 -12.625 -0.219 -1.250 1.081 -0.725
- D 262 260 3 263 3 -6.174 -1.687 -0.566
- IL 263 263 3 263 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 88 ]
- ML 264 263 3 266 3 -13.971 -0.000 -12.625 -0.741 -0.007 0.777 -0.529
- D 265 263 3 266 3 -6.174 -1.687 -0.566
- IL 266 266 3 266 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 89 ]
- ML 267 266 3 269 3 -13.971 -0.019 -6.263 -0.962 1.526 -2.136 -1.395
- D 268 266 3 269 3 -6.174 -1.687 -0.566
- IL 269 269 3 269 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 90 ]
- ML 270 269 3 272 2 * 0.000 1.039 -3.030 0.513 -1.334
- D 271 269 3 272 2 * 0.000
- IL 272 272 3 272 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 91 ]
- E 273 272 3 -1 0
-//
diff --git a/TRNAinf-ns-c.cm b/TRNAinf-ns-c.cm
deleted file mode 100644
index eb16491..0000000
--- a/TRNAinf-ns-c.cm
+++ /dev/null
@@ -1,404 +0,0 @@
-INFERNAL-1 [1.0]
-NAME tRNA1415G-nostruct
-STATES 274
-NODES 92
-ALPHABET 1
-ELSELF -0.08926734
-WBETA 1e-07
-NSEQ 1415
-EFFNSEQ 1415.000
-CLEN 90
-BCOM cmbuild --rf --enone -F TRNAinf-ns-nc.cm trna1415G-ns.sto
-BDATE Sun Feb 8 19:08:54 2009
-CCOM cmcalibrate --exp-hfile cmcalibrate_files/TRNAinf-ns.hfile --exp-sfile cmcalibrate_files/TRNAinf-ns.sfile --exp-qqfile cmcalibrate_files/TRNAinf-ns.qqfile --exp-ffile cmcalibrate_files/TRNAinf-ns.ffile --fil-dfile cmcalibrate_files/TRNAinf-ns.dfile -s 208 TRNAinf-ns-c.cm
-CDATE Sun Feb 8 20:30:24 2009
-NULL 0.000 0.000 0.000 0.000
-PART 1 0 100
-E-LC 0 0.49078 -12.62611 -0.78469 1500000 375887 0.002993
-E-GC 0 0.41765 -8.89028 0.64848 1500000 20146 0.018614
-E-LI 0 0.46559 -11.51012 0.52782 1500000 305685 0.003680
-E-GI 0 0.43790 -6.91908 2.16532 1500000 20030 0.018722
-E-LV 0 0.47172 -3.63429 3.80760 34250000 85962 0.029882
-E-GV 0 0.47808 -3.61099 6.00724 34250000 85034 0.010070
-E-LF 0 0.60665 1.70442 7.49428 34250000 86129 0.029824
-E-GF 0 0.49333 -1.70892 7.61160 34250000 85019 0.010071
-FT-LC 55 0.99500 10000 1500000 0
- 828.381 683.676 648.382 551.638 487.051 455.646 393.644 368.084 319.178 299.612 266.63 234.85 210.456 175.114 142.585 128.545 119.702 109.886 103.41 93.4411 81.2389 69.3969 62.3148 53.2386 50.7446 48.7088 44.4731 35.0529 31.6602 28.1016 24.3376 21.7681 20.263 19.1913 16.3107 15.1207 14.2761 12.3998 11.2004 10.4279 9.3165 3.68449 3.1511 2.56439 [...]
- 1349.3 1214.13 1082.61 968.851 869.154 763.798 659.508 586.996 511.479 458.847 397.881 353.92 316.731 284.656 255.21 228.67 205.14 182.032 162.411 145.964 131.342 115.772 103.921 93.3974 83.9902 74.9372 67.1852 58.9696 51.853 46.6585 41.8826 37.4136 33.5026 30.0551 26.9787 24.1293 21.6069 19.1847 17.2523 15.524 14.1942 11.6445 9.89123 7.85 [...]
-FT-LI 61 0.99500 10000 1500000 0
- 730.145 613.363 562.316 505.485 419.848 384.085 367.112 302.531 274.924 258.871 232.226 216.791 202.343 173.81 145.612 124.401 113.257 104.091 94.413 84.2348 72.0347 63.5166 60.6035 55.4635 51.8264 45.7608 37.8112 33.3336 31.7039 28.6252 25.7946 24.8692 22.6587 20.7227 18.5871 16.2985 15.5712 14.0906 13.4352 11.8505 11.3369 8.0177 7.31461 6.7513 [...]
- 1343.58 1190.79 1065.67 943.905 849.347 763.798 659.508 586.996 514.904 458.847 397.881 357.806 320.403 284.656 246.386 210.689 187.752 168.943 151.65 136.459 122.491 109.554 97.39 86.9453 76.8244 69.0445 62.0525 54.8958 49.0978 44.0188 39.1552 34.956 31.416 28.2346 25.4061 22.7641 20.4589 18.1873 16.2467 14.6103 14.1942 12.5315 11.2488 9.90323 [...]
-FT-GC 55 0.99500 10000 1500000 1
- 20146 5173.43 3379.23 2245.93 1487.74 1332.51 1074.51 778.898 664.417 550.594 451.233 404.656 365.616 329.337 273.841 215.146 175.661 132.26 119.913 106.551 96.5188 89.6996 74.8323 68.7454 63.5878 57.5931 52.2781 45.2188 40.1294 33.7606 31.0973 27.6475 23.8326 22.0934 20.1651 17.9638 16.9852 7.90368 7.15213 6.14099 5.59548 5.00384 4.72121 3.89203 [...]
- 704.051 609.297 547.711 486.795 434.364 381.699 339.414 304.956 273.726 245.332 216.012 188.607 167.3 149.945 134.523 119.503 106.948 95.3348 84.3563 74.4582 66.6356 59.8412 53.2907 47.6214 42.7869 38.481 34.6085 30.1881 27.1636 24.2021 21.7129 19.3934 17.3902 15.6016 14.0039 12.5636 11.3648 10.1672 9.00082 7.85893 6.74445 6.04183 5.4365 4.72111 [...]
-FT-GI 59 0.99500 10000 1500000 1
- 20030 3891.23 2110.86 1733.64 1071.72 989.149 901.971 710.174 627.136 469.001 441.797 372.657 325.842 280.263 232.646 194.586 166.599 130.733 114.122 103.102 92.9519 84.2965 74.585 67.1302 61.4245 57.9251 52.6792 45.8903 39.493 31.5045 29.5164 26.4122 24.0082 21.536 19.3965 16.6055 15.0612 10.9822 9.86983 8.94291 8.15398 7.3736 6.72621 6.06834 [...]
- 704.051 609.297 547.711 486.795 434.364 381.699 339.414 304.956 273.726 245.332 216.012 188.607 167.3 149.945 134.523 119.503 106.948 95.3348 84.3563 74.4582 66.6356 59.8412 53.2907 47.6214 42.7869 38.481 34.6256 30.1881 27.1636 24.2021 21.7129 19.3934 17.3902 15.6016 14.0039 12.545 11.3648 10.2074 9.13052 8.13908 7.31279 6.58012 5.89753 5.30666 [...]
-MODEL:
- [ ROOT 0 ]
- S 0 -1 0 1 4 -5.647 -2.578 -0.307 -7.818
- IL 1 1 2 1 4 -6.859 -1.137 -0.900 -10.028 0.000 0.000 0.000 0.000
- IR 2 2 3 2 3 -0.590 -1.580 -9.669 0.000 0.000 0.000 0.000
- [ MATL 1 ]
- ML 3 2 3 5 3 -16.502 -0.000 -15.157 -0.476 -1.314 1.308 -1.310
- D 4 2 3 5 3 -10.356 -0.056 -4.747
- IL 5 5 3 5 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 2 ]
- ML 6 5 3 8 3 -16.510 -0.000 -15.164 -0.544 0.310 0.585 -0.801
- D 7 5 3 8 3 -6.174 -1.687 -0.566
- IL 8 8 3 8 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 3 ]
- ML 9 8 3 11 3 -16.510 -0.000 -15.164 -0.396 0.076 0.344 -0.126
- D 10 8 3 11 3 -6.174 -1.687 -0.566
- IL 11 11 3 11 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 4 ]
- ML 12 11 3 14 3 -9.201 -0.003 -10.751 -0.168 -0.225 0.447 -0.167
- D 13 11 3 14 3 -6.174 -1.687 -0.566
- IL 14 14 3 14 3 -2.743 -0.273 -5.443 0.000 0.000 0.000 0.000
- [ MATL 5 ]
- ML 15 14 3 17 3 -16.509 -0.000 -15.163 0.295 -0.157 0.044 -0.243
- D 16 14 3 17 3 -7.715 -0.390 -2.107
- IL 17 17 3 17 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 6 ]
- ML 18 17 3 20 3 -10.851 -0.001 -15.164 -0.139 -0.441 -0.195 0.567
- D 19 17 3 20 3 -6.174 -1.687 -0.566
- IL 20 20 3 20 3 -1.988 -0.496 -4.688 0.000 0.000 0.000 0.000
- [ MATL 7 ]
- ML 21 20 3 23 3 -16.510 -0.004 -8.608 0.486 -2.894 0.703 -0.257
- D 22 20 3 23 3 -6.174 -1.687 -0.566
- IL 23 23 3 23 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 8 ]
- ML 24 23 3 26 3 -7.229 -0.022 -6.842 -2.035 -4.901 -2.973 1.846
- D 25 23 3 26 3 -9.461 -0.106 -3.853
- IL 26 26 3 26 3 -4.199 -0.094 -6.899 0.000 0.000 0.000 0.000
- [ MATL 9 ]
- ML 27 26 3 29 3 -6.782 -0.013 -15.151 1.370 -2.907 0.244 -3.366
- D 28 26 3 29 3 -11.126 -0.033 -5.517
- IL 29 29 3 29 3 -4.581 -0.071 -7.281 0.000 0.000 0.000 0.000
- [ MATL 10 ]
- ML 30 29 3 32 3 -16.510 -0.000 -15.164 -1.702 -2.393 1.744 -2.714
- D 31 29 3 32 3 -6.174 -1.687 -0.566
- IL 32 32 3 32 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 11 ]
- ML 33 32 3 35 3 -16.510 -0.000 -15.164 -2.916 1.111 -2.031 0.548
- D 34 32 3 35 3 -6.174 -1.687 -0.566
- IL 35 35 3 35 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 12 ]
- ML 36 35 3 38 3 -16.510 -0.000 -15.164 -0.921 -0.424 -0.513 1.019
- D 37 35 3 38 3 -6.174 -1.687 -0.566
- IL 38 38 3 38 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 13 ]
- ML 39 38 3 41 3 -16.510 -0.004 -8.402 -0.611 0.144 -0.593 0.657
- D 40 38 3 41 3 -6.174 -1.687 -0.566
- IL 41 41 3 41 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 14 ]
- ML 42 41 3 44 3 -16.505 -0.017 -6.438 1.873 -5.019 -3.121 -2.389
- D 43 41 3 44 3 -9.649 -5.162 -0.043
- IL 44 44 3 44 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 15 ]
- ML 45 44 3 47 3 -16.489 -0.260 -2.602 0.760 -2.963 0.888 -1.611
- D 46 44 3 47 3 -11.840 -7.353 -0.009
- IL 47 47 3 47 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 16 ]
- ML 48 47 3 50 3 -16.229 -1.139 -0.873 -0.871 -0.362 -2.505 1.321
- D 49 47 3 50 3 -15.430 -10.943 -0.001
- IL 50 50 3 50 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 17 ]
- ML 51 50 3 53 3 -2.064 -0.410 -6.932 -1.344 0.043 -3.899 1.327
- D 52 50 3 53 3 -17.254 -0.140 -3.439
- IL 53 53 3 53 3 -4.644 -0.060 -10.489 0.000 0.000 0.000 0.000
- [ MATL 18 ]
- ML 54 53 3 56 3 -16.419 -0.000 -15.073 -1.181 -2.707 1.649 -1.886
- D 55 53 3 56 3 -13.891 -9.404 -0.002
- IL 56 56 3 56 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 19 ]
- ML 57 56 3 59 3 -16.419 -0.319 -2.335 -1.565 -2.573 1.615 -1.218
- D 58 56 3 59 3 -13.891 -9.404 -0.002
- IL 59 59 3 59 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 20 ]
- ML 60 59 3 62 3 -0.979 -1.031 -8.141 -1.478 -1.029 -2.625 1.580
- D 61 59 3 62 3 -5.311 -0.057 -6.216
- IL 62 62 3 62 3 -2.215 -0.364 -7.102 0.000 0.000 0.000 0.000
- [ MATL 21 ]
- ML 63 62 3 65 3 -16.496 -0.000 -15.150 1.761 -3.648 -1.627 -2.270
- D 64 62 3 65 3 -11.226 -0.030 -5.618
- IL 65 65 3 65 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 22 ]
- ML 66 65 3 68 3 -16.510 -0.000 -15.164 0.879 -3.096 0.636 -1.028
- D 67 65 3 68 3 -6.174 -1.687 -0.566
- IL 68 68 3 68 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 23 ]
- ML 69 68 3 71 3 -16.510 -0.000 -15.164 1.008 -0.533 -0.343 -0.972
- D 70 68 3 71 3 -6.174 -1.687 -0.566
- IL 71 71 3 71 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 24 ]
- ML 72 71 3 74 3 -16.510 -0.000 -15.164 0.453 -1.932 1.161 -2.913
- D 73 71 3 74 3 -6.174 -1.687 -0.566
- IL 74 74 3 74 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 25 ]
- ML 75 74 3 77 3 -16.510 -0.006 -7.945 -2.659 1.485 -2.211 -0.274
- D 76 74 3 77 3 -6.174 -1.687 -0.566
- IL 77 77 3 77 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 26 ]
- ML 78 77 3 80 3 -7.293 -0.009 -15.158 0.871 -2.591 0.703 -1.403
- D 79 77 3 80 3 -10.074 -0.068 -4.466
- IL 80 80 3 80 3 -4.142 -0.097 -6.842 0.000 0.000 0.000 0.000
- [ MATL 27 ]
- ML 81 80 3 83 3 -10.025 -0.001 -15.164 -0.483 0.314 -0.967 0.613
- D 82 80 3 83 3 -6.174 -1.687 -0.566
- IL 83 83 3 83 3 -2.308 -0.383 -5.008 0.000 0.000 0.000 0.000
- [ MATL 28 ]
- ML 84 83 3 86 3 -16.510 -0.000 -15.164 -0.521 0.449 -1.302 0.616
- D 85 83 3 86 3 -6.174 -1.687 -0.566
- IL 86 86 3 86 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 29 ]
- ML 87 86 3 89 3 -16.510 -0.001 -10.125 0.160 -1.089 0.399 0.129
- D 88 86 3 89 3 -6.174 -1.687 -0.566
- IL 89 89 3 89 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 30 ]
- ML 90 89 3 92 3 -16.508 -0.000 -15.162 -0.957 -0.419 1.355 -2.480
- D 91 89 3 92 3 -8.174 -0.273 -2.566
- IL 92 92 3 92 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 31 ]
- ML 93 92 3 95 3 -16.510 -0.000 -15.164 0.574 -0.099 -0.248 -0.445
- D 94 92 3 95 3 -6.174 -1.687 -0.566
- IL 95 95 3 95 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 32 ]
- ML 96 95 3 98 3 -8.892 -0.003 -15.164 -3.426 1.205 -4.796 0.646
- D 97 95 3 98 3 -6.174 -1.687 -0.566
- IL 98 98 3 98 3 -2.936 -0.236 -5.636 0.000 0.000 0.000 0.000
- [ MATL 33 ]
- ML 99 98 3 101 3 -16.510 -0.000 -15.164 -9.794 -3.318 -10.511 1.963
- D 100 98 3 101 3 -6.174 -1.687 -0.566
- IL 101 101 3 101 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 34 ]
- ML 102 101 3 104 3 -16.510 -0.000 -15.164 -2.395 -0.665 0.411 0.887
- D 103 101 3 104 3 -6.174 -1.687 -0.566
- IL 104 104 3 104 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 35 ]
- ML 105 104 3 107 3 -16.510 -0.000 -15.164 0.200 -0.175 -0.316 0.217
- D 106 104 3 107 3 -6.174 -1.687 -0.566
- IL 107 107 3 107 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 36 ]
- ML 108 107 3 110 3 -16.510 -0.000 -15.164 0.119 -0.102 -0.270 0.205
- D 109 107 3 110 3 -6.174 -1.687 -0.566
- IL 110 110 3 110 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 37 ]
- ML 111 110 3 113 3 -5.040 -0.045 -15.164 1.609 -7.196 -0.129 -5.136
- D 112 110 3 113 3 -6.174 -1.687 -0.566
- IL 113 113 3 113 3 -0.077 -4.263 -13.157 0.000 0.000 0.000 0.000
- [ MATL 38 ]
- ML 114 113 3 116 3 -16.510 -0.000 -15.164 1.421 -0.510 -2.807 -1.067
- D 115 113 3 116 3 -6.174 -1.687 -0.566
- IL 116 116 3 116 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 39 ]
- ML 117 116 3 119 3 -16.510 -0.000 -15.164 -0.854 -0.363 0.131 0.655
- D 118 116 3 119 3 -6.174 -1.687 -0.566
- IL 119 119 3 119 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 40 ]
- ML 120 119 3 122 3 -16.510 -0.000 -15.164 -3.364 1.205 -0.313 -0.337
- D 121 119 3 122 3 -6.174 -1.687 -0.566
- IL 122 122 3 122 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 41 ]
- ML 123 122 3 125 3 -16.510 -0.000 -15.164 0.081 0.418 -1.057 0.171
- D 124 122 3 125 3 -6.174 -1.687 -0.566
- IL 125 125 3 125 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 42 ]
- ML 126 125 3 128 3 -10.989 -0.003 -9.167 0.436 -1.764 0.552 -0.173
- D 127 125 3 128 3 -6.174 -1.687 -0.566
- IL 128 128 3 128 3 -1.945 -0.514 -4.645 0.000 0.000 0.000 0.000
- [ MATL 43 ]
- ML 129 128 3 131 3 -16.507 -0.000 -15.161 0.452 -1.668 0.386 0.015
- D 130 128 3 131 3 -8.964 -0.152 -3.355
- IL 131 131 3 131 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 44 ]
- ML 132 131 3 134 3 -16.510 -0.213 -2.864 0.945 -0.909 -1.101 0.105
- D 133 131 3 134 3 -6.174 -1.687 -0.566
- IL 134 134 3 134 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 45 ]
- ML 135 134 3 137 3 -8.436 -5.633 -0.034 0.209 -2.944 1.009 -0.511
- D 136 134 3 137 3 -15.067 -0.019 -6.226
- IL 137 137 3 137 3 -3.098 -0.209 -5.798 0.000 0.000 0.000 0.000
- [ MATL 46 ]
- ML 138 137 3 140 3 -13.825 -0.056 -4.729 -0.561 -1.046 1.188 -0.839
- D 139 137 3 140 3 -17.685 -13.198 -0.000
- IL 140 140 3 140 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 47 ]
- ML 141 140 3 143 3 -13.770 -0.066 -4.479 -0.640 0.240 0.287 -0.063
- D 142 140 3 143 3 -17.695 -13.208 -0.000
- IL 143 143 3 143 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 48 ]
- ML 144 143 3 146 3 -5.529 -0.641 -1.569 -0.534 0.638 -0.254 -0.129
- D 145 143 3 146 3 -17.706 -13.219 -0.000
- IL 146 146 3 146 3 -3.321 -0.177 -6.021 0.000 0.000 0.000 0.000
- [ MATL 49 ]
- ML 147 146 3 149 3 -13.111 -0.888 -1.122 -1.800 0.474 -0.259 0.574
- D 148 146 3 149 3 -17.785 -13.298 -0.000
- IL 149 149 3 149 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 50 ]
- ML 150 149 3 152 3 -12.225 -0.676 -1.420 -0.064 -0.675 0.413 0.119
- D 151 149 3 152 3 -17.853 -13.366 -0.000
- IL 152 152 3 152 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 51 ]
- ML 153 152 3 155 3 -11.551 -1.040 -0.962 -0.051 -0.478 -0.112 0.477
- D 154 152 3 155 3 -17.882 -13.395 -0.000
- IL 155 155 3 155 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 52 ]
- ML 156 155 3 158 3 -10.514 -0.003 -9.168 -2.182 0.138 -1.596 1.232
- D 157 155 3 158 3 -17.906 -2.876 -0.211
- IL 158 158 3 158 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 53 ]
- ML 159 158 3 161 3 -13.770 -0.010 -7.152 -0.289 -1.583 0.139 0.804
- D 160 158 3 161 3 -17.695 -13.208 -0.000
- IL 161 161 3 161 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 54 ]
- ML 162 161 3 164 3 -13.760 -0.088 -4.086 0.094 -0.451 -1.987 0.963
- D 163 161 3 164 3 -17.697 -13.210 -0.000
- IL 164 164 3 164 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 55 ]
- ML 165 164 3 167 3 -5.013 -0.584 -1.729 0.935 -0.852 -2.754 0.471
- D 166 164 3 167 3 -17.711 -13.224 -0.000
- IL 167 167 3 167 3 -2.268 -0.355 -6.610 0.000 0.000 0.000 0.000
- [ MATL 56 ]
- ML 168 167 3 170 3 -1.805 -5.623 -0.528 0.723 -1.172 0.113 -0.280
- D 169 167 3 170 3 -17.780 -7.730 -0.007
- IL 170 170 3 170 3 -6.101 -1.520 -0.651 0.000 0.000 0.000 0.000
- [ MATL 57 ]
- ML 171 170 3 173 3 -10.514 -0.003 -9.168 0.482 -2.966 1.029 -1.203
- D 172 170 3 173 3 -17.906 -5.893 -0.024
- IL 173 173 3 173 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 58 ]
- ML 174 173 3 176 3 -11.551 -0.079 -4.243 -0.509 -0.366 0.327 0.341
- D 175 173 3 176 3 -17.882 -5.653 -0.029
- IL 176 176 3 176 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 59 ]
- ML 177 176 3 179 3 -12.177 -0.001 -10.831 -0.046 -0.091 -0.544 0.492
- D 178 176 3 179 3 -17.855 -4.446 -0.068
- IL 179 179 3 179 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 60 ]
- ML 180 179 3 182 3 -6.502 -0.016 -11.740 -0.017 -0.149 0.797 -1.429
- D 181 179 3 182 3 -17.788 -4.232 -0.079
- IL 182 182 3 182 3 -2.354 -0.369 -5.054 0.000 0.000 0.000 0.000
- [ MATL 61 ]
- ML 183 182 3 185 3 -13.687 -0.000 -12.341 -0.355 -0.499 0.726 -0.224
- D 184 182 3 185 3 -17.709 -6.986 -0.011
- IL 185 185 3 185 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 62 ]
- ML 186 185 3 188 3 -13.754 -0.000 -12.408 -0.137 0.282 0.272 -0.585
- D 187 185 3 188 3 -17.698 -13.211 -0.000
- IL 188 188 3 188 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 63 ]
- ML 189 188 3 191 3 -13.754 -0.449 -1.902 -1.315 0.984 -0.560 -0.087
- D 190 188 3 191 3 -17.698 -0.014 -6.691
- IL 191 191 3 191 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 64 ]
- ML 192 191 3 194 3 -1.100 -0.910 -9.578 0.539 -3.489 0.896 -0.742
- D 193 191 3 194 3 -5.057 -0.050 -7.937
- IL 194 194 3 194 3 -5.401 -0.035 -12.774 0.000 0.000 0.000 0.000
- [ MATL 65 ]
- ML 195 194 3 197 3 -16.508 -0.000 -15.162 -1.725 0.910 -2.834 0.747
- D 196 194 3 197 3 -8.555 -0.205 -2.947
- IL 197 197 3 197 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 66 ]
- ML 198 197 3 200 3 -16.510 -0.000 -15.164 0.226 -0.719 0.939 -1.709
- D 199 197 3 200 3 -6.174 -1.687 -0.566
- IL 200 200 3 200 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 67 ]
- ML 201 200 3 203 3 -16.510 -0.000 -15.164 -0.254 0.230 -0.307 0.239
- D 202 200 3 203 3 -6.174 -1.687 -0.566
- IL 203 203 3 203 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 68 ]
- ML 204 203 3 206 3 -8.047 -0.023 -6.372 0.295 -0.927 0.618 -0.489
- D 205 203 3 206 3 -6.174 -1.687 -0.566
- IL 206 206 3 206 3 -3.536 -0.151 -6.236 0.000 0.000 0.000 0.000
- [ MATL 69 ]
- ML 207 206 3 209 3 -16.492 -0.098 -3.925 -0.175 -3.230 1.453 -1.894
- D 208 206 3 209 3 -11.587 -7.100 -0.011
- IL 209 209 3 209 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 70 ]
- ML 210 209 3 212 3 -16.394 -0.061 -4.604 -1.936 -3.562 1.825 -3.183
- D 211 209 3 212 3 -14.236 -0.892 -1.117
- IL 212 212 3 212 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 71 ]
- ML 213 212 3 215 3 -10.928 -0.001 -12.013 -1.929 -2.701 -3.856 1.813
- D 214 212 3 215 3 -14.166 -0.088 -4.081
- IL 215 215 3 215 3 -1.931 -0.520 -4.631 0.000 0.000 0.000 0.000
- [ MATL 72 ]
- ML 216 215 3 218 3 -16.503 -0.003 -8.936 -2.119 -3.122 -1.967 1.765
- D 217 215 3 218 3 -10.178 -0.063 -4.570
- IL 218 218 3 218 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 73 ]
- ML 219 218 3 221 3 -16.507 -0.002 -9.836 -0.819 1.547 -3.433 -1.258
- D 220 218 3 221 3 -9.161 -0.131 -3.553
- IL 221 221 3 221 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 74 ]
- ML 222 221 3 224 3 -7.363 -0.027 -6.334 0.774 -2.691 0.903 -1.915
- D 223 221 3 224 3 -8.400 -0.230 -2.791
- IL 224 224 3 224 3 -4.087 -0.101 -6.787 0.000 0.000 0.000 0.000
- [ MATL 75 ]
- ML 225 224 3 227 3 -16.492 -0.081 -4.192 1.833 -3.456 -3.499 -1.953
- D 226 224 3 227 3 -11.623 -7.136 -0.011
- IL 227 227 3 227 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 76 ]
- ML 228 227 3 230 3 -6.078 -0.150 -3.576 0.776 -1.355 -0.284 0.105
- D 229 227 3 230 3 -14.021 -5.762 -0.027
- IL 230 230 3 230 3 -2.594 -0.268 -8.060 0.000 0.000 0.000 0.000
- [ MATL 77 ]
- ML 231 230 3 233 3 -16.286 -0.029 -5.633 -2.332 -0.701 -3.752 1.638
- D 232 230 3 233 3 -15.130 -0.775 -1.267
- IL 233 233 3 233 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 78 ]
- ML 234 233 3 236 3 -16.394 -0.000 -15.048 -3.411 1.836 -4.318 -1.806
- D 235 233 3 236 3 -14.230 -0.250 -2.654
- IL 236 236 3 236 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 79 ]
- ML 237 236 3 239 3 -9.824 -0.002 -15.146 -2.110 1.441 -2.868 -0.125
- D 238 236 3 239 3 -11.587 -0.024 -5.979
- IL 239 239 3 239 3 -2.395 -0.357 -5.095 0.000 0.000 0.000 0.000
- [ MATL 80 ]
- ML 240 239 3 242 3 -16.510 -0.000 -15.164 -0.784 0.532 -0.660 0.422
- D 241 239 3 242 3 -6.174 -1.687 -0.566
- IL 242 242 3 242 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 81 ]
- ML 243 242 3 245 3 -8.023 -0.006 -15.164 -0.007 -0.634 0.377 0.087
- D 244 242 3 245 3 -6.174 -1.687 -0.566
- IL 245 245 3 245 3 -3.555 -0.149 -6.255 0.000 0.000 0.000 0.000
- [ MATL 82 ]
- ML 246 245 3 248 3 -7.751 -0.008 -9.740 -2.070 0.584 -0.617 0.688
- D 247 245 3 248 3 -6.174 -1.687 -0.566
- IL 248 248 3 248 3 -3.769 -0.128 -6.469 0.000 0.000 0.000 0.000
- [ MATL 83 ]
- ML 249 248 3 251 3 -16.508 -0.000 -15.162 -0.278 0.549 -2.855 0.655
- D 250 248 3 251 3 -8.480 -0.217 -2.872
- IL 251 251 3 251 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 84 ]
- ML 252 251 3 254 3 -16.510 -0.000 -15.164 0.187 -0.372 -0.033 0.152
- D 253 251 3 254 3 -6.174 -1.687 -0.566
- IL 254 254 3 254 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 85 ]
- ML 255 254 3 257 3 -16.510 -0.000 -15.164 -0.530 -0.228 0.058 0.498
- D 256 254 3 257 3 -6.174 -1.687 -0.566
- IL 257 257 3 257 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 86 ]
- ML 258 257 3 260 3 -16.510 -0.000 -15.164 -0.403 0.272 0.007 0.045
- D 259 257 3 260 3 -6.174 -1.687 -0.566
- IL 260 260 3 260 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 87 ]
- ML 261 260 3 263 3 -16.510 -0.000 -15.164 -0.229 0.154 0.157 -0.121
- D 262 260 3 263 3 -6.174 -1.687 -0.566
- IL 263 263 3 263 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 88 ]
- ML 264 263 3 266 3 -16.510 -0.000 -15.164 -0.877 0.403 0.326 -0.185
- D 265 263 3 266 3 -6.174 -1.687 -0.566
- IL 266 266 3 266 3 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000
- [ MATL 89 ]
- ML 267 266 3 269 3 -8.999 -0.019 -6.512 -1.402 1.082 -1.350 0.154
- D 268 266 3 269 3 -6.174 -1.687 -0.566
- IL 269 269 3 269 3 -2.867 -0.248 -5.568 0.000 0.000 0.000 0.000
- [ MATL 90 ]
- ML 270 269 3 272 2 * 0.000 1.100 -2.060 -0.143 -0.494
- D 271 269 3 272 2 * 0.000
- IL 272 272 3 272 2 -1.823 -0.479 0.000 0.000 0.000 0.000
- [ END 91 ]
- E 273 272 3 -1 0
-//
diff --git a/debug.c b/debug.c
index 3782fcd..0d75c5b 100644
--- a/debug.c
+++ b/debug.c
@@ -131,7 +131,7 @@ PrintTrace(FILE *fp, struct trace_s *tr)
while ((currtr = PopTracestack(stack)) != NULL)
{
- fprintf(fp, "(%p) %3d %3d %3d %3d %p %p %p %s\n",
+ fprintf(fp, "(%#12x) %3d %3d %3d %3d %#10x %#10x %#10x %s\n",
currtr,
currtr->emitl, currtr->emitr,
currtr->nodeidx, currtr->type,
diff --git a/fasta2gsi.pl b/fasta2gsi.pl
old mode 100644
new mode 100755
diff --git a/gnuregex.c b/gnuregex.c
index 4cc9a63..68b938f 100644
--- a/gnuregex.c
+++ b/gnuregex.c
@@ -3749,7 +3749,7 @@ re_match_2 (bufp, string1, size1, string2, size2, pos, regs, stop)
regstart[r] = old_regstart[r];
/* xx why this test? */
- if ((long) old_regend[r] >= (long) regstart[r])
+ if ((int) old_regend[r] >= (int) regstart[r])
regend[r] = old_regend[r];
}
}
diff --git a/pavesi.c b/pavesi.c
index 1e9884a..e783c8a 100644
--- a/pavesi.c
+++ b/pavesi.c
@@ -459,13 +459,13 @@ Save_tRNA (TRNA_TYPE *tRNA, SQINFO *sqinfo, char *seq, int strand,
{
if (ShowScores)
- printf("%s.%d\t%ld\t%ld\t%s\t%d\tA:%.2f B:%.2f AB:%.2f T:%.2f Tot:%.2f\n",
+ printf("%s.%d\t%d\t%d\t%s\t%d\tA:%.2f B:%.2f AB:%.2f T:%.2f Tot:%.2f\n",
sqinfo->name,tRNA->idno,tRNA->start+sqoffset,tRNA->end+sqoffset,
tRNA->acodon,strand, tRNA->AboxSc,tRNA->BboxSc,tRNA->ABdistSc,
tRNA->TermSc,tRNA->totSc);
else
- printf("%-10s\t%d\t%ld\t%ld\t%s\t%s\t0\t0\t%.2f\n",
+ printf("%-10s\t%d\t%d\t%d\t%s\t%s\t0\t0\t%.2f\n",
sqinfo->name,tRNA->idno,tRNA->start+sqoffset,tRNA->end+sqoffset,
tRNA->iso_type,tRNA->acodon,tRNA->totSc);
diff --git a/save.c b/save.c
index 6a37015..c97aa08 100644
--- a/save.c
+++ b/save.c
@@ -210,11 +210,10 @@ read_cm20(FILE *fp, struct cm_s **ret_cm)
struct cm_s *cm;
int i, j, k;
int nodes;
- int ret = 0;
/* header info */
- ret = fscanf(fp, "%d \tnodes\n", &nodes);
+ fscanf(fp, "%d \tnodes\n", &nodes);
/* Given that header info, alloc for a model.
*/
@@ -224,42 +223,42 @@ read_cm20(FILE *fp, struct cm_s **ret_cm)
/* over all nodes, 0..nodes-1 */
for (k = 0; k < nodes; k++)
{
- ret = fscanf(fp, "### node %*d");
- ret = fscanf(fp, " type %d\n", &cm->nd[k].type);
- ret = fscanf(fp, "%d %d\n", &cm->nd[k].nxt, &cm->nd[k].nxt2);
+ fscanf(fp, "### node %*d");
+ fscanf(fp, " type %d\n", &cm->nd[k].type);
+ fscanf(fp, "%d %d\n", &cm->nd[k].nxt, &cm->nd[k].nxt2);
/* transitions */
for (i = 0; i < STATETYPES; i++)
{
for (j = 0; j < STATETYPES; j++)
- ret = fscanf(fp, "%lf ", &cm->nd[k].tmx[i][j]);
- ret = fscanf(fp, "\n");
+ fscanf(fp, "%lf ", &cm->nd[k].tmx[i][j]);
+ fscanf(fp, "\n");
}
/* INSL emissions */
for (i = 0; i < ALPHASIZE; i++)
- ret = fscanf(fp, "%lf ", &cm->nd[k].il_emit[i]);
- ret = fscanf(fp, "# INSL\n");
+ fscanf(fp, "%lf ", &cm->nd[k].il_emit[i]);
+ fscanf(fp, "# INSL\n");
/* INSR emissions */
for (i = 0; i < ALPHASIZE; i++)
- ret = fscanf(fp, "%lf ", &cm->nd[k].ir_emit[i]);
- ret = fscanf(fp, "# INSR\n");
+ fscanf(fp, "%lf ", &cm->nd[k].ir_emit[i]);
+ fscanf(fp, "# INSR\n");
/* MATP emissions */
for (i = 0; i < ALPHASIZE; i++)
{
for (j = 0; j < ALPHASIZE; j++)
- ret = fscanf(fp, "%lf ", &cm->nd[k].mp_emit[i][j]);
- ret = fscanf(fp, "# MATP\n");
+ fscanf(fp, "%lf ", &cm->nd[k].mp_emit[i][j]);
+ fscanf(fp, "# MATP\n");
}
/* MATL emissions */
for (i = 0; i < ALPHASIZE; i++)
- ret = fscanf(fp, "%lf ", &cm->nd[k].ml_emit[i]);
- ret = fscanf(fp, "# MATL\n");
+ fscanf(fp, "%lf ", &cm->nd[k].ml_emit[i]);
+ fscanf(fp, "# MATL\n");
/* MATR emissions */
for (i = 0; i < ALPHASIZE; i++)
- ret = fscanf(fp, "%lf ", &cm->nd[k].mr_emit[i]);
- ret = fscanf(fp, "# MATR\n");
+ fscanf(fp, "%lf ", &cm->nd[k].mr_emit[i]);
+ fscanf(fp, "# MATR\n");
}
*ret_cm = cm;
return 1;
diff --git a/scorestack.c b/scorestack.c
index 7c00b73..e0f2dc7 100644
--- a/scorestack.c
+++ b/scorestack.c
@@ -244,7 +244,7 @@ free_hitstack(struct hitstack_s *hstack)
int left, right;
double score;
- while (pop_hitstack(hstack, &left, &right, &score) != 0)
+ while (pop_hitstack(hstack, &left, &right, &score) != NULL)
; /* do nothing */
free(hstack);
}
diff --git a/sqio.c b/sqio.c
index 7c4ae18..e46dd05 100644
--- a/sqio.c
+++ b/sqio.c
@@ -235,7 +235,7 @@ readline(FILE *f, char *s)
}
static void
-GetLine(struct ReadSeqVars *V)
+getline(struct ReadSeqVars *V)
{
readline(V->f, V->sbuffer);
}
@@ -306,7 +306,7 @@ readLoop(int addfirst, int (*endTest)(char *,int *), struct ReadSeqVars *V)
V->seqlen = 0;
if (addfirst) addseq(V->sbuffer, V);
do {
- GetLine(V);
+ getline(V);
done = feof(V->f);
done |= (*endTest)(V->sbuffer, &addend);
if (addend || !done)
@@ -332,7 +332,7 @@ readPIR(struct ReadSeqVars *V)
char *sptr;
/* load first line of entry */
while (!feof(V->f) && strncmp(V->sbuffer, "ENTRY", 5) != 0)
- GetLine(V);
+ getline(V);
if (feof(V->f)) return;
if ((sptr = strtok(V->sbuffer + 15, "\n\t ")) != NULL)
@@ -341,7 +341,7 @@ readPIR(struct ReadSeqVars *V)
SetSeqinfoString(V->sqinfo, sptr, SQINFO_ID);
}
do {
- GetLine(V);
+ getline(V);
if (!feof(V->f) && strncmp(V->sbuffer, "TITLE", 5) == 0)
SetSeqinfoString(V->sqinfo, V->sbuffer+15, SQINFO_DESC);
else if (!feof(V->f) && strncmp(V->sbuffer, "ACCESSION", 9) == 0)
@@ -350,7 +350,7 @@ readPIR(struct ReadSeqVars *V)
SetSeqinfoString(V->sqinfo, sptr, SQINFO_ACC);
}
} while (! feof(V->f) && (strncmp(V->sbuffer,"SEQUENCE", 8) != 0));
- GetLine(V); /* skip next line, coords */
+ getline(V); /* skip next line, coords */
readLoop(0, endPIR, V);
@@ -364,7 +364,7 @@ readPIR(struct ReadSeqVars *V)
/* get next line
*/
while (!feof(V->f) && strncmp(V->sbuffer, "ENTRY", 5) != 0)
- GetLine(V);
+ getline(V);
}
@@ -382,7 +382,7 @@ readIG(struct ReadSeqVars *V)
char *nm;
/* position past ';' comments */
do {
- GetLine(V);
+ getline(V);
} while (! (feof(V->f) || ((*V->sbuffer != 0) && (*V->sbuffer != ';')) ));
if (!feof(V->f))
@@ -394,7 +394,7 @@ readIG(struct ReadSeqVars *V)
}
while (!(feof(V->f) || ((*V->sbuffer != '\0') && (*V->sbuffer == ';'))))
- GetLine(V);
+ getline(V);
}
static int
@@ -416,7 +416,7 @@ readStrider(struct ReadSeqVars *V)
if ((nm = strtok(V->sbuffer+16, ",\n\t ")) != NULL)
SetSeqinfoString(V->sqinfo, nm, SQINFO_NAME);
}
- GetLine(V);
+ getline(V);
}
if (! feof(V->f))
@@ -425,7 +425,7 @@ readStrider(struct ReadSeqVars *V)
/* load next line
*/
while ((!feof(V->f)) && (*V->sbuffer != ';'))
- GetLine(V);
+ getline(V);
}
@@ -443,7 +443,7 @@ readGenBank(struct ReadSeqVars *V)
int in_definition;
while (strncmp(V->sbuffer, "LOCUS", 5) != 0)
- GetLine(V);
+ getline(V);
if ((sptr = strtok(V->sbuffer+12, "\n\t ")) != NULL)
{
@@ -454,7 +454,7 @@ readGenBank(struct ReadSeqVars *V)
in_definition = FALSE;
while (! feof(V->f))
{
- GetLine(V);
+ getline(V);
if (! feof(V->f) && strstr(V->sbuffer, "DEFINITION") == V->sbuffer)
{
if ((sptr = strtok(V->sbuffer+12, "\n")) != NULL)
@@ -487,11 +487,11 @@ readGenBank(struct ReadSeqVars *V)
while (!(feof(V->f) || ((*V->sbuffer!=0) && (strstr(V->sbuffer,"LOCUS") == V->sbuffer))))
- GetLine(V);
+ getline(V);
/* SRE: V->s now holds "//", so sequential
reads are wedged: fixed Tue Jul 13 1993 */
while (!feof(V->f) && strstr(V->sbuffer, "LOCUS ") != V->sbuffer)
- GetLine(V);
+ getline(V);
}
static int
@@ -521,12 +521,12 @@ readNBRF(struct ReadSeqVars *V)
if ((sptr = strtok(V->sbuffer+4, "\n\t ")) != NULL)
SetSeqinfoString(V->sqinfo, sptr, SQINFO_NAME);
- GetLine(V); /*skip title-junk line*/
+ getline(V); /*skip title-junk line*/
readLoop(0, endNBRF, V);
while (!(feof(V->f) || (*V->sbuffer != 0 && *V->sbuffer == '>')))
- GetLine(V);
+ getline(V);
}
@@ -559,7 +559,7 @@ readGCGdata(struct ReadSeqVars *V)
} else Die("bogus GCGdata format? %s", V->sbuffer);
/* second line contains free text description */
- GetLine(V);
+ getline(V);
SetSeqinfoString(V->sqinfo, V->sbuffer, SQINFO_DESC);
if (binary) {
@@ -579,7 +579,7 @@ readGCGdata(struct ReadSeqVars *V)
else readLoop(0, endGCGdata, V);
while (!(feof(V->f) || ((*V->sbuffer != 0) && (*V->sbuffer == '>'))))
- GetLine(V);
+ getline(V);
}
static int
@@ -625,7 +625,7 @@ readPearson(struct ReadSeqVars *V)
readLoop(0, endPearson, V);
while (!(feof(V->f) || ((*V->sbuffer != 0) && (*V->sbuffer == '>'))))
- GetLine(V);
+ getline(V);
}
@@ -652,7 +652,7 @@ readEMBL(struct ReadSeqVars *V)
/* make sure we have first line */
while (!feof(V->f) && strncmp(V->sbuffer, "ID ", 4) != 0)
- GetLine(V);
+ getline(V);
if ((sptr = strtok(V->sbuffer+5, "\n\t ")) != NULL)
{
@@ -661,7 +661,7 @@ readEMBL(struct ReadSeqVars *V)
}
do {
- GetLine(V);
+ getline(V);
if (!feof(V->f) && strstr(V->sbuffer, "AC ") == V->sbuffer)
{
if ((sptr = strtok(V->sbuffer+5, "; \t\n")) != NULL)
@@ -685,7 +685,7 @@ readEMBL(struct ReadSeqVars *V)
/* load next record's ID line */
while (!feof(V->f) && strncmp(V->sbuffer, "ID ", 4) != 0)
- GetLine(V);
+ getline(V);
}
@@ -701,7 +701,7 @@ readZuker(struct ReadSeqVars *V)
{
char *sptr;
- GetLine(V); /*s == "seqLen seqid string..."*/
+ getline(V); /*s == "seqLen seqid string..."*/
if ((sptr = strtok(V->sbuffer+6, " \t\n")) != NULL)
SetSeqinfoString(V->sqinfo, sptr, SQINFO_NAME);
@@ -712,7 +712,7 @@ readZuker(struct ReadSeqVars *V)
readLoop(0, endZuker, V);
while (!(feof(V->f) | ((*V->sbuffer != '\0') & (*V->sbuffer == '('))))
- GetLine(V);
+ getline(V);
}
static void
@@ -734,7 +734,7 @@ readUWGCG(struct ReadSeqVars *V)
do {
done = feof(V->f);
- GetLine(V);
+ getline(V);
if (! done) addseq(V->sbuffer, V);
} while (!done);
}
@@ -746,7 +746,7 @@ readSquid(struct ReadSeqVars *V)
char *sptr;
int dostruc = FALSE;
- while (strncmp(V->sbuffer, "NAM ", 4) != 0) GetLine(V);
+ while (strncmp(V->sbuffer, "NAM ", 4) != 0) getline(V);
if ((sptr = strtok(V->sbuffer+4, "\n\t ")) != NULL)
SetSeqinfoString(V->sqinfo, sptr, SQINFO_NAME);
@@ -754,7 +754,7 @@ readSquid(struct ReadSeqVars *V)
/*CONSTCOND*/
while (1)
{
- GetLine(V);
+ getline(V);
if (feof(V->f)) {squid_errno = SQERR_FORMAT; return; }
if (strncmp(V->sbuffer, "SRC ", 4) == 0)
@@ -786,14 +786,14 @@ readSquid(struct ReadSeqVars *V)
while (1)
{
/* sequence line */
- GetLine(V);
+ getline(V);
if (feof(V->f) || strncmp(V->sbuffer, "++", 2) == 0)
break;
addseq(V->sbuffer, V);
/* structure line */
if (dostruc)
{
- GetLine(V);
+ getline(V);
if (feof(V->f)) { squid_errno = SQERR_FORMAT; return; }
addstruc(V->sbuffer, V);
}
@@ -801,7 +801,7 @@ readSquid(struct ReadSeqVars *V)
while (!feof(V->f) && strncmp(V->sbuffer, "NAM ", 4) != 0)
- GetLine(V);
+ getline(V);
}
@@ -848,7 +848,7 @@ SeqfileOpen(char *filename, int format, char *env)
/* Load the first line.
*/
- GetLine(dbfp);
+ getline(dbfp);
return dbfp;
}
@@ -862,7 +862,7 @@ void
SeqfilePosition(SQFILE *sqfp, long offset)
{
fseek(sqfp->f, offset, SEEK_SET);
- GetLine(sqfp);
+ getline(sqfp);
}
@@ -954,7 +954,7 @@ ReadSeq(SQFILE *V, int format, char **ret_seq, SQINFO *sqinfo)
do { /* skip leading comments on GCG file */
gotuw = (strstr(V->sbuffer,"..") != NULL);
if (gotuw) readUWGCG(V);
- GetLine(V);
+ getline(V);
} while (! feof(V->f));
break;
diff --git a/sstofa.pl b/sstofa.pl
old mode 100644
new mode 100755
diff --git a/tRNAscan-SE.src b/tRNAscan-SE.src
index 7b645d8..c8a18ef 100644
--- a/tRNAscan-SE.src
+++ b/tRNAscan-SE.src
@@ -1,430 +1,455 @@
#! /usr/bin/perl
#
-# --------------------------------------------------------------------
+# --------------------------------------------------------------
# tRNAscan-SE: a program for improved detection of transfer RNA
# genes in genomic sequence
#
-# Version 1.3.1
+# Todd Lowe (1) & Sean Eddy (2)
#
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-#
-# School of Engineering, University of California, Santa Cruz
+# (1) School of Engineering, University of California, Santa Cruz
# lowe at soe.ucsc.edu
# http://lowelab.ucsc.edu/
-# --------------------------------------------------------------------
+#
+# (2) Dept. of Genetics, Washington U. School of Medicine, St. Louis
+# --------------------------------------------------------------
#
# Algorithm & performance published in
# Lowe, T.M. & Eddy, S.R.,
# Nucl. Acids Res. 25, 955-964, 1997.
#
-# --------------------------------------------------------------------
+# Current release: 1.23 (Apr 2002)
+# Copyright (C) 1996-2002 Todd M. Lowe & Sean R. Eddy
+#
#
-# Usage:
# tRNAscan-SE [options] <FASTA file(s)>
#
+$version = ""; # set when built by 'make'
+$release_date = ""; # set when built by 'make'
+$program_id = "tRNAscan-SE-".$version;
-use strict;
-use Getopt::Long;
-use tRNAscanSE::Utils;
-use tRNAscanSE::Constants;
-use tRNAscanSE::GeneticCode;
-use tRNAscanSE::Options;
-use tRNAscanSE::Eufind;
-use tRNAscanSE::Tscan;
-use tRNAscanSE::CM;
-use tRNAscanSE::LogFile;
-use tRNAscanSE::Stats;
-use tRNAscanSE::Sequence;
-use tRNAscanSE::ScanResult;
-use tRNAscanSE::SS;
-
-# set when built by 'make'
-our $version = "";
-our $release_date = "";
-our $program_id = "tRNAscan-SE-".$version;
-# modified by 'make'
-our $bindir = "";
-our $lib_dir = "/usr/local/lib/tRNAscanSE/";
-our $temp_dir = "/tmp";
-
-# set location of temp files
-if ($ENV{TMPDIR}) {
- $temp_dir = $ENV{TMPDIR};
-}
-
-# Global variables
-our @fp_start_time;
-our $constants = tRNAscanSE::Constants->new;
-our $opts = tRNAscanSE::Options->new;
-our $log = tRNAscanSE::LogFile->new;
-our $eufind = tRNAscanSE::Eufind->new;
-our $tscan = tRNAscanSE::Tscan->new;
-our $cm = tRNAscanSE::CM->new;
-our $gc = tRNAscanSE::GeneticCode->new;
-our $stats = tRNAscan::Stats->new;
-our $seq_file = tRNAscanSE::Sequence->new;
-
-# Signal handling
-$SIG{'TERM'} = 'error_handler';
-$SIG{'QUIT'} = 'error_handler';
-$SIG{'INT'} = 'error_handler';
-
-&set_options(); # set user-selectable options
-
-# set location of binaries & data files,
-# plus, check to make sure they are there
-$cm->set_file_paths($opts);
-$cm->check_lib_files($opts, $lib_dir);
-$cm->set_bin($bindir);
-$eufind->set_bin($bindir);
-$tscan->set_bin($bindir);
-
-# initialize variables
-$constants->set_temp_file_names($temp_dir);
-$gc->read_transl_table($opts);
-if ($opts->save_stats()) {
- $stats->file_name($opts->stats_file());
-}
-
-my @prescan_tRNAs = ();
-
-my %global_vars = ('constants' => $constants,
- 'opts' => $opts,
- 'cm' => $cm);
-
-# Start processing
-&initialize_process();
-if ($opts->tscan_mode() || $opts->eufind_mode()) {
- &first_pass_prescan();
-} # (prescan with either tRNAscan/eufind or both)
-
-# Check to see if no sequences were read from input file(s)
-if (($stats->numscanned() == 0) && ($opts->eufind_mode() || $opts->tscan_mode())) {
- if ($opts->seq_key() ne '\S*') {
- die "\nNo FASTA sequences matching \'".$opts->raw_seq_key()."\' key found\n\n";
- }
- elsif ($opts->multiple_files()) {
- die "\nFATAL: No sequences in FASTA format found in ", join(', ', at ARGV),"\n\n"; }
- else {
- die "\nFATAL: No sequences in FASTA format found in file ".$opts->fastafile()."\n\n";
- }
-}
+&Set_defaults(*Cutoff,*Max_tRNA_length,*Max_Cove_tRNA_length,*Min_intron_length,
+ *tscan_version,*temp_dir,*Min_pseudo_filter_score,
+ *Min_ss_score,*Min_hmm_score,*MaxSeqBuffer,*SeqBufOverlap,
+ *ReallyBigNumber,*SeqIndexInc);
-# Run Cove or Infernal on candidate tRNAs picked in first pass,
-# or by itself on seqs if no first pass searches
-elsif ($opts->cove_mode() || $opts->infernal_mode()) {
- &run_cm_scan();
-} # if Using second-pass scanner
+&Set_options(); # set user-selectable options
-$stats->end_sp_timer();
-if ($opts->save_stats()) {
- $stats->open_file();
- $stats->save_final_stats($opts, $gc, \@prescan_tRNAs, $cm->tab_results());
- $stats->close_file();
+# set location of binaries & data files,
+# plus, check to make sure they are there
+
+&Set_file_paths(*Main_cm_file,*MainNS_cm_file,*Pselc_cm_file,*Eselc_cm_file,
+ *lib_dir,*covels_bin,*coves_bin,*eufind_bin,*tscan_bin,
+ $tscan_version);
+
+# Initialize globals - counters, temp file names, & translation maps
+
+&Initialize_vars(*seqs_hit,*numscanned,*trna_total,
+ *first_pass_base_ct,*fpass_trna_base_ct,*fpos_base_ct,
+ *covels_base_ct,*coves_base_ct,*total_covels_ct,
+ *tmp_raw,*tmp_fa,*tmp_trnaseq,*printed_header,*ruler,
+ *CompMap,*AmbigTransMap,*TransMap,
+ *OneLetTransMap,$alt_gcode,$gc_file,
+ *Tscan_mask, *Eufind_mask, *SourceTab);
+
+# print program info header, credits, & selected run options
+
+if (!($quiet_mode)) {
+ print STDERR "\ntRNAscan-SE v.$version ($release_date) -",
+ " scan sequences for transfer RNAs\n";
+ &display_credits();
+ &display_run_options(STDERR);
}
-$log->close_file();
-
-&cleanup(); # clean up temp files
-exit(0);
-
-# END main
+ at fp_start_time = (times)[0,2,1,3]; # save starting time
+$host_name = "".$ENV{HOST};
+# if statistics are being saved, write run options in stats file
-sub initialize_process {
-
- # print program info header, credits, & selected run options
- if (!$opts->quiet_mode()) {
- print STDERR "\ntRNAscan-SE v.$version ($release_date) -",
- " scan sequences for transfer RNAs\n";
- &display_credits();
- $opts->display_run_options($cm, $tscan, $eufind, *STDERR);
- }
-
- $stats->start_fp_timer(); # save starting time
-
- # if statistics are being saved, write run options in stats file
- if ($opts->save_stats()) {
- my $host = `hostname`;
- chomp($host);
- $stats->open_file();
- $stats->write_line("\ntRNAscan-SE v.$version ($release_date) scan results (on host $host)\nStarted: ".`date`);
- $opts->display_run_options($cm, $tscan, $eufind, $stats->FILE_H());
- $stats->close_file();
- }
+if ($save_stats) {
+ &open_for_append(STATS,$stats_file);
+ print STATS "\ntRNAscan-SE v.$version ($release_date) scan results (on host $host_name)\n",
+ "Started: ",`date`,"\n";
+ &display_run_options(STATS);
+ close STATS;
}
# Running tRNAscan and/or EufindtRNA
-sub first_pass_prescan {
-
- $log->write_line("\nPhase I: Searching for tRNAs with tRNAscan and/or EufindtRNA\n");
- # open seq file to search
- $seq_file->open_file($opts->fasta_file(), "read");
+if ($Tscan_mode || $Eufind_mode) {
+
+ print LOGFILE "\nPhase I: Searching for tRNAs with ",
+ "tRNAscan and/or EufindtRNA\n\n";
+
+ # open seq file to search
+ &open_fasta($fastafile,SEQFILE);
# Main loop for reading seqs & scanning with tRNAscan and/or
# EufindtRNA
-
- my $targ_seq_id = 0; # Don't look for a specific Seq number
- my $start_index = 1;
- my $sequence_scanned = 0;
- my $eufind_output;
- my @hit_list = ();
- my $tmp_raw = $constants->tmp_raw();
- my $tmp_fa = $constants->tmp_fa();
- my $tmp_fa_file = tRNAscanSE::Sequence->new;
- my $missing_fa_file = tRNAscanSE::Sequence->new;
-
- while ($seq_file->read_fasta($opts, $targ_seq_id)) {
- if ($opts->cove_mode() || $opts->infernal_mode()) {
- $log->write_line("Scanned seqs: ".$stats->numscanned()." (at ".$seq_file->seq_name().")");
- }
- $stats->increment_numscanned();
- $stats->increment_first_pass_base_ct($seq_file->seq_length());
-
- do {
- # Write one input sequence / seq buffer to tmp_fa file
-
- $tmp_fa_file->open_file($tmp_fa, "write");
- $tmp_fa_file->set_seq_info($seq_file->seq_name(), $seq_file->seq_description(),
- $seq_file->seq_length(), $seq_file->sequence());
- $tmp_fa_file->write_fasta();
- $tmp_fa_file->close_file();
-
- # Run tRNAscan on $tmp_fa file & write results to
- # $tmp_raw output file
-
- if ($opts->tscan_mode()) {
- $tscan->run_tRNAscan($tmp_fa, $tmp_raw,
- $start_index, $lib_dir, $seq_file->seq_name());
- if ($opts->save_verbose()) {
- $tscan->append_verbfile($opts->verb_file(), $tmp_fa, $seq_file->seq_name());
- }
- $tscan->process_tRNAscan_hits($constants, $gc, $stats, $seq_file->seq_name(), \@hit_list);
- }
-
- # Run eufindtRNA program & save results in memory
- # in $Eufind_output array
-
- if ($opts->eufind_mode()) {
- $eufind_output = $eufind->run_eufind($tmp_fa, $start_index,
- $opts->max_int_len(), $seq_file->seq_name());
- if ($eufind_output ne "") {
- $eufind->process_Eufind_hits($constants, $stats, \@hit_list, $eufind_output);
- $eufind_output = "";
- }
- }
-
- $sequence_scanned = 1; # Flag indicating current sequence has been scanned
-
- # Check to see if all of sequence was read in last buffer-sized chunck
-
- if ($seq_file->seq_buf_overrun()) {
- $start_index = $seq_file->buffer_end_index() + 1;
- if ($seq_file->read_more_fasta()) {
- $sequence_scanned = 0;
- }
- }
-
- } until ($sequence_scanned);
-
- if ($#hit_list >= 0) {
- $stats->increment_seqs_hit();
-
- # save results in ACeDB format now if not
- # using Cove analysis
- if ($opts->ace_output() && (!$opts->CM_mode())) {
- &save_Acedb_from_firstpass($opts->output_codon(), $gc->one_let_trans_map(),
- \@hit_list, $opts->out_file());
- }
- else {
- # save all hits for this seq
- my $fpass_trna_base_ct = $stats->fpass_trna_base_ct();
- &save_firstpass_output($opts, \@hit_list, $constants->source_tab(), \$fpass_trna_base_ct,
- $seq_file->seq_length(), $seq_file->seq_id());
- $stats->fpass_trna_base_ct($fpass_trna_base_ct);
- }
- @hit_list = (); # clear hit array
- }
- elsif ($opts->save_missed()) {
- # save sequence that had no tRNA hits if -M param set
- # NOTE: only writes last frame of seq buffer if seq length > max_seq_buffer
- $missing_fa_file->open_file($opts->missed_seq_file(), "append");
- $missing_fa_file->set_seq_info($seq_file->seq_name(), $seq_file->seq_description(),
- $seq_file->seq_length(), $seq_file->sequence());
- $missing_fa_file->write_fasta();
- $missing_fa_file->close_file();
- }
-
- $seq_file->reset_buffer_ct();
- $start_index = 1;
-
+ $TargSeqID = 0; # Don't look for a specific Seq number
+ $CurSeqLine = '';
+ $buffer_overlap_seq = "";
+ $buffer_end_index = 0;
+ $Seq_buf_overrun = 0;
+ $start_index = 1;
+ @AllSeqIndices = (); # Keeps track of indexing into seqs for fast retreival
+
+ while (&read_fasta($seq_key,*key_found,$TargSeqID,*SeqName,*SeqDescription,
+ *SeqLength,\$Sequence,*CurSeqLine,SEQFILE,
+ *buffer_overlap_seq, *buffer_end_index, *Seq_buf_overrun, *BufferLength,
+ \@AllSeqIndices))
+ {
+ if ($Cove_mode) {
+ print LOGFILE "Scanned seqs: $numscanned (at $SeqName)\n";
+ }
+ $numscanned++;
+ $first_pass_base_ct += $SeqLength;
+
+ do {
+
+ # Write one input sequence / seq buffer to tmp_fa file
+
+ open(TMPSEQFILE,">$tmp_fa") ||
+ die "FATAL: Unable to open temp file $tmp_fa\n\n";
+ &write_fasta($SeqName,$SeqDescription,length($Sequence),
+ *Sequence,TMPSEQFILE);
+ close (TMPSEQFILE);
+
+ # Run tRNAscan on $tmp_fa file & write results to
+ # $tmp_raw output file
+
+ if ($Tscan_mode) {
+ &Run_tRNAscan($tscan_version,$tscan_bin,$tscan_params,
+ $tmp_fa,$tmp_raw,$start_index);
+ if ($save_verbose) {
+ &Append_verbfile($verb_file);
+ }
+ &Process_tRNAscan_hits(*hit_list,$tmp_raw);
+ }
+
+ # Run eufindtRNA program & save results in memory
+ # in $Eufind_output array
+
+ if ($Eufind_mode) {
+ $Eufind_output = `$eufind_bin -i $start_index -F -I $eufind_Intscore -l $max_int_len $eufind_params $tmp_fa`;
+
+ &Error_exit_status("EufindtRNA",$SeqName); #check exit status
+ &Process_Eufind_hits(*hit_list,$Eufind_output);
+ $Eufind_output = "";
+ }
+
+ $Sequence_scanned = 1; # Flag indicating current sequence has been scanned
+
+ # Check to see if all of sequence was read in last buffer-sized chunck
+
+ if ($Seq_buf_overrun) {
+ $start_index = $buffer_end_index +1;
+ &read_more_fasta(\$Sequence,*CurSeqLine,SEQFILE,
+ *buffer_overlap_seq, *buffer_end_index,
+ *Seq_buf_overrun,*BufferLength);
+ $Sequence_scanned = 0;
+ }
+
+ } until ($Sequence_scanned);
+
+
+ if ($#hit_list >= 0) {
+ $seqs_hit++;
+
+ # save results in ACeDB format now if not
+ # using Cove analysis
+ if ($ace_output && !$Cove_mode) {
+ &Save_Acedb_from_firstpass(*hit_list,$out_file);
+ }
+ else {
+ # save all hits for this seq
+ &Save_firstpass_output(*hit_list,*fpass_trna_base_ct,
+ *printed_header,$SeqLength,$SeqID);
+ }
+
+ @hit_list = (); # clear hit array
+ }
+ elsif ($save_missed) {
+ # save sequence that had no tRNA hits if -M param set
+ # NOTE: only writes last frame of seq buffer if seq length > $MaxSeqBuffer
+ &open_for_append(MISSED,$missed_seq_file);
+ &write_fasta($SeqName,$SeqDescription,$SeqLength,*Sequence,MISSED);
+ close(MISSED);
+ }
+
+ $buffer_overlap_seq = "";
+ $buffer_end_index = 0;
+ $Seq_buf_overrun = 0;
+ $start_index = 1;
+
} # while (read_fasta()) - still more seqs to scan
- $seq_file->close_file();
+ &close_fasta(SEQFILE);
# remove temporary files
system("rm -f $tmp_raw $tmp_fa");
- $seq_file->release_memory(); # release memory
+ undef($Sequence); # release memory
- $log->write_line("\n".$stats->numscanned()." seqs scanned, ".$stats->seqs_hit()." seqs had at ".
- "least one hit.\n".$stats->trnatotal()." total tRNAs predicted in first pass scans\n");
+ print LOGFILE "\n$numscanned seqs scanned, $seqs_hit seqs had at ",
+ "least one hit.\n$trnatotal total tRNAs predicted in first pass scans\n\n";
- if ((!$opts->CM_mode()) && ($stats->trnatotal() == 0) && (!$opts->quiet_mode())) {
- print STDERR "No tRNAs found.\n\n";
+ if ((!$Cove_mode) && ($trnatotal == 0) && (!$quiet_mode)) {
+ print STDERR "No tRNAs found.\n\n";
}
-
- $stats->end_fp_timer(); # save time first-pass scans are done
- if ($opts->save_stats()) {
- $stats->open_file();
- $stats->save_firstpass_stats();
- $stats->close_file();
- }
-}
+ @fp_end_time = (times)[0,2,1,3]; # save time first-pass scans are done
-# Run Cove or Infernal
-sub run_cm_scan {
-
- $stats->start_sp_timer();
+ if ($save_stats) {
+ &open_for_append(STATS,$stats_file);
+ &Save_firstpass_stats(STATS);
+ close STATS;
+ }
- if ($opts->tscan_mode() || $opts->eufind_mode()) {
- $log->write_line("\nPhase II: ".$opts->second_pass_label()." verification of candidate ".
- "tRNAs detected\n with tRNAscan and/or EufindtRNA\n");
+} # (prescan with either tRNAscan/eufind or both)
+
+
+# Check to see if no sequences were read from input file(s)
+
+if (($numscanned == 0) && ($Eufind_mode || $Tscan_mode)) {
+ if ($seq_key ne '\S*') {
+ die "\nNo FASTA sequences matching \'$raw_seq_key\' key found\n\n";
}
+ elsif ($multiple_files) {
+ die "\nFATAL: No sequences in FASTA format found in ",
+ join(', ', at ARGV),"\n\n"; }
else {
- $log->write_line("\nRunning ".$opts->second_pass_label()." analysis\n");
- if (!$opts->use_prev_ts_run()) {
- &prep_for_secpass_only($opts, $stats, $seq_file);
- }
+ die "\nFATAL: No sequences in FASTA format found in file ",
+ "$fastafile\n\n";
}
-
- my $prev_seq_name = ''; # Name of tRNA sequence currently in memory
- my $seqinfo_flag = 0; # flag indicates if seqid and seqlen are saved
- # in firstpass result file
- my $curseq_trnact = 0;
- my $r_prescan_tRNA;
- my $tRNAs_found = 0;
- my @sec_pass_hits = ();
-
- $seq_file->open_file($opts->fasta_file(), "read");
-
- &parse_tabular_output($opts, \@prescan_tRNAs, \$seqinfo_flag);
+}
- for (my $tRNA_ct=0; $tRNA_ct <= $#prescan_tRNAs; $tRNA_ct++)
- {
- $r_prescan_tRNA = $prescan_tRNAs[$tRNA_ct];
+# Run Cove on candidate tRNAs picked in first pass,
+# or by itself on seqs if no first pass searches
- # Reset tRNA counter for each new sequence
- if ($r_prescan_tRNA->{src_seqname} ne $prev_seq_name) {
- $curseq_trnact = 0;
- }
-
- # Retrieve tRNA sequence and write to tmp_trnaseq_file
- if (!&prepare_tRNA_to_scan($seq_file, $r_prescan_tRNA)) {
- next;
- }
-
- if ($opts->cove_mode())
- {
- $tRNAs_found = $cm->analyze_with_cove($opts, $constants, $stats, $gc, $log, $program_id,
- $r_prescan_tRNA, $constants->tmp_trnaseq_file(), \$curseq_trnact, \@sec_pass_hits);
- }
- elsif ($opts->infernal_mode())
- {
- $tRNAs_found = $cm->analyze_with_cmsearch($opts, $constants, $stats, $gc, $log, $program_id,
- $r_prescan_tRNA, $constants->tmp_trnaseq_file(), \$curseq_trnact, \@sec_pass_hits);
- }
-
- $prev_seq_name = $r_prescan_tRNA->{src_seqname};
-
- if (!$cm->CM_check_for_introns()) {
- $stats->increment_total_secpass_ct($tRNAs_found);
- }
-
- }
+elsif ($Cove_mode) {
+
+ $key_found = 0; # reset flag for 2nd pass thru seq file
- if (($cm->CM_check_for_introns() || $cm->CM_check_for_split_halves()) && (scalar(@sec_pass_hits) > 0)) {
- $cm->scan_noncanonical_introns($opts, $constants, $stats, $gc, $log, $seq_file, \@sec_pass_hits);
- if ($cm->CM_check_for_split_halves()) {
- $cm->scan_split_tRNAs($opts, $constants, $stats, $gc, $log, \@sec_pass_hits);
- }
-
- for (my $ct = 0; $ct < scalar(@sec_pass_hits); $ct++) {
- &output_tRNA($opts, $gc, $log, $cm->tab_results(), $cm->get_hmm_score(), $program_id,
- $sec_pass_hits[$ct], $sec_pass_hits[$ct], $ct+1);
- $stats->increment_total_secpass_ct(1);
- }
+ if ($Tscan_mode || $Eufind_mode) {
+ print LOGFILE "\nPhase II: Cove verification of candidate ",
+ "tRNAs detected\n with tRNAscan and/or EufindtRNA\n\n";
}
- $seq_file->close_file();
-
- if (($stats->total_secpass_ct() == 0) && (!$opts->quiet_mode())) {
- print STDERR "No tRNAs found.\n\n";
+ else {
+ print LOGFILE "\nRunning Cove analysis\n\n";
+ if (!$use_prev_ts_run) {
+ &prep_for_cove_only($fastafile,$firstpass_result_file,$seq_key,
+ *numscanned);
+ }
}
-}
+
+
+# open first-pass tabular result file
-# Extracts tRNA sequence with given coordinates, and writes to
-# $tmp_
-sub prepare_tRNA_to_scan {
-
- my ($seq_file, $r_tRNA_info) = @_;
-
- my ($tRNA_seq, $upstream, $downstream) = $seq_file->get_tRNA_sequence($r_tRNA_info->{src_seqname}, $r_tRNA_info->{strand},
- $r_tRNA_info->{start}, $r_tRNA_info->{end},
- $log, $opts, $constants);
- $r_tRNA_info->{seq} = $tRNA_seq;
- $r_tRNA_info->{upstream} = $upstream;
- $r_tRNA_info->{downstream} = $downstream;
-
- $stats->increment_secpass_base_ct($r_tRNA_info->{len});
+ open (FIRSTPASS_TRNAS,"$firstpass_result_file") ||
+ die "FATAL: Can't open first-pass tRNA output file ",
+ "$firstpass_result_file\n\n" ;
- &write_tRNA($constants->tmp_trnaseq_file(), $seq_file->seq_name(), $seq_file->seq_description(), $r_tRNA_info->{seq}, 1);
+ $firstpass_trna_ct = 0; # counter for #trna's read from first-pass
+ # result file
+ $prevSeqName = ''; # Name of tRNA sequence currently in memory
+ $CurSeqLine = ''; # Last line read from input fasta file
+ $seqinfo_flag = 0; # flag indicates if seqid and seqlen are saved
+ # in firstpass result file
+
+ &open_fasta($fastafile,SEQFILE);
- $seq_file->release_memory();
+# read first pass result file one trna at a time, confirming or
+# altering tRNA-scan predictions and saving results
+
+ TRNA:
+ while (<FIRSTPASS_TRNAS>) {
+
+ if (!&Parse_tabular_output(*Seqname,*trnact,*cv_trnact,*trnaName,
+ *ts_start,*ts_end,*ts_len,*sense_strand,
+ *ts_SeqID,*ts_SeqLen, *ts_type,
+ *ts_anticodon,*hit_source,$Padding,*seqinfo_flag))
+ {
+ next TRNA;
+ }
+ $firstpass_trna_ct++;
+
+ if (!&read_fasta_subseq($SeqName,*key_found,$ts_SeqID,*SeqName,*SeqDescription,
+ *SeqLength,*Sequence,*CurSeqLine,SEQFILE,
+ Min($ts_start,$ts_end),$ts_len,\@AllSeqIndices)) {
+
+ # if can't find it on first try, reposition
+ # to beginning of file & try once more
+
+ print LOGFILE "Missed $SeqName using quick index. Rewinding ",
+ "seq file and trying again with slow search...\n";
+ &close_fasta(SEQFILE);
+ &open_fasta($fastafile,SEQFILE);
+ $CurSeqLine = '';
+ if (!&read_fasta_subseq_slow($SeqName,*key_found,$ts_SeqID,*SeqName,
+ *SeqDescription,*SeqLength,
+ *Sequence,*CurSeqLine,SEQFILE,
+ Min($ts_start,$ts_end),$ts_len)) {
+ print STDERR "Could not find $SeqName in $fastafile\n";
+ print LOGFILE "Skipping to next tRNA hit...\n";
+ next TRNA;
+ }
+ }
+
+ $prevSeqName = $SeqName;
+
+ if (!$sense_strand) {
+ $Sequence = &RevCompSeq(*Sequence);
+ }
+
+ &Write_tRNA($Sequence,$SeqName,$SeqDescription,
+ *covels_base_ct,$tmp_trnaseq,1);
+
+ if (!&Run_Covels(*covels_hit_list,*cur_cm_file,
+ $tmp_trnaseq,$ts_len,$ts_type))
+ {
+ next TRNA; # skip to next tRNA if Covels fails
+ }
+
+# Loop to parse covels tRNA hit(s) and run Coves on each tRNA
+
+ COVELS_TRNA:
+ foreach $covels_hit (@covels_hit_list) {
+
+ if ((!&Parse_Covels_output($covels_hit,*score,*subseq_start,
+ *subseq_end,*trna_len,*cv_start,
+ *cv_end,*hit_seqname,$ts_start,
+ *sense_strand)) ||
+ ($score < $Cutoff)) {
+ next COVELS_TRNA;
+ }
+
+ $cv_trnact++;
+ $total_covels_ct++;
+
+ if (($subseq_start == 1) && ($subseq_end == $ts_len)) {
+ $coves_base_ct += $ts_len;
+ }
+ else {
+ # get correct subseq for coves & save to file
+ &Write_tRNA(substr($Sequence,$subseq_start-1,$subseq_end-$subseq_start+1),
+ $SeqName,$SeqDescription,
+ *coves_base_ct,$tmp_trnaseq,1);
+ }
+
+ ($covseq,$covss,$coves_score) =
+ &Run_Coves($tmp_trnaseq,$SeqName,$cur_cm_file);
+
+ $cv_anticodon = "ERR";
+ if ($covseq ne "Error") {
+ ($cv_anticodon,$antiloopIndex,$antiloopEnd,$acodonIndex) =
+ &Find_anticodon($covseq,$covss);
+ }
+
+ # check for problem running Coves or
+ # parsing anticodon loop
+ if (($covseq eq "Error") || ($cv_anticodon eq '???')) {
+ $cv_anticodon = '???';
+ $cv_type = "Undet";
+ $intron = 0;
+
+ if ($save_odd_struct) {
+ open(ODDTRNA,">>$odd_struct_file") ||
+ die "FATAL: Can't open $odd_struct_file to save",
+ "seconary structures\n\n";
+ print ODDTRNA "$SeqName.t$cv_trnact ($cv_start-$cv_end):\n",
+ "$covseq\n$covss\n\n";
+ close(ODDTRNA);
+ }
+ }
+ else { # continue tRNA struct parsing
+ ($intron,$istart,$iend) =
+ &Find_intron($covseq,$antiloopIndex,$antiloopEnd);
+
+ if (($cv_anticodon ne (uc($ts_anticodon))) &&
+ ($Tscan_mode || $Eufind_mode) && ($strict_params)) {
+ print LOGFILE "\n$trnaName - anticondon conflict\tcoves:",
+ " $cv_anticodon\t","firstpass ($hit_source)",
+ ": $ts_anticodon\n$covseq\n$covss\n\n";
+ }
+
+ $cv_type = Get_tRNA_type($cv_anticodon,$cur_cm_file);
+ }
+
+ $pseudo_gene_flag = 0;
+ $hmm_score = $ss_score = 0;
+ if (($cv_type !~ /SeC/) &&
+ (&Is_pseudo_gene(*hmm_score,*ss_score,$score,
+ $tmp_trnaseq,$SeqName,$get_hmm_score)) &&
+ (!$skip_pseudo_filter))
+ {
+ $pseudo_gene_flag = 1; # set to non-zero for likely
+ } # pseudogenes
+
+ if (!$results_to_stdout) {
+ print LOGFILE "$trnaName: Cove type= $cv_type\t ",
+ "First-pass scan ($hit_source) type= $ts_type\t",
+ "Score= $score\n";
+ }
+ if ($save_all_struct) {
+ &Save_AllStruct_Output($pseudo_gene_flag);
+ }
+
+ # Create tabular results line, ready for output
+
+ if (!$printed_header) {
+ $MaxSeqNameWidth = Max(length($SeqName)+1,8);
+ $MaxSeqLenWidth = length($SeqLength);
+ }
+
+ $Results_line = &Construct_TabOutput($SeqName,*printed_header,
+ $pseudo_gene_flag,$cv_type,
+ $MaxSeqNameWidth,$MaxSeqLenWidth);
+
+ # Internal copy of results saved for later uses
+ push(@Tab_Results,$Results_line);
+
+ if ($ace_output) {
+ &Save_Acedb_from_cov($pseudo_gene_flag);
+ }
+ else {
+
+ if (!($brief_output || $printed_header)) {
+ &print_results_header($out_file,$MaxSeqNameWidth,$MaxSeqLenWidth);
+ $printed_header = 1;
+ }
+
+ &open_for_append(TABOUT,$out_file);
+ print TABOUT $Results_line;
+ close TABOUT;
+
+ }
+ } # while more covels_hits
+
+ } # while <FIRSTPASS_TRNAS> not at eof
+
+ &close_fasta(SEQFILE);
+ close FIRSTPASS_TRNAS;
+
+ if (($total_covels_ct == 0) && (!$quiet_mode)) {
+ print STDERR "No tRNAs found.\n\n";
+ }
- return 1;
-}
+} # if Cove_mode
-sub cleanup { # clean up temp files
+ at cv_end_time = (times)[0,2,1,3];
- system("rm -f ".$opts->temp_dir()."/tscan$$".'*');
- system("rm -f ".$opts->fafile().".pid");
+if ($save_stats) {
+ &open_for_append(STATS,$stats_file);
+ &Save_final_stats(STATS);
+ close STATS;
}
-sub error_handler {
-
- print "\nAborting tRNAscan-SE\n\n";
- my $ppid = $$;
- my $psout = `ps -ef`;
- my @ps_lines = split(/\n/,$psout);
- foreach my $line (0..$#ps_lines) {
- if ($ps_lines[$line] =~/^\s+\S+\s+(\d+)\s+($ppid)\s/) {
-# print STDERR "Killing process $1:\n",$ps_lines[$line],"\n";
- my $killct = kill 'KILL', $1;
-# print STDERR "$killct jobs received the kill signal\n";
- }
- }
-
- &cleanup();
- exit(1);
-}
+&cleanup(); # clean up temp files
+exit(0);
-sub display_credits {
- print STDERR "\n Please cite: \n",
- "\tLowe, T.M. & Eddy, S.R. (1997) \"tRNAscan-SE: A program for\n",
- "\timproved detection of transfer RNA genes in genomic sequence\"\n",
- "\tNucl. Acids Res. 25: 955-964.\n",
- "\n This program uses a modified, optimized version of tRNAscan v1.3\n",
- " (Fichant & Burks, J. Mol. Biol. 1991, 220: 659-671),\n",
- " a new implementation of a multistep weight matrix algorithm\n",
- " for identification of eukaryotic tRNA promoter regions\n",
- " (Pavesi et al., Nucl. Acids Res. 1994, 22: 1247-1256),\n",
- " as well as the RNA covariance analysis package Cove v.2.4.2\n",
- " (Eddy & Durbin, Nucl. Acids Res. 1994, 22: 2079-2088).\n\n";
-}
+# END main
sub print_usage {
@@ -434,12 +459,11 @@ sub print_usage {
" -- defaults to use with eukaryotic sequences \n",
" (use -B, -A, -O or -G to scan other types of sequences)\n\n",
"Basic Options\n",
- " -B : search for bacterial tRNAs (use bacterial tRNA model)\n",
+ " -B or -P : search for bacterial tRNAs (use bacterial tRNA model)\n",
" -A : search for archaeal tRNAs (use archaeal tRNA model)\n",
" -O : search for organellar (mitochondrial/chloroplast) tRNAs\n",
" -G : use general tRNA model (cytoplasmic tRNAs from all 3 domains included)\n\n",
- " -i : search using Infernal cm analysis only (max sensitivity, very slow)\n",
- " -C : search using Cove analysis only (high sensitivity, very slow)\n\n",
+ " -C : search using Cove analysis only (max sensitivity, very slow)\n\n",
" -o <file> : save final results in <file>\n",
" -f <file> : save tRNA secondary structures to <file>\n",
" -a : output results in ACeDB output format instead of default\n",
@@ -452,580 +476,3162 @@ sub print_usage {
" -h : print full list (long) of available options\n\n";
}
+
sub print_all_options {
print "\nUsage: tRNAscan-SE [-options] <FASTA file(s)>\n\n";
print " Scan a sequence file for tRNAs using tRNAscan, EufindtRNA &\n",
" tRNA covariance models\n",
" -- defaults to use with eukaryotic sequences \n",
- " (use 'Search Mode Options' below to scan other types of sequences)\n\n",
- "Search Mode Options:\n\n",
- " -B --bact : search for bacterial tRNAs (use bacterial tRNA model)\n",
- " -A --arch : search for archaeal tRNAs (use archaeal tRNA model)\n",
- " -O --organ : search for organellar (mitochondrial/chloroplast) tRNAs\n",
- " -G --general : use general tRNA model (cytoplasmic tRNAs from all 3 domains included)\n\n",
- " -C --cove : search using covariance model analysis only (max sensitivity, slow)\n",
- " -i --infernal : search using Infernal cm analysis only (max sensitivity, very slow)\n",
- " --newscan : search using Infernal and new cm models instead of Cove\n",
- " -H --breakdown : show breakdown of primary and secondary structure components to\n",
- " covariance model bit scores\n",
- " -D --nopseudo : disable pseudogene checking\n\n",
-
- "Achaeal-specific options:\n\n",
- " --ncintron : scan for noncanonical introns\n",
- " --frag <file> : scan for putative tRNA gene fragments that may form split tRNAs\n",
- " and save results in <file>\n\n",
+ " (use -B, -A, -O or -G to scan other types of sequences)\n\n",
+ "Search Mode options:\n\n",
+ " -B or -P : search for bacterial tRNAs (use bacterial tRNA model)\n",
+ " -A : search for archaeal tRNAs (use archaeal tRNA model)\n",
+ " -O : search for organellar (mitochondrial/chloroplast) tRNAs\n",
+ " -G : use general tRNA model (cytoplasmic tRNAs from all 3 domains included)\n\n",
+ " -C : search using covariance model analysis only (max sensitivity, slow)\n\n",
+ " -H : show both primary and secondary structure components to\n",
+ " covariance model bit scores\n",
+ " -D : disable pseudogene checking\n\n",
"Output options:\n\n",
- " -o --output <file> : save final results in <file>\n",
- " -f --struct <file> : save tRNA secondary structures to <file>\n",
- " -a --acedb : output results in ACeDB output format instead of default\n",
- " tabular format\n",
- " -m --stats <file> : save statistics summary for run in <file>\n",
- " (speed, # tRNAs found in each part of search, etc)\n\n",
- " -d --progress : display program progress messages\n",
- " -l --log <file> : save log of program progress in <file>\n\n",
- " -q --quiet : quiet mode (credits & run option selections suppressed)\n",
- " -b --brief : brief output format (no column headers)\n\n",
- " -N --codons : output corresponding codons instead of tRNA anticodons\n\n",
- " -? \# : '#' in place of <file> chooses default name for output files\n",
- " -p --prefix <label> : use <label> prefix for all default output file names\n\n",
- " -y --hitsrc : show origin of first-pass hits (Ts=tRNAscan 1.4,\n",
- " Eu=EufindtRNA, Bo= Both)\n\n",
+ " -o <file> : save final results in <file>\n",
+ " -f <file> : save tRNA secondary structures to <file>\n",
+ " -a : output results in ACeDB output format instead of default\n",
+ " tabular format\n",
+ " -m <file> : save statistics summary for run in <file>\n",
+ " (speed, # tRNAs found in each part of search, etc)\n\n",
+ " -d : display program progress messages\n",
+ " -l <file> : save log of program progress in <file>\n\n",
+
+ " -q : quiet mode (credits & run option selections suppressed)\n",
+ " -b : brief output format (no column headers)\n\n",
+ " -N : output corresponding codons instead of tRNA anticodons\n\n",
+
+ " -? \# : '#' in place of <file> chooses default name for output files\n",
+ " -p <label> : use <label> prefix for all default output file names\n\n",
+ " -y : show origin of first-pass hits (Ts=tRNAscan 1.4,\n",
+ " Eu=EufindtRNA, Bo= Both)\n\n",
"Specify Alternate Cutoffs / Data Files:\n\n",
- " -X --score <score> : set cutoff score (in bits) for reporting tRNAs (default=20)\n",
- " -L --len <length> : set max length of tRNA intron+variable region (default=116bp)\n\n",
- " -I --iscore <score> : manually set \"intermediate\" cutoff score for EufindtRNA\n",
- " -z --pad <number> : use <number> nucleotides padding when passing first-pass\n",
- " tRNA bounds predictions to CM analysis (default=8)\n\n",
- " -g --gencode <file> : use alternate genetic codes specified in <file> for\n",
- " determining tRNA type\n",
- " -c --cm <file> : use an alternate covariance model in <file>\n\n",
+ " -X <score> : set cutoff score (in bits) for reporting tRNAs (default=20)\n",
+ " -L <length>: set max length of tRNA intron+variable region (default=116bp)\n\n",
+
+ " -I <score> : manually set \"intermediate\" cutoff score for EufindtRNA\n",
+
+ " -z <number> : use <number> nucleotides padding when passing first-pass\n",
+ " tRNA bounds predictions to CM analysis (default=7)\n\n",
+
+ " -g <file> : use alternate genetic codes specified in <file> for\n",
+ " determining tRNA type\n",
+ " -c <file> : use an alternate covariance model in <file>\n\n",
"Misc Options:\n\n",
- " -h --help : print this help message\n",
- " -Q --forceow : do not prompt user before overwriting pre-existing\n",
- " result files (for batch processing)\n\n",
- " -n --match <EXPR> : search only sequences with names matching <EXPR> string\n",
- " (<EXPR> may contain * or ? wildcard chars)\n",
- " -s --search <EXPR> : start search at sequence with name matching <EXPR> string\n",
- " and continue to end of input sequence file(s)\n",
+
+ " -h : print this help message\n",
+ " -Q : do not prompt user before overwriting pre-existing\n",
+ " result files (for batch processing)\n\n",
+ " -n <EXPR> : search only sequences with names matching <EXPR> string\n",
+ " (<EXPR> may contain * or ? wildcard chars)\n",
+ " -s <EXPR> : start search at sequence with name matching <EXPR> string\n",
+ " and continue to end of input sequence file(s)\n",
"Special Options (for testing & special purposes)\n\n",
- " -T --tscan : search using tRNAscan only (defaults to strict params)\n",
- " -t --tmode <mode> : explicitly set tRNAscan params, where <mode>=R or S\n",
- " (R=relaxed, S=strict tRNAscan v1.3 params)\n\n",
- " -E --eufind : search using Eukaryotic tRNA finder (EufindtRNA) only\n",
- " (defaults to Normal seach parameters when run alone,\n",
- " or to Relaxed search params when run with Cove)\n",
- " -e --emode <mode> : explicitly set EufindtRNA params, where <mode>=R, N, or S\n",
- " (relaxed, normal, or strict)\n\n",
- " -r --fsres <file> : save first-pass scan results from EufindtRNA and/or\n",
- " tRNAscan in <file> in tabular results format\n",
- " -u --filter <file> : search with Cove only those sequences & regions delimited\n",
- " in <file> (tabular results file format)\n",
- " -F --falsepos <file> : save first-pass candidate tRNAs in <file> that were then\n",
- " found to be false positives by Cove analysis\n",
- " -M --missed <file> : save all seqs that do NOT have at least one\n",
- " tRNA prediction in them (aka \"missed\" seqs)\n",
- " -v --verbose <file> : save verbose tRNAscan 1.3 output to <file>\n",
- " -V --version <vers> : run an alternate version of tRNAscan\n",
- " where <vers> = 1.3, 1.39, 1.4 (default), or 2.0\n",
- " --nomerge : Keep redundant tRNAscan 1.3 hits (don't filter out multiple\n",
- " predictions per tRNA identification)\n",
+ " -T : search using tRNAscan only (defaults to strict params)\n",
+ " -t <mode> : explicitly set tRNAscan params, where <mode>=R or S\n",
+ " (R=relaxed, S=strict tRNAscan v1.3 params)\n\n",
+ " -E : search using Eukaryotic tRNA finder (EufindtRNA) only\n",
+ " (defaults to Normal seach parameters when run alone,\n",
+ " or to Relaxed search params when run with Cove)\n",
+ " -e <mode> : explicitly set EufindtRNA params, where <mode>=R, N, or S\n",
+ " (relaxed, normal, or strict)\n\n",
+ " -r <file> : save first-pass scan results from EufindtRNA and/or\n",
+ " tRNAscan in <file> in tabular results format\n",
+ " -u <file> : search with Cove only those sequences & regions delimited\n",
+ " in <file> (tabular results file format)\n",
+ " -F <file> : save first-pass candidate tRNAs in <file> that were then\n",
+ " found to be false positives by Cove analysis\n",
+ " -M <file> : save all seqs that do NOT have at least one\n",
+ " tRNA prediction in them (aka \"missed\" seqs)\n",
+ " -v <file> : save verbose tRNAscan 1.3 output to <file>\n",
+ " -V <vers> : run an alternate version of tRNAscan\n",
+ " where <vers> = 1.3, 1.39, 1.4 (default), or 2.0\n",
+ " -K : Keep redundant tRNAscan 1.3 hits (don't filter out multiple\n",
+ " predictions per tRNA identification)\n",
"\n\n";
}
-sub set_options {
+sub Set_defaults {
+
+ local(*Cutoff,*Max_tRNA_length,*Max_Cove_tRNA_length,*Min_intron_length,
+ *tscan_version,*temp_dir,*Min_pseudo_filter_score,
+ *Min_ss_score,*Min_hmm_score, *MaxSeqBuffer,*SeqBufOverlap,
+ *ReallyBigNumber, *SeqIndexInc) = @_;
+
+ $Cutoff = 20; # default cutoff score for covels reporting of tRNA
+ $Max_tRNA_length = 500; # max size of -w parameter passed to covels
+ # when using a pre-scanner (eufind or tRNAscan)
+ $Max_Cove_tRNA_length = 250; # max size of -w param if only
+ # Cove is being used (too slow otherwise)
+ $Min_tRNA_no_intron = 76; # min length for average tRNA with no intron;
+
+ $Min_intron_length = 5; # min size of introns detected by parsing of
+ # coves output
+
+ $Min_pseudo_filter_score = 55; # Below this score, tRNAs are checked
+ # for min primary and secondary structure
+ # scores to catch pseudogene repeats
+ # like rat ID & rodent B2 elements
+
+ $Min_ss_score = 5; # Below this secondary structure score,
+ # tRNA is considered a pseudogene
+ $Min_hmm_score = 10; # Below this primary structure score,
+ # tRNA is considered a pseudogene
+
+ $tscan_version = 1.4; # version of tRNAscan used by tRNAscan-SE
+
+ if ($ENV{TMPDIR}) { # set location of temp files
+ $temp_dir = $ENV{TMPDIR};
+ }
+ else {
+ $temp_dir = "/tmp";
+ }
+
+ $SIG{'TERM'} = 'Error_Handler';
+ $SIG{'QUIT'} = 'Error_Handler';
+ $SIG{'INT'} = 'Error_Handler';
+
+ $No_ambig_bin_suffix = "-NA";
+
+ $MaxSeqBuffer = 1000000; # Max size of seq buffer read in at once
+ $SeqBufOverlap = 200; # Nucleotides of overlap between buffers
+ $ReallyBigNumber = 1000000000; # largest sequence length imaginable
+
+ $SeqIndexInc = 100000;
+
+}
+
+sub Set_file_paths {
+
+ local(*Main_cm_file,*MainNS_cm_file,*Pselc_cm_file,*Eselc_cm_file,
+ *lib_dir,*covels_bin,*coves_bin,*eufind_bin,*tscan_bin,
+ $tscan_version) = @_;
+
+ if ($use_orig_cm) {
+ $Main_cm_file = "TRNA2.cm"; # use original covariance model
+ $MainNS_cm_file = "TRNA2ns.cm"; # no sec struct
+ }
+
+ elsif ($Bact_mode) {
+ $Main_cm_file = "TRNA2-bact.cm"; # use bacterial covariance model
+ $MainNS_cm_file = "TRNA2-bactns.cm"; # no sec struct
+ }
+ elsif ($Arch_mode) {
+ $Main_cm_file = "TRNA2-arch.cm"; # use archae covariance model
+ $MainNS_cm_file = "TRNA2-archns.cm"; # no sec struct
+ }
+ else {
+ $Main_cm_file = "TRNA2-euk.cm"; # default to eukar cove model
+ $MainNS_cm_file = "TRNA2-eukns.cm"; # no secondary struct
+ }
+
+ if ($Alt_cm_file ne '') {
+ $Main_cm_file = $Alt_cm_file; # use alternate cm file specified
+ # on command line with -c param
+ $MainNS_cm_file = "TRNA2ns.cm";
+ }
+
+ $Pselc_cm_file = "PSELC.cm";
+ $Eselc_cm_file = "ESELC.cm";
+
+ $lib_dir = "/usr/local/lib/tRNAscanSE/";
+
+ $bindir = ""; # modified by 'make'
+ $covels_bin = "covels-SE";
+
+ $coves_bin = "coves-SE";
+
+ $eufind_bin = "eufindtRNA";
+
+ if (-r $Main_cm_file) {
+ $Main_cm_file_path = $Main_cm_file;
+ }
+ elsif (-r $lib_dir.$Main_cm_file) {
+ $Main_cm_file_path = $lib_dir.$Main_cm_file;
+ }
+ else {
+ die "FATAL: Unable to open $Main_cm_file covariance model file\n\n";
+ }
+
+ if (-r $MainNS_cm_file) {
+ $MainNS_cm_file_path = $MainNS_cm_file;
+ }
+ elsif (-r $lib_dir.$MainNS_cm_file) {
+ $MainNS_cm_file_path = $lib_dir.$MainNS_cm_file;
+ }
+ else {
+ die "FATAL: Unable to open $MainNS_cm_file covariance model file\n\n";
+ }
+
+ if (-r $Pselc_cm_file) {
+ $Pselc_cm_file_path = $Pselc_cm_file;
+ }
+ elsif (-r $lib_dir.$Pselc_cm_file) {
+ $Pselc_cm_file_path = $lib_dir.$Pselc_cm_file;
+ }
+ else {
+ die "FATAL: Unable to open $Pselc_cm_file covariance model file\n\n";
+ }
+
+ if (-r $Eselc_cm_file) {
+ $Eselc_cm_file_path = $Eselc_cm_file;
+ }
+ elsif (-r $lib_dir.$Eselc_cm_file) {
+ $Eselc_cm_file_path = $lib_dir.$Eselc_cm_file;
+ }
+ else {
+ die "FATAL: Unable to open $Eselc_cm_file covariance model file\n\n";
+ }
+
+ if (!(-x $covels_bin)) {
+ $covels_bin = $bindir.$covels_bin;
+ if (!(-x $covels_bin)) {
+ die "FATAL: Unable to find $covels_bin executable\n\n";
+ }
+ }
+ if ($MP_cove_mode && (!(-x $MP_covels_bin))) {
+ $MP_covels_bin = $bindir.$MP_covels_bin;
+ if (!(-x $MP_covels_bin)) {
+ die "FATAL: Unable to find $MP_covels_bin executable\n\n";
+ }
+ }
+ if (!(-x $coves_bin)) {
+ $coves_bin = $bindir.$coves_bin;
+ if (!(-x $coves_bin)) {
+ die "FATAL: Unable to find $coves_bin executable\n\n";
+ }
+ }
+ if (!(-x $eufind_bin)) {
+ $eufind_bin = $bindir.$eufind_bin;
+ if (!(-x $eufind_bin)) {
+ die "FATAL: Unable to find $eufind_bin executable\n\n";
+ }
+ }
+
+
+ # choose correct name for version being run
+ # only version 1.4 is provided with distribution
+
+ if ($tscan_version == 1.4) {
+ $tscan_bin = "trnascan-1.4";
+ }
+ elsif ($tscan_version == 1.39) {
+ $tscan_bin = "trnascan-1.39";
+ }
+ elsif ($tscan_version == 2) {
+ $tscan_bin = "TRNAscan";
+ }
+ elsif ($tscan_version == 1.3) {
+ $tscan_bin = "trnascan-1.3";
+ }
+ else {
+ die "FATAL: Illegal tRNAscan version.\n\n";
+ }
+
+ if (!(-x $tscan_bin)) {
+ $tscan_bin = $bindir.$tscan_bin;
+ if (!(-x $tscan_bin)) {
+ die "FATAL: Unable to find $tscan_bin executable\n\n";
+ }
+ }
+}
+
+sub Set_options {
+
+
+ # set default values for all user-selectable options
+
+ $fafile = ""; # input sequence file
+ $out_file = "-"; # output result file -- send to
+ # stdout ("-") by default
+
+ $results_to_stdout = 1; # send results to stdout by default
+
+ $ace_output = 0; # output in ACeDB format if non-zero
+ $brief_output = 0; # don't print tabular output column headers
+ # if non-zero
+ $quiet_mode = 0; # don't print credits & selected run options
+ # if non-zero
+ $display_progress = 0; # print program progress info if non-zero
+ $save_progress = 0; # save progress to log file if non-zero
+ $log_file = ""; # name of log file
+
+ $seq_key = ""; # require seq names to match this key
+ $raw_seq_key = ""; # unmodified user-input key
+ $start_at_key = 0; # read all seqs after finding seqname=KEY?
+ $key_found = 0; # init flag telling if a sequence name
+ # has been found matching KEY expr
+
+ $Tscan_mode = 1; # run tRNAscan if non-zero
+ $Eufind_mode = 1; # run eufindtRNA (pavesi) if non-zero
+ $Cove_mode = 1; # run Cove if non-zero
+
+ $Bact_mode = 0; # run covariance model for bacteria if set
+ $Arch_mode = 0; # run archaea cov model if set
+ $Org_mode = 0; # run in organellar mode
+ # run eukaryotic model by default
+
+ $alt_gcode = 0; # use alternate genetic translation table
+ # file if non-zero
+ $gc_file = ""; # alternate transl table file
+
+ $Alt_cm_file = ''; # alternate covariance model file (-c option)
+
+ $strict_params = 1; # use original strict tRNAscan params
+ # if non-zero
+
+ # set to non-zero if you do NOT want redundant, overlapping hits
+ # found by tRNAscan merged into one hit
+ $Keep_tscan_repeats = 0;
+
+ $tscan_params = "-s"; # parameter set to be used for tRNAscan
+ # default is "-s" strict params
+ # default for prokaryotes should be relaxed
+ # params "-r"
+
+ $eufind_params = "-r"; # relaxed params to be used with
+ # eufindtRNA program by default
+ # this option selects tRNAs,
+ # not looking for poly T
+ # pol III termination signal
+
+ $eufind_Intscore = -32.10; # Intermediate score cutoff for use
+ # with eufindtRNA
+# $eufind_Totscore = -31.8; # Total score cutoff for use
+ # with eufindtRNA in non-relaxed mode
+
+ $Default_Padding = 7;
+ $Padding = $Default_Padding; # pad both ends of first-pass hits with this
+ # many extra bases before passing to Cove
+
+ $save_stats = 0; # save statistics for search
+ $stats_file = "";
+
+ $save_odd_struct = 0; # save structures for which Cove
+ # was unable to determine anticodon
+ $odd_struct_file = "";
+
+ $save_all_struct = 0; # save secondary structures if nonzero
+ $all_struct_file = ""; # sec struct file, set with -f option
+
+ $save_verbose = 0; # save verbose output from tRNAscan
+ $verb_file = "";
+
+ $save_firstpass_res = 0; # save tabular tRNAscan results
+ $firstpass_result_file = "";
+
+ $use_prev_ts_run = 0; # specify result file from previous
+ # tRNA search for Cove-confirmation
+
+ $save_falsepos = 0; # save false positive tRNAs in
+ # fasta file
+ $falsepos_file = "";
+
+ $save_missed = 0; # save seqs without a hit
+ $missed_seq_file = "";
+
+ $save_source = 0; # save source of first-pass hit
+
+ $output_codon = 0; # output tRNA codon instead of anticodon
+ # (off by default)
+
+ $use_orig_cm = 0; # use original covariance model that
+ # contains tRNAS from all three domains
+
+ $skip_pseudo_filter = 0; # enable filter for psuedogenes (Cove score <40,
+ # primary struct score <10 bits, secondary
+ # structure score < 5 bits)
+
+ $get_hmm_score = 0; # also score tRNA with covariance model
+ # without sec structure info, similar
+ # to getting hmm score for match of
+ # seq to tRNA hmm (-H option)
+
+ $Def_max_int_len = 200; # default MAX intron+variable loop region size
+ # used in EufindtRNA
+
+ $max_int_len = $Def_max_int_len;
+
+ $prompt_for_overwrite = 1; # prompt user before overwriting a pre-existing
+ # output file, disabled with -Q option
+
# clear option vars
- our $opt_acedb=0; our $opt_brief=0; our $opt_quiet=0; our $opt_progress=0;
- our $opt_bact=0; our $opt_arch=0; our $opt_organ=0; our $opt_general=0;
- our $opt_cove=0; our $opt_infernal=0; our $opt_eufind=0; our $opt_tscan=0; our $opt_newscan=0;
- our $opt_ncintron=0; our $opt_frag='';
- our $opt_breakdown=0; our $opt_nopseudo=0; our $opt_nomerge=0; our $opt_hitsrc=0;
- our $opt_output=''; our $opt_struct=''; our $opt_stats=''; our $opt_log='';
- our $opt_prefix=''; our $opt_match=''; our $opt_search='';
- our $opt_gencode=''; our $opt_cm=''; our $opt_codons=0;
- our $opt_tmode=''; our $opt_emode=''; our $opt_fsres=''; our $opt_filter=''; our $opt_falsepos=''; our $opt_missed='';
- our $opt_score=1000; our $opt_iscore=1000; our $opt_len=-1; our $opt_pad=1000;
- our $opt_version=0; our $opt_help=0; our $opt_verbose=''; our $opt_forceow=0;
- our $opt_w=''; our $opt_U=0; our $opt_Y=0;
-
- Getopt::Long::Configure("bundling", "no_ignore_case", "no_auto_abbrev");
- my $result = &GetOptions(
- # Misc option switches
- "help|h",
- "acedb|a","brief|b","quiet|q","hitsrc|y","breakdown|H",
- "Y",
- "progress|d","nopseudo|D","codons|N","forceow|Q","nomerge",
- # Search mode switches
- "bact|B", "arch|A", "organ|O", "general|G",
- "eufind|E", "tscan|T", "cove|C","infernal|i", "newscan",
- "ncintron", "frag=s",
- # file name input specifiers
- "gencode|g=s","filter|u=s","cm|c=s",
- # file name output specifiers
- "output|o=s","stats|m=s","log|l=s","struct|f=s","fsres|r=s","verbose|v=s","w=s","falsepos|F=s","missed|M=s",
- #string parameters
- "prefix|p=s","match|n=s","search|s=s","emode|e=s","tmode|t=s",
- #numerical parameters
- "version|V=f","score|X=f","iscore|I=f","pad|z=i","len|L=i");
-
- if ($opt_help) {
- print STDERR "\ntRNAscan-SE $version ($release_date)\n";
- &display_credits;
- &print_all_options;
- exit(0);
+
+ $opt_o=''; $opt_a=0; $opt_b=0; $opt_q=0; $opt_n=''; $opt_s='';
+ $opt_C=0; $opt_T=0; $opt_G=0; $opt_g=''; $opt_m=''; $opt_h=0;
+ $opt_w=''; $opt_f=''; $opt_p=''; $opt_v='';
+ $opt_t=''; $opt_r=''; $opt_u=''; $opt_y=0; $opt_P = 0; $opt_z=1000;
+ $opt_d=0; $opt_l=''; $opt_V=0; $opt_X=1000;
+ $opt_E=0; $opt_e=''; $opt_F = ''; $opt_I=1000; $opt_M='';
+ $opt_K=0; $opt_c=''; $opt_H = 0; $opt_U=0; $opt_N=0; $opt_D=0;
+ $opt_L= -1; $opt_Q=0; $opt_Y=0; $opt_A=0; $opt_O=0; $opt_B=0;
+
+ &Getopts('o:abqhyKHn:s:CTEGOg:APBe:m:w:f:p:v:t:r:u:dl:V:X:F:I:M:z:L:DNQYc:');
+
+ if ($opt_h != 0) {
+ print STDERR "\ntRNAscan-SE $version ($release_date)\n";
+ &display_credits;
+ &print_all_options;
+ exit(0);
}
if ($#ARGV < 0) {
- print STDERR "\ntRNAscan-SE $version ($release_date)\n";
- print STDERR "\nFATAL: No sequence file(s) specified.\n";
- &print_usage();
- exit(1);
+ print STDERR "\ntRNAscan-SE $version ($release_date)\n";
+ print STDERR "\nFATAL: No sequence file(s) specified.\n";
+ &print_usage();
+ exit(1);
}
-
- my $fafile = $ARGV[0]; # use input seq file name as prefix
- $fafile =~ s/\.fa|\.seq$//; # for default output file names
- # take .seq or .fa extensions off
+
+ $fafile = $ARGV[0]; # use input seq file name as prefix
+ $fafile =~ s/\.fa|\.seq$//; # for default output file names
+ # take .seq or .fa extensions off
- if ($opt_prefix ne '') { # use specified prefix for default
- $fafile = $opt_prefix; # output file names
+ if ($opt_p ne '') { # use specified prefix for default
+ $fafile = $opt_p; # output file names
}
- $opts->fafile($fafile);
- if ($opt_forceow != 0) { # Do NOT prompt before overwriting pre-existing
- # output files; good for use in batch-mode jobs
- $opts->prompt_for_overwrite(0);
+ if ($opt_Q != 0) { # Do NOT prompt before overwriting pre-existing
+ # output files; good for use in batch-mode jobs
+ $prompt_for_overwrite = 0;
}
- if ($opt_output ne '') { # set name of result file
- $opts->results_to_stdout(0);
- if ($opt_output eq "#") {
- $opts->out_file("$fafile.out");
- }
- else {
- $opts->out_file($opt_output);
- }
- &check_output_file($opts->out_file(), $opts->prompt_for_overwrite());
+
+ if ($opt_o ne '') { # set name of result file
+ $results_to_stdout = 0;
+ if ($opt_o eq "#") {
+ $out_file = "$fafile.out";
+ }
+ else {
+ $out_file = $opt_o;
+ }
+ &open_for_write(TESTF,$out_file);
+ close(TESTF);
}
- if ($opt_acedb != 0) { # save results in ACeDB output
- $opts->ace_output(1);
- }
- if ($opt_brief != 0) { # use brief output (suppress column header)
- $opts->brief_output(1);
- }
- if ($opt_quiet != 0) { # use quite mode (suppress credits &
- $opts->quiet_mode(1); # user-selected options)
- }
-
- if ($opt_hitsrc != 0) { # save source of tRNA hit
- $opts->save_source(1);
+ if ($opt_a != 0) { # save results in ACeDB output
+ $ace_output = 1;
+ }
+ if ($opt_b != 0) { # use brief output (suppress column header)
+ $brief_output = 1;
+ }
+ if ($opt_q != 0) { # use quite mode (suppress credits &
+ $quiet_mode = 1; # user-selected options)
+ }
+
+ if ($opt_y != 0) { # save source of tRNA hit
+ $save_source = 1;
}
- if ($opt_nopseudo != 0) {
- $cm->skip_pseudo_filter(1); # disable psuedogene filtering
+ if ($opt_D != 0) {
+ $skip_pseudo_filter = 1; # disable psuedogene filtering
}
- if ($opt_codons != 0) {
- $opts->output_codon(1); # translate anticodon to codon for output
+ if ($opt_N != 0) {
+ $output_codon = 1; # traNslate anticodon to codon for output
}
- if ($opt_match ne '') { # search only sequences matching KEY name
- $opts->seq_key($opt_match);
- $opts->raw_seq_key($opts->seq_key()); # save original KEY expr
- my $key = $opts->seq_key();
- $key =~ s/(\W)/\\$1/g;
- $key =~ s/\\\*/\\S\*/g; # turning KEY into regular expression
- $key =~ s/\\\?/\\S/g; # notation
- $key =~ s/[\"\']//g; # "
- $opts->seq_key($key);
- }
- elsif ($opt_search ne '') { # search all sequences after matching KEY
- $opts->start_at_key(1);
- $opts->seq_key($opt_search);
- $opts->raw_seq_key($opts->seq_key()); # save original KEY expr
- my $key = $opts->seq_key();
- $key =~ s/(\W)/\\$1/g;
- $key =~ s/\\\*/\\S\*/g; # turning KEY into regular expression
- $key =~ s/\\\?/\\S/g; # notation
- $key =~ s/[\"\']//g; # "
- $opts->seq_key($key);
+ if ($opt_n ne '') { # search only sequences matching KEY name
+ $seq_key = $opt_n;
+ $raw_seq_key = $seq_key; # save original KEY expr
+ $seq_key =~ s/(\W)/\\$1/g;
+ $seq_key =~ s/\\\*/\\S\*/g; # turning KEY into regular expression
+ $seq_key =~ s/\\\?/\\S/g; # notation
+ $seq_key =~ s/[\"\']//g; # "
+ }
+ elsif ($opt_s ne '') { # search all sequences after matching KEY
+ $start_at_key = 1;
+ $seq_key = $opt_s;
+ $raw_seq_key = $seq_key; # save original KEY expr
+ $seq_key =~ s/(\W)/\\$1/g;
+ $seq_key =~ s/\\\*/\\S\*/g; # turning KEY into regular expression
+ $seq_key =~ s/\\\?/\\S/g; # notation
+ $seq_key =~ s/[\"\']//g; # "
}
else {
- $opts->seq_key('\S*');
+ $seq_key = '\S*';
}
- if ($opt_organ != 0) { # shorthand for setting options
- $opt_cove = 1; # cove mode is best for organellar scans
- $opt_eufind = 0; # (mito/chloroplast)
- $opt_tscan = 0;
- $opts->search_mode("general"); # use original "General" tRNA model
-
- $opts->org_mode(1);
- $cm->cm_cutoff(15); # lower cove cutoff score
- $cm->skip_pseudo_filter(1); # disable psuedogene checking
+ if ($opt_O != 0) { # shorthand for setting options
+ $opt_C = 1; # for organellar scans
+ $opt_E = 0; # (mito/chloroplast)
+ $opt_T = 0;
+ $opt_P = 0;
+ $opt_G = 1; # use original "General" tRNA model
+
+ $Org_mode = 1;
+ $Cutoff = 15; # lower cove cutoff score
+ $skip_pseudo_filter = 1; # disable psuedogene checking
}
-
- if ($opt_bact != 0) {
- $eufind->eufind_intscore(-36.0); # cutoff for bacterial tRNAs
- # using relaxed mode eufindtRNA
- $opts->search_mode("bacteria"); # use arch/bact SelCys covariance model
+
+ if ($opt_C != 0) { # do Cove scan only
+ $Cove_mode = 1;
+ $Tscan_mode = 0; # don't use tRNAscan unless
+ # also specified by -T option
+ $Eufind_mode = 0; # don't use eufindtRNA unless
+ # also specified by -E option
+ }
+ if ($opt_T != 0) { # do tRNAscan only, skip Cove
+ $Tscan_mode = 1;
+ $tscan_params = "-s"; # if only using tRNAscan, use
+ $strict_params = 1; # strict tRNAscan 1.3 params
+ # since Cove won't eliminate high
+ # false pos rate with default params
+ if ($opt_C == 0) { # if -C isn't also specified
+ $Cove_mode = 0; # turn off Cove filtering
+ }
+ if ($opt_E == 0) { # if -E option isn't also specified
+ $Eufind_mode = 0; # turn off eufindtRNA
+ }
}
- $cm->CM_check_for_introns(0);
- $cm->CM_check_for_split_halves(0);
- if ($opt_arch != 0) {
- $opts->CM_mode("cove");
- $eufind->eufind_intscore(-36.0); # cutoff for bacterial/arch tRNAs
- # using relaxed mode eufindtRNA
- $opts->search_mode("archaea"); # use Arch covariance model
-
- if ($opt_ncintron != 0) {
- $cm->CM_check_for_introns(1); # check for non-canonical introns
- }
-
- if ($opt_frag ne '') {
- $cm->CM_check_for_split_halves(1); # check for tRNA fragments of split tRNAs
- if ($opt_frag eq "#") {
- $opts->split_fragment_file("$fafile.frag");
- }
- elsif (($opt_frag eq "\$") ||
- ($opt_frag eq "-")) { # sends structure output to stdout
- $opts->split_fragment_file("-"); # instead of tabular output
- if ($opts->results_to_stdout()) {
- $opts->results_to_stdout(0);
- $opts->out_file("/dev/null");
- }
- }
- else {
- $opts->split_fragment_file($opt_frag);
- }
- &check_output_file($opts->split_fragment_file(), $opts->prompt_for_overwrite());
- }
+ if ($opt_t ne '') { # set tRNAscan search params
+ $opt_t = uc($opt_t);
+ if ($opt_t eq "R") {
+ $tscan_params = "-r"; # use relaxed tRNAscan params
+ $strict_params = 0;
+ }
+ elsif ($opt_t eq "S") {
+ $tscan_params = "-s"; # use strict tRNAscan v1.3 params
+ $strict_params = 1;
+ }
+ elsif ($opt_t eq "A") {
+ $tscan_params = "-a"; # use alternate tRNAscan params
+ $strict_params = 0;
+ }
+ else {
+ print STDERR "\nWARNING: tRNAscan parameter specified",
+ " with -t option not recognized.\n",
+ " Defaulting to strict tRNAscan params\n\n";
+ $tscan_params = "-s";
+ $strict_params = 1;
+ }
+ }
+
+ if ($opt_K != 0) { # don't merge redundant tRNAscan hits
+ # option only for diagnostic purposes
+ $Keep_tscan_repeats = 1;
+ }
+
+ if ($opt_E != 0) { # use eufindtRNA
+ $Eufind_mode = 1;
+ if ($opt_C == 0) {
+ $Cove_mode = 0; # turn off Cove filtering if not
+ # specified on command line
+ $eufind_params = ""; # use more strict default params
+ # if no Cove filtering
+ }
+ else { # use more relaxed params if using
+ # Cove filtering
+ $eufind_params = "-r";
+ }
+ if ($opt_T == 0) { # turn off tRNAscan if not specified
+ $Tscan_mode = 0; # on command line
+ }
}
- if ($opt_general != 0) { # use original general cove model
- $opts->search_mode("general"); # with all tRNAs from 3 domains
+ if ($opt_e ne '') { # set eufindtRNA search params
+ $opt_e = uc($opt_e);
+ if ($opt_e eq "R") {
+ $eufind_params = "-r"; # use relaxed params
+ } # does not look for poly T
+ elsif ($opt_e eq "N") {
+ $eufind_params = ""; # use default params
+ } # penalizes for no poly T
+ elsif ($opt_e eq "S") {
+ $eufind_params = "-s"; # use strict params
+ # requires poly T
+ $eufind_Intscore = -31.25; # default intermediate cutoff
+ # for original algorithm
+ }
+ else {
+ print STDERR "\nWARNING: EufindtRNA parameter specified",
+ " with -e option not recognized.\n",
+ " Defaulting to relaxed EufindtRNA params\n\n";
+ $eufind_params = "-r";
+ }
+ }
+
+ if (($opt_P != 0) || ($opt_B !=0)) {
+ $eufind_Intscore = -36.0; # cutoff for bacterial tRNAs
+ # using relaxed mode eufindtRNA
+ $Bact_mode = 1; # use arch/bact SelCys covariance model
}
- if ($opt_newscan && $opt_cove) {
- die "FATAL: Conflicting search options have been selected. --newscan and -C cannot be used simultaneously.\n";
+ if ($opt_A != 0) {
+ $eufind_Intscore = -36.0; # cutoff for bacterial/arch tRNAs
+ # using relaxed mode eufindtRNA
+ $Arch_mode = 1; # use Arch covariance model
}
- if ($opt_newscan) { # use old tRNAscan-SE method for scanning (Cove instead of infernal)
- $opts->CM_mode("infernal");
+ if ($opt_I != 1000) {
+ $eufind_Intscore = $opt_I;
}
- if ($opt_cove != 0) { # do Cove scan only
- $opts->CM_mode("cove");
+ if ($opt_z != 1000) { # pad both ends of first-pass hits with this
+ $Padding = $opt_z; # many extra bases before passing to Cove
}
-
- if ($opt_infernal != 0) { # do Cove scan only
- $opts->CM_mode("infernal");
+
+ if ($opt_g ne '') { # use alternate genetic code table
+ $gc_file = $opt_g;
+ $alt_gcode = 1;
}
-
- if ($opt_cove || $opt_infernal) {
- $opts->tscan_mode(0); # don't use tRNAscan unless
- # also specified by -T option
- $opts->eufind_mode(0); # don't use eufindtRNA unless
- # also specified by -E option
+
+ if ($opt_H != 0) { # get HMM score for tRNA hits
+ $get_hmm_score = 1;
}
-
- if ($opt_tscan != 0) { # do tRNAscan only, skip Cove
- $opts->tscan_mode(1);
- $tscan->tscan_params("-s"); # if only using tRNAscan, use
- $opts->strict_params(1); # strict tRNAscan 1.3 params
- # since Cove won't eliminate high
- # false pos rate with default params
-
- if (($opt_cove == 0) || ($opt_infernal == 0)) {
- $opts->CM_mode(""); # if -C isn't also specified
- } # turn off Cove filtering
- # if -i isn't also specified
- # turn off infernal filtering
- if ($opt_eufind == 0) { # if -E option isn't also specified
- $opts->eufind_mode(0); # turn off eufindtRNA
- }
+ if ($opt_c ne '') { # use alternate covariance model
+ $Alt_cm_file = $opt_c;
+ $skip_pseudo_filter = 1; # disable psuedogene checking
+ $get_hmm_score = 0; # don't try to get hmm score
}
- if ($opt_tmode ne '') { # set tRNAscan search params
- $opt_tmode = uc($opt_tmode);
- if ($opt_tmode eq "R") {
- $tscan->tscan_params("-r"); # use relaxed tRNAscan params
- $opts->strict_params(0);
- }
- elsif ($opt_tmode eq "S") {
- $tscan->tscan_params("-s"); # use strict tRNAscan v1.3 params
- $opts->strict_params(1);
- }
- elsif ($opt_tmode eq "A") {
- $tscan->tscan_params("-a"); # use alternate tRNAscan params
- $opts->strict_params(0);
- }
- else {
- print STDERR "\nWARNING: tRNAscan parameter specified",
- " with -t option not recognized.\n",
- " Defaulting to strict tRNAscan params\n\n";
- $tscan->tscan_params("-s");
- $opts->strict_params(1);
- }
- }
-
- if ($opt_nomerge != 0) { # don't merge redundant tRNAscan hits
- # option only for diagnostic purposes
- $tscan->keep_tscan_repeats(1);
+ if ($opt_G != 0) { # use original general cove model
+ $use_orig_cm = 1; # with all tRNAs from 3 domains
}
-
- if ($opt_eufind != 0) { # use eufindtRNA
- $opts->eufind_mode(1);
-
- if (($opt_cove == 0) || ($opt_infernal == 0)) {
- $opts->CM_mode(""); # if -C isn't also specified
- } # turn off Cove filtering
- # if -i isn't also specified
- # turn off infernal filtering
-
- if (!$opts->cove_mode() && !$opts->infernal_mode()) {
- $eufind->eufind_params(""); # use more strict default params
- # if no second-pass filtering
- }
- else { # use more relaxed params if using
- # second-pass filtering
- $eufind->eufind_params("-r");
- }
- if ($opt_tscan == 0) { # turn off tRNAscan if not specified
- $opts->tscan_mode(0); # on command line
- }
- }
-
- if ($opt_emode ne '') { # set eufindtRNA search params
- $opt_emode = uc($opt_emode);
- if ($opt_emode eq "R") {
- $eufind->eufind_params("-r"); # use relaxed params
- } # does not look for poly T
- elsif ($opt_emode eq "N") {
- $eufind->eufind_params(""); # use default params
- } # penalizes for no poly T
- elsif ($opt_emode eq "S") {
- $eufind->eufind_params("-s"); # use strict params
- # requires poly T
- $eufind->eufind_intscore(-31.25); # default intermediate cutoff
- # for original algorithm
- }
- else {
- print STDERR "\nWARNING: EufindtRNA parameter specified",
- " with -e option not recognized.\n",
- " Defaulting to relaxed EufindtRNA params\n\n";
- $eufind->eufind_params("-r");
- }
- }
-
- if ($opt_iscore != 1000) {
- $eufind->eufind_intscore($opt_iscore);
- }
-
- if ($opt_pad != 1000) { # pad both ends of first-pass hits with this
- $opts->padding($opt_pad); # many extra bases before passing to Cove
- }
-
- if ($opt_gencode ne '') { # use alternate genetic code table
- $opts->gc_file($opt_gencode);
- $opts->alt_gcode(1);
+
+ if ($opt_m ne '') { # save stats summary file
+ $save_stats = 1;
+ if ($opt_m eq "#") {
+ $stats_file = "$fafile.stats";
+ }
+ else {
+ $stats_file = $opt_m;
+ }
+ &open_for_write(TESTF,$stats_file);
+ close(TESTF);
}
-
- if ($opt_breakdown != 0) { # get HMM score for tRNA hits
- $cm->get_hmm_score(1);
- }
-
- if ($opt_cm ne '') { # use alternate covariance model
- $cm->alt_cm_file($opt_cm);
- $cm->skip_pseudo_filter(1); # disable psuedogene checking
- $cm->get_hmm_score(0); # don't try to get hmm score
- }
-
- if ($opt_stats ne '') { # save stats summary file
- $opts->save_stats(1);
- if ($opt_stats eq "#") {
- $opts->stats_file("$fafile.stats");
- }
- else {
- $opts->stats_file($opt_stats);
- }
- &check_output_file($opts->stats_file(), $opts->prompt_for_overwrite());
- }
-
- if ($opt_w ne '') { # save coves secondary structures for
- $opts->save_odd_struct(1); # tRNA's whose acodons it couldn't call
- if ($opt_w eq "#") {
- $opts->odd_struct_file("$fafile.oddstruct");
- }
- else {
- $opts->odd_struct_file($opt_w);
- }
- &check_output_file($opts->odd_struct_file(), $opts->prompt_for_overwrite());
- }
-
- if ($opt_struct ne '') { # save all coves secondary structures
- $opts->save_all_struct(1);
- if ($opt_struct eq "#") {
- $opts->all_struct_file("$fafile.ss");
- }
- elsif (($opt_struct eq "\$") ||
- ($opt_struct eq "-")) { # sends structure output to stdout
- $opts->all_struct_file("-"); # instead of tabular output
- if ($opts->results_to_stdout()) {
- $opts->results_to_stdout(0);
- $opts->out_file("/dev/null");
- }
- }
- else {
- $opts->all_struct_file($opt_struct);
- }
- &check_output_file($opts->all_struct_file(), $opts->prompt_for_overwrite());
+
+ if ($opt_w ne '') { # save coves secondary structures for
+ $save_odd_struct = 1; # tRNA's whose acodons it couldn't call
+ if ($opt_w eq "#") {
+ $odd_struct_file = "$fafile.oddstruct";
+ }
+ else {
+ $odd_struct_file = $opt_w;
+ }
+ &open_for_write(TESTF,$odd_struct_file);
+ close(TESTF);
+
+ }
+ if ($opt_f ne '') { # save all coves secondary structures
+ $save_all_struct = 1;
+ if ($opt_f eq "#") {
+ $all_struct_file = "$fafile.ss";
+ }
+ elsif (($opt_f eq "\$") ||
+ ($opt_f eq "-")) { # sends structure output to stdout
+ $all_struct_file = "-"; # instead of tabular output
+ if ($results_to_stdout) {
+ $results_to_stdout = 0;
+ $out_file = "/dev/null";
+ }
+ }
+ else {
+ $all_struct_file = $opt_f;
+ }
+ &open_for_write(TESTF,$all_struct_file);
+ close(TESTF);
}
- if ($opt_missed ne '') { # save only seqs without a tRNA hit
- $opts->save_missed(1);
- if ($opt_missed eq "#") {
- $opts->missed_seq_file("$fafile.missed");
- }
- else {
- $opts->missed_seq_file($opt_missed);
- }
- &check_output_file($opts->missed_seq_file(),$opts->prompt_for_overwrite());
- }
-
- # outputs PID number in file for
- # tRNAscan-SE web server program
+ if ($opt_M ne '') { # save only seqs without a tRNA hit
+ $save_missed = 1;
+ if ($opt_M eq "#") {
+ $missed_seq_file = "$fafile.missed";
+ }
+ else {
+ $missed_seq_file = $opt_M;
+ }
+ &open_for_write(TESTF,$missed_seq_file);
+ close(TESTF);
+ }
+
+ # outputs PID number in file for
+ # tRNAscan-SE web server program
if ($opt_Y != 0) {
- &check_output_file("$fafile.pid", $opts->prompt_for_overwrite());
- &open_for_write(\*TESTF, "$fafile.pid");
- print TESTF "PID=$$\n";
- close(TESTF);
- }
-
- if ($opt_verbose ne '') { # save verbose tRNAscan output
- $opts->save_verbose(1);
- my $tmp_verb = &tempname($temp_dir,".vb"); # get temp output file name
- &check_output_file($tmp_verb, $opts->prompt_for_overwrite());
- $opts->tscan_params($opts->tscan_params() . "-v $tmp_verb");
- if ($opt_verbose eq "#") {
- $opts->verb_file("$fafile.verb");
- }
- else {
- $opts->verb_file($opt_verbose);
- }
- &check_output_file($opts->verb_file(),$opts->prompt_for_overwrite());
- }
-
- if ($opt_filter ne '') { # use previous results output file
- $opts->tscan_mode(0);
- $opts->eufind_mode(0);
- $opts->use_prev_ts_run(1);
- $opts->firstpass_result_file($opt_filter);
- if (!(-e $opts->firstpass_result_file())) {
- die "FATAL: Can't find formatted tRNA output file ",
- $opts->firstpass_result_file()."\n\n";
- }
- }
- elsif ($opt_fsres ne '') { # create named file for first
- $opts->save_firstpass_res(1); # pass results
- if ($opt_fsres eq "#") {
- $opts->firstpass_result_file("$fafile.fpass.out");
- }
- else {
- $opts->firstpass_result_file($opt_fsres);
- }
- &check_output_file($opts->firstpass_result_file(), $opts->prompt_for_overwrite());
- &init_fp_result_file($opts->firstpass_result_file());
+ &open_for_write(TESTF,"$fafile.pid");
+ print TESTF "PID=$$\n";
+ close(TESTF);
+ }
+
+ if ($opt_v ne '') { # save verbose tRNAscan output
+ $save_verbose = 1;
+ $tmp_verb = &tempname(".vb"); # get temp output file name
+ &open_for_write(TESTF,$tmp_verb);
+ close(TESTF);
+ $tscan_params .= "-v $tmp_verb";
+ if ($opt_v eq "#") {
+ $verb_file = "$fafile.verb";
+ }
+ else {
+ $verb_file = $opt_v;
+ }
+ &open_for_write(TESTF,$verb_file);
+ close(TESTF);
+ }
+
+ if ($opt_u ne '') { # use previous results output file
+ $Tscan_mode = 0;
+ $Eufind_mode = 0;
+ $Cove_mode = 1;
+ $use_prev_ts_run = 1;
+ $firstpass_result_file = $opt_u;
+ if (!(-e $firstpass_result_file)) {
+ die "FATAL: Can't find formatted tRNA output file",
+ " $firstpass_result_file\n\n";
+ }
+ }
+ elsif ($opt_r ne '') { # create named file for first
+ $save_firstpass_res = 1; # pass results
+ if ($opt_r eq "#") {
+ $firstpass_result_file = "$fafile.fpass.out";
+ }
+ else {
+ $firstpass_result_file = $opt_r;
+ }
+ &open_for_write(TESTF,$firstpass_result_file);
+ print TESTF "Sequence\t\ttRNA Bounds\ttRNA\tAnti\t\n";
+ print TESTF "Name \ttRNA #\tBegin\tEnd\tType\tCodon\t",
+ "SeqID\tSeqLen\tScore\n";
+ print TESTF "--------\t------\t-----\t---\t----\t-----\t",
+ "-----\t------\t-----\n";
+ close(TESTF);
}
- else { # create temp file for firstpass output
- $opts->firstpass_result_file(&tempname($temp_dir, ".fpass"));
- &check_output_file($opts->firstpass_result_file(), $opts->prompt_for_overwrite());
- &init_fp_result_file($opts->firstpass_result_file());
- }
+ else { # create temp file for firstpass output
+ $firstpass_result_file = &tempname(".fpass");
+ &open_for_write(TESTF,$firstpass_result_file);
+ print TESTF "Sequence\t\ttRNA Bounds\ttRNA\tAnti\t\n";
+ print TESTF "Name \ttRNA #\tBegin\tEnd\tType\tCodon\t",
+ "SeqID\tSeqLen\tScore\n";
+ print TESTF "--------\t------\t-----\t---\t----\t-----\t",
+ "-----\t------\t-----\n";
+ close(TESTF);
+ }
- if ($opt_falsepos ne '') { # save false positive tRNAs from
- $opts->save_falsepos(1); # first-pass scans that Cove bonked
- $opts->save_source(1); # save source of tRNA hit (-y option)
- if ($opt_falsepos eq "#") {
- $opts->falsepos_file("$fafile.fpos");
- }
- else {
- $opts->falsepos_file($opt_falsepos);
- }
- &check_output_file($opts->falsepos_file(), $opts->prompt_for_overwrite());
- }
-
- if ($opt_len > 0) {
- $opts->max_int_len($opt_len); # set MAX intron+variable loop region size
- # used in EufindtRNA & Cove
-
- if ($opts->use_prev_ts_run() || $opts->eufind_mode()) {
- $opts->find_long_tRNAs(1); # look for long tRNAs if needed
- }
- else {
- $cm->max_cove_tRNA_length($opts->max_int_len() + $cm->min_tRNA_no_intron());
- }
- }
-
- if ($opt_progress != 0) {
- $log->open_file("-") ||
- die "FATAL: Unable to open standard out to display program progress\n\n";
- $opts->display_progress(1);
- }
- elsif ($opt_log ne '') {
- if ($opt_log eq "#") {
- $opts->log_file("$fafile.log");
- }
- else {
- $opts->log_file($opt_log);
- }
- &check_output_file($opts->log_file(), $opts->prompt_for_overwrite());
- $log->open_file($opts->log_file());
- $opts->save_progress(1);
+ if ($opt_F ne '') { # save false positive tRNAs from
+ $save_falsepos = 1; # first-pass scans that Cove bonked
+ $save_source = 1; # save source of tRNA hit (-y option)
+ if ($opt_F eq "#") {
+ $falsepos_file = "$fafile.fpos";
+ }
+ else {
+ $falsepos_file = $opt_F;
+ }
+ &open_for_write(TESTF,$falsepos_file);
+ close(TESTF);
+ }
+
+ if ($opt_L > 0) {
+ $max_int_len = $opt_L; # set MAX intron+variable loop region size
+ # used in EufindtRNA & Cove
+
+ if ($use_prev_ts_run || $Eufind_mode) {
+ $find_long_tRNAs = 1; # look for long tRNAs if needed
+ }
+ else {
+ $Max_Cove_tRNA_length = $max_int_len + $Min_tRNA_no_intron;
+ }
+ }
+
+ if ($opt_d != 0) {
+ open (LOGFILE,">-") ||
+ die "FATAL: Unable to open standard out to display ",
+ "program progress\n\n";
+ $display_progress = 1;
+ }
+ elsif ($opt_l ne '') {
+ if ($opt_l eq "#") {
+ $log_file = "$fafile.log";
+ }
+ else {
+ $log_file = $opt_l;
+ }
+ &open_for_write (LOGFILE,"$log_file");
+ select(LOGFILE);
+ $|=1;
+ $save_progress = 1;
}
else {
- $log->open_file("/dev/null") ||
- die "FATAL: Unable to open /dev/null to record program progress\n\n";
+ open (LOGFILE,">/dev/null");
}
- if ($opt_version != 0) { # use alternate tRNAscan version
- $tscan->tscan_version($opt_version);
+ if ($opt_V != 0) { # use alternate tRNAscan version
+ $tscan_version = $opt_V;
}
- if ($opt_score != 1000) { # use different Cove-score cutoff for reporting
- # "real" tRNAs
- $cm->cm_cutoff($opt_score); # dummy opt_X val is 10,000 to avoid overlap
- # with a real value a user might specify
+ if ($opt_X != 1000) { # use different Cove-score cutoff for reporting
+ # "real" tRNAs
+ $Cutoff = $opt_X; # dummy opt_X val is 10,000 to avoid overlap
+ # with a real value a user might specify
}
+
- if ($#ARGV == 0) { # only one seq file on command line
- $opts->multiple_files(0);
- $opts->fasta_file($ARGV[0]);
+ if ($#ARGV == 0) { # only one seq file on command line
+ $multiple_files = 0;
+ $fastafile = $ARGV[0];
}
- else {
- $opts->multiple_files(1);
- my $tmp_multiseq_file = &tempname($temp_dir, ".mseq");
- &check_output_file($tmp_multiseq_file, $opts->prompt_for_overwrite());
- foreach my $filename (@ARGV) {
- system("cat $filename >> $tmp_multiseq_file");
- }
- $opts->fasta_file($tmp_multiseq_file);
+ else {
+ $multiple_files = 1;
+ $tmp_multiseq_file = &tempname(".mseq");
+ &open_for_write(TESTF,$tmp_multiseq_file);
+ close(TESTF);
+ foreach $filename (@ARGV) {
+ system("cat $filename >> $tmp_multiseq_file");
+ }
+ $fastafile = $tmp_multiseq_file;
}
+}
- if ($opts->cove_mode()) {
- $opts->second_pass_label("Cove");
- }
- if ($opts->infernal_mode()) {
- $opts->second_pass_label("Infernal");
- }
+# Initialize counters, temp file names, complement map, &
+# genetic translation maps
+
+sub Initialize_vars {
+
+ local(*seqs_hit, *numscanned, *trna_total,
+ *first_pass_base_ct, *fpass_trna_base_ct,*fpos_base_ct,
+ *covels_base_ct, *coves_base_ct, *total_covels_ct,
+ *tmp_raw,*tmp_fa,*tmp_trnaseq,*printed_header, *ruler,
+ *CompMap,*AmbigTransMap,*TransMap, *OneLetTransMap,$alt_gcode,$gc_file,
+ *Tscan_mask, *Eufind_mask, *SourceTab) = @_;
+
+ local($acodon);
+
+ # Bit-wise masks for source of tRNA hits
+
+ $Tscan_mask = 1; $Eufind_mask = 2;
+
+ # Source of first-pass hits table
+ # C = Cove, T = tRNAscan, E = EufindtRNA, B = both
+
+ @SourceTab = ('Cv','Ts','Eu','Bo');
+
+ $seqs_hit = 0; # num seqs with at least one trna hit
+ $numscanned = 0; # total sequences scanned
+ $trnatotal = 0; # total trnas found by tscan
+
+ $first_pass_base_ct = 0; # no bases in all seqs in first pass scans
+ $fpass_trna_base_ct = 0; # no bases in tRNAs in first pass scans
+ $fpos_base_ct = 0; # no bases in false positive tRNAs
+ $covels_base_ct = 0;
+ $coves_base_ct = 0;
+ $total_covels_ct = 0;
+
+ %CompMap = (
+ 'A' => 'T', 'T' => 'A', 'U' => 'A',
+ 'G' => 'C', 'C' => 'G',
+ 'Y' => 'R', 'R' => 'Y',
+ 'S' => 'W', 'W' => 'S',
+ 'M' => 'K', 'K' => 'M',
+ 'B' => 'V', 'V' => 'B',
+ 'H' => 'D', 'D' => 'H',
+ 'N' => 'N', 'X' => 'X',
+ '?' => '?');
+
+ # Amino acid -> Anti-codon list for printing out global tRNA summary
+
+ %ACList = (
+ 'Ala' => [qw/AGC GGC CGC TGC/],
+ 'Gly' => [qw/ACC GCC CCC TCC/],
+ 'Pro' => [qw/AGG GGG CGG TGG/],
+ 'Thr' => [qw/AGT GGT CGT TGT/],
+ 'Val' => [qw/AAC GAC CAC TAC/],
+
+ 'Ser' => [qw/AGA GGA CGA TGA ACT GCT/],
+ 'Arg' => [qw/ACG GCG CCG TCG CCT TCT/],
+ 'Leu' => [qw/AAG GAG CAG TAG CAA TAA/],
+
+ 'Phe' => [qw/AAA GAA     /],
+
+ 'Asn' => [qw/ATT GTT     /],
+ 'Lys' => [qw/    CTT TTT/],
+
+ 'Asp' => [qw/ATC GTC     /],
+ 'Glu' => [qw/    CTC TTC/],
+
+ 'His' => [qw/ATG GTG     /],
+ 'Gln' => [qw/    CTG TTG/],
+
+ 'Tyr' => [qw/ATA GTA     /],
+ 'Supres' => [qw/    CTA TTA/],
+
+ 'Ile' => [qw/AAT GAT   TAT/],
+ 'Met' => [qw/    CAT  /],
+
+ 'Cys' => [qw/ACA GCA     /],
+ 'Trp' => [qw/    CCA  /],
+ 'SelCys' => [qw/      TCA/]
+
+ );
- $cm->CM_mode($opts->CM_mode());
- $opts->temp_dir($temp_dir);
+ @Isotypes = ('Ala', 'Gly', 'Pro', 'Thr', 'Val',
+ 'Ser', 'Arg', 'Leu',
+ 'Phe','Asn', 'Lys', 'Asp', 'Glu', 'His', 'Gln',
+ 'Ile', 'Met', 'Tyr', 'Supres', 'Cys', 'Trp', 'SelCys');
+
+ # Read in translation table
+
+ &Read_transl_table(*AmbigTransMap,*TransMap,
+ *OneLetTransMap,$alt_gcode,$gc_file);
+
+ # set temp file names
+
+ $tmp_raw = &tempname(".raw"); # for raw tscan output
+ $tmp_fa = &tempname(".fa"); # for current fasta seq file
+ $tmp_trnaseq = &tempname(".trna"); # for current tRNA seq
+
+ $printed_header = 0; # keeps track of whether or
+ # or not results column header
+ # has been printed yet
+
+ $ruler = ' * |' x 20; # ruler printed out with
+ # secondary structure output
+}
+
+sub Read_transl_table {
+
+ local(*AmbigTransMap,*TransMap,*OneLetTransMap,$alt_gcode,$gc_file) = @_;
+ local($acodon, at expanded_set,$expanded_ac,$gc_file_path);
+
+ # Read in default genetic code table (may contain ambiguous bases) at
+ # end of this source file
+
+ while (<DATA>) {
+ if ((/^[^\#]/) &&
+ (/^([ACGTUNRYSWMKBDHV]{3,3})\s+(\S+)\s+(\S)/i)) {
+ $acodon = uc($1);
+ $AmbigTransMap{&RevCompSeq(*acodon)} = $2;
+ $OneLetTransMap{$2} = $3;
+ }
+ }
+
+ $OneLetTransMap{"Undet"} = "?";
+ $OneLetTransMap{"SeC(p)"} = "Z";
+ $OneLetTransMap{"SeC(e)"} = "Z";
+
+ # Convert any ambiguous bases to make all non-ambigous codons
+ # and save translated amino acid
+
+ @expanded_set = ();
+ foreach $acodon (sort keys(%AmbigTransMap)) {
+ push(@expanded_set,&expand_ambig($acodon));
+ foreach $expanded_ac (@expanded_set) {
+ $TransMap{$expanded_ac} = $AmbigTransMap{$acodon};
+ }
+ @expanded_set = ();
+ }
+
+ if ($alt_gcode) {
+
+ %AltTransMap = ();
+
+ if (-r $gc_file) {
+ $gc_file_path = $gc_file;
+ }
+ elsif (-r "/usr/local/lib/tRNAscanSE/".$gc_file) {
+ $gc_file_path = "/usr/local/lib/tRNAscanSE/".$gc_file;
+ }
+ else {
+ die "FATAL: Could not find $gc_file translation codon file\n\n";
+ }
+
+ open (GC_TABLE,"$gc_file_path") ||
+ die "FATAL: Could not find $gc_file translation codon file\n\n";
+
+ # Read in genetic code table (may contain ambiguous bases)
+
+ while (<GC_TABLE>) {
+ if ((/^[^\#]/)
+ && (/^([ACGTUNRYSWMKBDHV]{3,3})\s+(\S+)\s+(\S)/i))
+ {
+ $acodon = uc($1);
+ $AltTransMap{&RevCompSeq(*acodon)} = $2;
+ $OneLetTransMap{$2} = $3;
+ }
+ }
+ close GC_TABLE;
+
+ # Convert any ambiguous bases to make all non-ambigous codons
+ # and save translated amino acid
+
+ @expanded_set = ();
+ foreach $acodon (sort keys(%AltTransMap)) {
+ push(@expanded_set,&expand_ambig($acodon));
+ foreach $expanded_ac (@expanded_set) {
+ $TransMap{$expanded_ac} = $AltTransMap{$acodon};
+ }
+ @expanded_set = ();
+ }
+ }
+}
+
+
+sub expand_ambig {
+ local($ac) = @_;
+
+ $ac = " ".$ac." ";
+
+ while (index($ac,'N') != -1) {
+ $ac =~ s/(.*)\s(\S*)N(\S*)\s(.*)/$1 $2A$3 $2C$3 $2G$3 $2T$3 $4/g;
+ }
+ &expand2(*ac,'Y','C','T'); &expand2(*ac,'R','A','G');
+ &expand2(*ac,'W','A','T'); &expand2(*ac,'S','C','G');
+ &expand2(*ac,'M','A','C'); &expand2(*ac,'K','G','T');
+
+ &expand3(*ac,'V','A','C','G'); &expand3(*ac,'B','C','G','T');
+ &expand3(*ac,'H','A','C','T'); &expand3(*ac,'D','A','G','T');
+
+ $ac = substr($ac,1);
+ return (split(/ /,$ac));
+}
+
+sub expand2 {
+ local(*acodon,$Ambig_base,$sub1,$sub2) = @_;
+
+ while (index($acodon,$Ambig_base) != -1) {
+ $acodon =~ s/(.*)\s(\S*)$Ambig_base(\S*)\s(.*)/$1 $2$sub1$3 $2$sub2$3 $4/g;
+ }
+}
+
+sub expand3 {
+ local(*acodon,$Ambig_base,$sub1,$sub2,$sub3) = @_;
+
+ while (index($acodon,$Ambig_base) != -1) {
+ $acodon =~ s/(.*)\s(\S*)$Ambig_base(\S*)\s(.*)/$1 $2$sub1$3 $2$sub2$3 $2$sub3$3 $4/g;
+ }
+
+}
+
+sub Get_tRNA_type {
+
+ local($ac,$cm_file) = @_; # anticodon to be decoded
+ local($prev_type,$type);
+
+ if ($cv_anticodon eq '???') {
+ return 'Unkown';
+ }
+ elsif ($cm_file eq $Pselc_cm_file_path) {
+ return 'SeC(p)';
+ }
+ elsif ($cm_file eq $Eselc_cm_file_path) {
+ return 'SeC(e)';
+ }
+ else {
+ $prev_type = 'INIT';
+ foreach $exp_codon (&expand_ambig($ac)) {
+ $type = $TransMap{$exp_codon};
+ if (($type ne $prev_type) && ($prev_type ne 'INIT')) {
+ return 'Unknown';
+ }
+ $prev_type = $type;
+ }
+ return $type;
+ }
+}
+
+sub display_credits {
+
+ print STDERR "\n Please cite: \n",
+ "\tLowe, T.M. & Eddy, S.R. (1997) \"tRNAscan-SE: A program for\n",
+ "\timproved detection of transfer RNA genes in genomic sequence\"\n",
+ "\tNucl. Acids Res. 25: 955-964.\n",
+ "\n This program uses a modified, optimized version of tRNAscan v1.3\n",
+ " (Fichant & Burks, J. Mol. Biol. 1991, 220: 659-671),\n",
+ " a new implementation of a multistep weight matrix algorithm\n",
+ " for identification of eukaryotic tRNA promoter regions\n",
+ " (Pavesi et al., Nucl. Acids Res. 1994, 22: 1247-1256),\n",
+ " as well as the RNA covariance analysis package Cove v.2.4.2\n",
+ " (Eddy & Durbin, Nucl. Acids Res. 1994, 22: 2079-2088).\n\n";
+
+}
+
+sub display_run_options {
+ local(*FHAND) = @_;
+
+ print FHAND ('-' x 60,"\n",
+ "Sequence file(s) to search: ",join(', ', at ARGV),"\n");
+ if ($seq_key ne '\S*') {
+ if ($start_at_key) {
+ print FHAND "Starting at sequence name: $raw_seq_key\n" }
+ else {
+ print FHAND "Search only names matching: $raw_seq_key\n" }
+ }
+
+ print FHAND "Search Mode: ";
+ if ($Bact_mode) {
+ print FHAND "Bacterial\n";
+ }
+ elsif ($Arch_mode) {
+ print FHAND "Archaeal\n";
+ }
+ elsif ($Org_mode) {
+ print FHAND "Organellar\n";
+ }
+ elsif ($use_orig_cm) {
+ print FHAND "General\n";
+ }
+ else {
+ print FHAND "Eukaryotic\n";
+ }
+
+ print FHAND "Results written to: ",
+ &print_filename($out_file),"\n";
+
+ print FHAND "Output format: ";
+ if ($ace_output) {
+ print FHAND "ACeDB\n"; }
+ else {
+ print FHAND "Tabular\n"; }
+
+ print FHAND "Searching with: ";
+ if ($Eufind_mode) {
+ if ($Tscan_mode) {
+ if ($Cove_mode) {
+ print FHAND "tRNAscan + EufindtRNA -> Cove\n"; }
+ else {
+ print FHAND "tRNAscan + EufindtRNA (no Cove)\n"; }
+ }
+ elsif ($Cove_mode) {
+ print FHAND "EufindtRNA->Cove\n"; }
+ else {
+ print FHAND "EufindtRNA only\n"; }
+ }
+ elsif ($Tscan_mode) {
+ if ($Cove_mode) {
+ print FHAND "tRNAscan->Cove\n"; }
+ else {
+ print FHAND "tRNAscan only\n"; }
+ }
+ else {
+ print FHAND "Cove only\n";
+ }
+
+ if ($Alt_cm_file eq '') {
+ print FHAND "Covariance model: $Main_cm_file\n";
+ }
+ else {
+ print FHAND "Use alt. covariance model: $Alt_cm_file\n";
+ }
+
+ if ($Cutoff != 20.0) {
+ print FHAND "tRNA Cove cutoff score: $Cutoff\n";
+ }
+
+ if ($use_prev_ts_run) {
+ print FHAND "Using previous\n",
+ "tabular output file: $firstpass_result_file\n";
+ }
+
+ if ($tscan_version != 1.4) {
+ print FHAND "Alternate tRNAscan version: $tscan_version\n";
+ }
+
+ if ($Tscan_mode) {
+ print FHAND "tRNAscan parameters: ";
+ if ($strict_params) {
+ print FHAND "Strict\n"; }
+ else {
+ print FHAND "Relaxed\n"; }
+ }
+
+ if ($Eufind_mode) {
+ print FHAND "EufindtRNA parameters: ";
+ if ($eufind_params eq "-r") {
+ print FHAND "Relaxed (Int Cutoff= $eufind_Intscore)\n"; }
+ elsif ($eufind_params eq "") {
+ print FHAND "Normal\n"; }
+ elsif ($eufind_params eq "-s") {
+ print FHAND "Strict\n"; }
+ else {
+ print FHAND "?\n"; }
+ }
+
+ if ($Padding != $Default_Padding) {
+ print FHAND "First-pass tRNA hit padding: $Padding bp\n";
+ }
+
+ if ($alt_gcode) {
+ print FHAND "Alternate transl code used: ",
+ "from file $gc_file\n";
+ }
+
+ if ($save_all_struct) {
+ print FHAND "tRNA secondary structure\n",
+ " predictions saved to: ";
+ if ($all_struct_file eq "-") {
+ print FHAND "Standard output\n";
+ }
+ else {
+ print FHAND "$all_struct_file\n";
+ }
+ }
+ if ($save_odd_struct) {
+ print FHAND "Sec structures for tRNAs\n",
+ " with no anticodon predictn: $odd_struct_file\n";
+ }
+ if ($save_firstpass_res) {
+ print FHAND "First-pass results saved i: ",
+ "$firstpass_result_file\n";
+ }
+ if ($save_progress) {
+ print FHAND "Search log saved in: $log_file\n";
+ }
+ if ($save_stats) {
+ print FHAND "Search statistics saved in: $stats_file\n";
+ }
+ if ($save_falsepos) {
+ print FHAND "False positives saved in: $falsepos_file\n";
+ }
+ if ($save_missed) {
+ print FHAND "Seqs with 0 hits saved in: $missed_seq_file\n";
+ }
+ if ($skip_pseudo_filter | $get_hmm_score | $Keep_tscan_repeats) {
+ print FHAND "\n";
+ }
+ if ($max_int_len != $Def_max_int_len) {
+ print FHAND "Max intron + var. length: $max_int_len\n";
+ }
+ if ($skip_pseudo_filter) {
+ print FHAND "Pseudogene checking disabled\n";
+ }
+ if ($get_hmm_score) {
+ print FHAND "Reporting HMM/2' structure score breakdown\n";
+ }
+ if ($Keep_tscan_repeats) {
+ print FHAND "Redundant tRNAscan hits not merged\n";
+ }
+
+ print FHAND ('-' x 60,"\n\n");
+}
+
+sub print_results_header {
+ local($out_file,$MaxSeqNameWidth,$MaxSeqLenWidth) = @_;
+
+ local($label,$codon_label) = "";
+
+ if ($Cove_mode) {
+ $label = "\tCove";
+ }
+ elsif ($Eufind_mode && !$Tscan_mode) {
+ $label = "\tEufind";
+ }
+
+ if ($output_codon) {
+ $codon_label = " ";
+ }
+ else {
+ $codon_label = "Anti";
+ }
+
+ if (!($ace_output)) {
+ &open_for_append(OUTFILE,$out_file);
+
+ printf OUTFILE "%-".$MaxSeqNameWidth."s\t\t","Sequence";
+ printf OUTFILE "%-".$MaxSeqLenWidth."s\t","tRNA";
+ printf OUTFILE "%-".$MaxSeqLenWidth."s\t","Bounds";
+ print OUTFILE "tRNA\t$codon_label\tIntron Bounds",$label;
+
+ if ($get_hmm_score) {
+ print OUTFILE "\tHMM\t2'Str\n";
+ }
+ else {
+ print OUTFILE "\n";
+ }
+
+ printf OUTFILE "%-".$MaxSeqNameWidth."s\t","Name";
+ print OUTFILE "tRNA \#\t";
+ printf OUTFILE "%-".$MaxSeqLenWidth."s\t","Begin";
+ printf OUTFILE "%-".$MaxSeqLenWidth."s\t","End";
+
+ print OUTFILE "Type\tCodon\tBegin\tEnd\tScore";
+
+ if ($get_hmm_score) {
+ print OUTFILE "\tScore\tScore\n";
+ }
+ else {
+ print OUTFILE "\n";
+ }
+
+
+ printf OUTFILE "%-".$MaxSeqNameWidth."s\t","--------";
+ print OUTFILE "------\t";
+ printf OUTFILE "%-".$MaxSeqLenWidth."s\t","----";
+ printf OUTFILE "%-".$MaxSeqLenWidth."s\t","------";
+ print OUTFILE "----\t-----\t-----\t----\t------";
+
+ if ($get_hmm_score) {
+ print OUTFILE "\t-----\t-----\n";
+ }
+ else {
+ print OUTFILE "\n";
+ }
+
+
+ }
+ close OUTFILE;
+}
+
+
+sub Error_exit_status {
+ local($progName,$SeqName) = @_;
+
+ if ($? != 0) {
+ print STDERR "$progName could not complete successfully for $SeqName.\n",
+ "Possible memory allocation problem or missing file. (Exit code=",$?,").\n\n";
+ return 1;
+ }
+ else {
+ return 0;
+ }
+}
+
+
+sub Run_tRNAscan {
+ local($tscan_version,$tscan_bin,$tscan_params,
+ $tmp_fa,$tmp_raw, $start_index) = @_;
+
+ # version provided with distribution
+
+ if ($tscan_version == 1.4) {
+ # run default tRNAscan 1.4 using selected param set
+ system ("$tscan_bin -i $start_index -c $tscan_params $tmp_fa > $tmp_raw");
+ if (&Error_exit_status("tRNAscan",$SeqName)) {
+ return -1;
+ }
+ }
+
+ # run tRNAscan without conservative ambiguous base pairing rules
+ # not available in distribution version
+
+ elsif ($tscan_version == 1.39) {
+ system ("$tscan_bin -c $tscan_params $tmp_fa > $tmp_raw");
+ }
+
+ # run tRNAscan v2.0, not available in distribution version
+
+ elsif ($tscan_version == 2) {
+ system ("$tscan_bin -SEQ $tmp_fa -TEMPLATE SEtemplate -OUTPUT $tmp_raw > /dev/null");
+ }
+
+ # run original tRNAscan 1.3, not available in distribution version
+
+ elsif ($tscan_version == 1.3) {
+ if (!(-r "./TPCsignal")) {
+ system ("ln -s ".$lib_dir."TPCsignal TPCsignal");
+ }
+ if (!(-r "./Dsignal")) {
+ system ("ln -s ".$lib_dir."Dsignal Dsignal");
+ }
+ system ("reformat -ld genbank $tmp_fa > tmp.gb");
+ system ("$tscan_bin tmp.gb $tmp_raw > /dev/null");
+ system ("rm tmp.gb");
+ }
+ else {
+ die "FATAL: Illegal tRNAscan version.\n\n";
+ }
+}
+
+# Append tRNAscan verbose output to
+# result file with header tag
+
+sub Append_verbfile {
+ local($verb_file) = @_;
+
+ open (TSCANVERB, ">>$verb_file") ||
+ die "FATAL: Unable to open verbose output file $tmp_fa\n\n";
+
+ print TSCANVERB "\n>>>> tRNA-Scan verbose output for <$SeqName>\n\n";
+ close TSCANVERB;
+ system ("cat tscan.verb.out >>$verb_file");
+}
+
+# extract trna hits from raw result file while weeding out repeated hits
+# save non-redundant hits in "hit_list" array
+
+sub Process_tRNAscan_hits {
+
+ local(*hit_list,$tmp_raw) = @_;
+ local($istart,$iend,$from,$to,$intron,$trnact,$len,
+ $anticodon,$iso_type,$sense_strand,$pos, $i);
+
+ $trnact = 0; # trna count for this sequence
+ $istart = 0; $iend = 0; # intron bounds
+ $from = 0; $to = 0; # tRNA bounds
+ $len = 0; # tRNA length
+ $intron = 0; # intron present? flag
+ $anticodon = '';
+ $iso_type = '';
+ $score = 0;
+
+ # open trnascan raw output file for current seq
+
+ open (TSCANRAW,"$tmp_raw") ||
+ die ("FATAL: Unable to open temp raw output file $tmp_raw\n\n");
+
+
+ # parse one complete hit per call
+ while (&Parse_tscan_hit($tscan_version,TSCANRAW,*from,*to,*sense_strand,
+ *istart,*iend,*intron,*len,*iso_type,
+ *anticodon,*pos)) {
+
+
+ if ($Keep_tscan_repeats ||
+ (!&Merge_repeat_hit(*hit_list,*trnact,*trnatotal,$from,$to,
+ $sense_strand,$iso_type,$score,$Tscan_mask)))
+
+ # if NOT a repeat hit, put it on the hit list
+ {
+
+ # check to see if tscan 1.3 has incorrectly reported
+ # start/end index (happens occassionally)
+
+ if ((abs($to-$from)+1) != $len) {
+ if ($sense_strand) {
+ $to = $from + $len - 1; }
+ else {
+ $to = $from - $len + 1; }
+ }
+
+ $i=0;
+ while (($i <= $#hit_list) &&
+ ($hit_list[$i]{position} < $pos)) {
+ $i++;
+ }
+
+ # save non-redundant hit
+ splice(@hit_list,$i,0,{
+ seqname => $SeqName,
+ start => $from, end => $to,
+ type => $iso_type, acodon => $anticodon,
+ istart => $istart, iend => $iend,
+ sen_strand => $sense_strand,
+ position => $pos, score => 0,
+ source => $Tscan_mask,
+ });
+
+ $trnact++;
+ $trnatotal++;
+
+ }
+
+ } # while (&Parse_tscan_hit), more hits to process for cur seq
+}
+
+sub by_hit {
+ if ($a{sen_strand} && !$b{sen_strand}) {
+ return -1;
+ }
+ elsif (!$a{sen_strand} && $b{sen_strand}) {
+ return 1;
+ }
+ elsif ($a{sen_strand}) {
+ if ($a{start} < $b{start}) {
+ return -1;
+ }
+ else {
+ return 1;
+ }
+ }
+ elsif ($a{start} > $b{start}) {
+ return -1;
+ }
+ else {
+ return 1;
+ }
+}
+
+
+sub Process_Eufind_hits {
+
+ local(*hit_list,$Eufind_output) = @_;
+ local($istart,$iend,$from,$to,$intron,$trnact,$len,
+ $anticodon,$iso_type,$sense_strand,$score,$pos, at eufind_lines);
+
+ $trnact = 0; # trna count for this sequence
+ $istart = 0; $iend = 0; # intron bounds
+ $from = 0; $to = 0; # tRNA bounds
+ $len = 0; # tRNA length
+ $intron = 0; # intron present? flag
+ $anticodon = '';
+ $iso_type = '';
+ $score = 0.0;
+
+
+ @eufind_lines = split(/\n/,$Eufind_output);
+ foreach (@eufind_lines) {
+ if (/^(\S+)\s+(\d+)\s+(\d+)\s+(\d+)\s+(\S+)\s+(\S+)\s+(\d+)\s+(\d+)\s+(\S+)/o)
+ {
+ $SeqName = $1; $trnact = $2;
+ $from = $3; $to = $4;
+ $iso_type = $5; $anticodon = $6;
+ $score = $9;
+ $istart = 0; $iend = 0;
+ if ($from < $to) {
+ $len = $to - $from +1;
+ $pos = $from;
+ $sense_strand = 1; # flag for forward or reverse strand
+ }
+ else {
+ $len = $from - $to +1;;
+ $pos = $ReallyBigNumber - $from +1;
+ $sense_strand = 0;
+ }
+
+ if ($from == $to) {
+ print STDERR "Error reading EufindtRNA results: ",
+ "tRNA of length 0";
+ }
+
+ if (!&Merge_repeat_hit(*hit_list,*trnact,*trnatotal,$from,$to,
+ $sense_strand,$iso_type,$score,$Eufind_mask)) {
+
+ # insert non-redundant hit in order
+ # 'Merge_repeat_hits' depends on list being in order
+
+ $i=0;
+ while (($i <= $#hit_list) &&
+ ($hit_list[$i]{position} < $pos)) {
+ $i++;
+ }
+
+ splice(@hit_list,$i,0,{
+ seqname => $SeqName,
+ start => $from, end => $to,
+ type => $iso_type, acodon => $anticodon,
+ istart => 0, iend => 0,
+ sen_strand => $sense_strand,
+ position => $pos, score => $score,
+ source => $Eufind_mask
+ });
+
+ $trnact++;
+ $trnatotal++;
+
+ }
+ }
+ }
+}
+
+sub tRNAsource {
+ local($code) = @_;
+
+ local($sourcecode) = substr($code, 2, 3);
+ if ($sourcecode <= 29) {$source = "Virus"; }
+ elsif ($sourcecode <= 109) {$source = "Archaebacteria";}
+ elsif ($sourcecode <= 239) {$source = "Eubacteria"; }
+ elsif ($sourcecode <= 359) {$source = "Chloroplast"; }
+ elsif ($sourcecode <= 419) {$source = "Mitochondria (unicellular)"; }
+ elsif ($sourcecode <= 459) {$source = "Mitochondria (plant)"; }
+ elsif ($sourcecode <= 599) {$source = "Mitochondria (animal)"; }
+ elsif ($sourcecode <= 669) {$source = "Cytoplasmic (unicellular)"; }
+ elsif ($sourcecode <= 749) {$source = "Cytoplasmic (plant)"; }
+ elsif ($sourcecode <= 999) {$source = "Cytoplasmic (animal)" }
+}
+
+
+sub Min {
+ local ($a,$b) = @_;
+ if ($a < $b) {
+ return ($a); }
+ else {
+ return ($b); }
+}
+
+sub Max {
+ local ($a,$b) = @_;
+ if ($a > $b) {
+ return ($a); }
+ else {
+ return ($b); }
+}
+
+sub SegOverlap {
+ local($seg1_a,$seg1_b,$seg2_a,$seg2_b) = @_;
+
+ if ((($seg1_a >= $seg2_a) && ($seg1_a <= $seg2_b)) ||
+ (($seg1_b >= $seg2_a) && ($seg1_b <= $seg2_b)) ||
+ (($seg2_a >= $seg1_a) && ($seg2_a <= $seg1_b)) ||
+ (($seg2_b >= $seg1_a) && ($seg2_b <= $seg1_b))) {
+ return 1;
+ }
+ else {
+ return 0;
+ }
+}
+
+sub Parse_tscan_hit {
+
+ local($tscan_version,*TSCANRAW,*from,*to,*sense_strand,
+ *istart,*iend,*intron,*len,*type,*anticodon,*pos) = @_;
+
+ local($trna_seq) = '';
+
+
+ # clear intron info parsing each hit
+ $istart = 0; $iend = 0; $intron = 0;
+
+ if ($tscan_version <= 1.4) {
+
+ while (<TSCANRAW>) {
+ if (/^start position=\s*(\d+)\s*end position=\s*(\d+)/o)
+ {
+ $from = $1; $to = $2;
+ if ($from < $to) {
+ $sense_strand = 1;
+ $pos = $from }
+ else {
+ $sense_strand = 0;
+ $pos = $ReallyBigNumber - $from +1;
+ }
+ }
+
+ elsif (/^potential tRNA sequence=\s(.+)\n/o) {
+ $trna_seq = $1; $len = length($trna_seq);
+ }
+ elsif (/^tRNA predict as a tRNA-\s*(\S+)\s*: anticodon (\S+)/o) {
+ $type = $1;
+ $anticodon = $2;
+ }
+ elsif (/^anticodon includes unknown bases/o) {
+ $type = 'Unknown';
+ $anticodon = '???';
+ }
+ elsif (/^potential intron between positions\s*(\d+)\s*(\d+)/o) {
+ $istart = $1; $iend = $2;
+ $intron = 1;
+ }
+ # flag for end of current tRNA hit info
+ elsif (/^number of base pairing in the anticodon/o) {
+ return 1;
+ }
+ elsif (/^number of predicted tRNA=(\d+)/o) {
+ return 0; # end of hits for this seq
+ }
+ }
+ return 0; # reached end of raw hits file
+ }
+
+ else {
+ die "FATAL: Illegal tRNAscan version selected.\n\n";
+ }
+}
+
+
+# check current hit for redundancy against all previous hits in hitlist
+#
+# if it IS a repeat, merge it with overlapping hit and return 1
+# if it doesn't overlap with any hits, return 0
+
+sub Merge_repeat_hit {
+
+ local (*hit_list,*trnact,*trnatotal,$from,$to,$sense_strand,$iso_type,
+ $score,$source_mask) = @_;
+ local ($i);
+
+ foreach $i (0..$#hit_list) {
+
+ if ($sense_strand) {
+ if (($hit_list[$i]{sen_strand} == 1) &&
+ (&SegOverlap($from,$to,$hit_list[$i]{start},
+ $hit_list[$i]{end})))
+ {
+ $hit_list[$i]{start} = &Min($from,$hit_list[$i]{start});
+ $hit_list[$i]{end} = &Max($to, $hit_list[$i]{end});
+ $hit_list[$i]{source} = $hit_list[$i]{source} | $source_mask;
+ $hit_list[$i]{type} = $iso_type;
+ $hit_list[$i]{score} = $score;
+
+ # check to see if extended endpoint overlaps
+ # i+1 hit's start boundary
+ # if so, combine hit[i] and hit[i+1] into one
+ # hit and delete hit[i+1]
+ if (($i != $#hit_list) && ($hit_list[$i+1]{sen_strand})
+ && ($hit_list[$i]{end} >= $hit_list[$i+1]{start}))
+ {
+ $hit_list[$i]{end} = &Max($hit_list[$i]{end},
+ $hit_list[$i+1]{end});
+ $hit_list[$i]{source} =
+ $hit_list[$i]{source} | $hit_list[$i+1]{source};
+
+ splice(@hit_list,$i+1,1); # toss out overlapping hit
+ $trnact--;
+ $trnatotal--;
+ }
+ return 1; # exit loop immediately
+ }
+ }
+ else # else (antisense) strand
+ {
+ if (($hit_list[$i]{sen_strand} == 0) &&
+ (&SegOverlap($to,$from,$hit_list[$i]{end},
+ $hit_list[$i]{start})))
+ {
+ $hit_list[$i]{start} = &Max($from,$hit_list[$i]{start});
+ $hit_list[$i]{end} = &Min($to,$hit_list[$i]{end});
+ $hit_list[$i]{source} = $hit_list[$i]{source} | $source_mask;
+ $hit_list[$i]{type} = $iso_type;
+ $hit_list[$i]{score} = $score;
+
+ if (($i != $#hit_list) &&
+ ($hit_list[$i]{end} <= $hit_list[$i+1]{start}))
+ {
+ $hit_list[$i]{end} = &Min($hit_list[$i]{end},
+ $hit_list[$i+1]{end});
+ $hit_list[$i]{source} =
+ $hit_list[$i]{source} | $hit_list[$i+1]{source};
+
+ splice(@hit_list,$i+1,1); # toss out overlapping hit
+ $trnact--;
+ $trnatotal--;
+ }
+ return 1; # exit loop immediately
+ }
+ } # else (antisense) strand
+
+ } # for each (hit)
+
+ return 0; # current hit is not a repeat
+}
+
+sub print_filename {
+ local($fname) = @_;
+ if ($fname eq "-") {
+ $fname = "Standard output";
+ }
+ return $fname;
+}
+
+sub open_for_append {
+ local(*FHAND, $fname) = @_;
+
+ open (FHAND,">>$fname") ||
+ die "FATAL: Unable to open output file ",
+ &print_filename($fname),"\n\n";
+}
+
+sub Save_firstpass_output {
+ local(*hit_list,*fpass_trna_base_ct,*printed_header,$SeqLen,$SeqID) = @_;
+ local($i, $triplet);
+
+ if (!$Cove_mode) {
+ if (!($brief_output || $printed_header)) {
+ &print_results_header($out_file,20,20);
+ $printed_header = 1;
+ }
+ &open_for_append(TAB_RESULTS,$out_file);
+ }
+ else {
+ &open_for_append(TAB_RESULTS,$firstpass_result_file);
+ }
+
+ foreach $i (0..$#hit_list) {
+
+ $triplet = uc($hit_list[$i]{acodon});
+ if ($output_codon) {
+ $triplet = &RevCompSeq(*triplet);
+ }
+
+ printf TAB_RESULTS "%-10s\t%d\t%d\t%d\t%s\t%s\t",
+ $hit_list[$i]{seqname},$i+1,
+ $hit_list[$i]{start},$hit_list[$i]{end},
+ $hit_list[$i]{type},$triplet;
+
+ # save intron bounds if not doing Cove analysis
+
+ if (!$Cove_mode) {
+ printf TAB_RESULTS "%d\t%d\t%.2f",$hit_list[$i]{istart},
+ $hit_list[$i]{iend},$hit_list[$i]{score};
+ }
+
+ # save seq id number and source seq length if needed for Cove analysis
+
+ else {
+ printf TAB_RESULTS "%d\t%d\t%.2f",$SeqID,$SeqLen,$hit_list[$i]{score};
+ }
+
+ if ($save_source) {
+ print TAB_RESULTS " ",$SourceTab[$hit_list[$i]{source}];
+ }
+ print TAB_RESULTS "\n";
+
+ $fpass_trna_base_ct += abs($hit_list[$i]{end}-$hit_list[$i]{start})+1;
+ }
+ close TAB_RESULTS;
+}
+
+
+sub Save_Acedb_from_firstpass {
+
+ local(*hit_list,$out_file) = @_;
+ local($i, $triplet);
+
+ &open_for_append(ACEOUT,$out_file);
+
+ foreach $i (0..$#hit_list) {
+ printf ACEOUT "Sequence\t%s\nSubsequence\t%s.t%d %d %d\n\n",
+ $hit_list[$i]{seqname},$hit_list[$i]{seqname},
+ $i+1,$hit_list[$i]{start},$hit_list[$i]{end};
+
+ printf ACEOUT "Sequence\t%s.t%d\nSource\t\t%s\n",
+ $hit_list[$i]{seqname},$i+1,$hit_list[$i]{seqname};
+ if ($hit_list[$i]{istart} > 0) {
+ if ($hit_list[$i]{istart} < $hit_list[$i]{iend}) {
+ printf ACEOUT "Source_Exons\t1 %d\n",
+ $hit_list[$i]{istart}-$hit_list[$i]{start};
+ printf ACEOUT "Source_Exons\t%d %d\n",
+ $hit_list[$i]{iend}-$hit_list[$i]{start}+2,
+ $hit_list[$i]{end}-$hit_list[$i]{start}+1; }
+ else {
+ printf ACEOUT "Source_Exons\t1 %d\n",
+ $hit_list[$i]{start}-$hit_list[$i]{istart}+1;
+ printf ACEOUT "Source_Exons\t%d %d\n",
+ $hit_list[$i]{start}-$hit_list[$i]{iend}+2,
+ $hit_list[$i]{start}-$hit_list[$i]{end}+1; }
+ }
+ printf ACEOUT "Brief_identification tRNA-%s\n",$hit_list[$i]{type};
+
+ # either output Codon or Anticodon for tRNA
+ $triplet = uc($hit_list[$i]{acodon});
+ if ($output_codon) {
+ $triplet = &RevCompSeq(*triplet);
+ }
+
+ printf ACEOUT "Transcript tRNA \"%s %s %s\"\n\n",
+ $triplet,$hit_list[$i]{type},$OneLetTransMap{$hit_list[$i]{type}};
+
+ }
+ close ACEOUT;
+}
+
+sub prep_for_cove_only { # Create dummy first-pass result file
+ # with all sequences
+
+ local($fastafile,$firstpass_result_file,$seq_key,
+ *numscanned) = @_;
+ local($SavedLine,$key_found,$SeqName,$SeqDescription,
+ $SeqLength,$Sequence,$TargSeqID,
+ $buffer_overlap_seq, $buffer_end_index, $Seq_buf_overrun, $BufferLength);
+
+ &open_fasta($fastafile,SEQFILE);
+ &open_for_append(RESFILE,$firstpass_result_file);
+ $SavedLine = '';
+ $TargSeqID = 0; # Don't look for a specific Seq number
+
+ while (&read_fasta($seq_key,*key_found,$TargSeqID,*SeqName,*SeqDescription,
+ *SeqLength,*Sequence,*SavedLine,SEQFILE,
+ *buffer_overlap_seq, *buffer_end_index, *Seq_buf_overrun,
+ *BufferLength,\@AllSeqIndices)) {
+
+ print (RESFILE "$SeqName\t1\t1\t$SeqLength\t???\t???\t$SeqID\t$SeqLength C\n");
+ print (RESFILE "$SeqName\t2\t$SeqLength\t1\t???\t???\t$SeqID\t$SeqLength C\n");
+
+ $numscanned++;
+ }
+ close RESFILE;
+ &close_fasta(SEQFILE);
+}
+
+
+sub RevCompSeq {
+ local (*seq) = @_;
+ local ($seqlen) = length($seq);
+ local ($i,$j,$rcseq);
+
+ $rcseq = 'X' x $seqlen; # pre-extending string for efficiency
+ for ($i=$seqlen-1, $j=0; $i > -1; $i--, $j++) {
+ substr($rcseq,$j,1) = $CompMap{(substr($seq,$i,1))};
+ }
+ return $rcseq;
+}
+
+# Save tRNA hits in Tabular output
+
+sub Construct_TabOutput {
+ local($SeqName,*printed_header,$pseudo_gene_flag,
+ $tRNA_type, $MaxSeqNameWidth,$MaxSeqLenWidth) = @_;
+ local($result_line);
+
+ if ($pseudo_gene_flag) {
+ $tRNA_type = "Pseudo";
+ }
+
+# extend short seq names to line up in tabular column output
+# if (length($SeqName) < 8) {
+# $SeqName .= ' ' x (10-(length($SeqName)));
+# }
+
+ $result_line = sprintf "%-".$MaxSeqNameWidth."s\t",$SeqName;
+ $result_line .= "$cv_trnact\t";
+
+ $result_line .= sprintf "%-".$MaxSeqLenWidth."d\t",$cv_start;
+ $result_line .= sprintf "%-".$MaxSeqLenWidth."d\t",$cv_end;
+
+ $result_line .= "$tRNA_type\t";
+
+ if ($output_codon) {
+ $result_line .= {&RevCompSeq(*cv_anticodon)}."\t";
+ }
+ else {
+ $result_line .= "$cv_anticodon\t";
+ }
+
+ if (!$intron) {
+ $result_line .= "0\t0";
+ }
+ else {
+ if ($sense_strand) {
+ $result_line .= ($istart+$cv_start-1)."\t".($iend+$cv_start-1); }
+ else {
+ $result_line .= ($cv_start-$istart+1)."\t".($cv_start-$iend+1); }
+ }
+ $result_line .= "\t$score";
+
+ if ($get_hmm_score) {
+ $result_line .= sprintf "\t%.2f\t%.2f",$hmm_score,$ss_score;
+ }
+ if ($save_source) {
+ $result_line .= " $hit_source";
+ }
+ $result_line .= "\n";
+
+ return $result_line;
+}
+
+sub Save_AllStruct_Output {
+
+ local($pseudo_gene_flag) = @_;
+ local($seqlen);
+
+ $seqlen = length($covseq);
+
+ open(SECSTRUCT,">>$all_struct_file") ||
+ die "FATAL: Can't open $all_struct_file to save",
+ "seconary structures\n\n";
+ print SECSTRUCT "$SeqName.trna$cv_trnact ($cv_start-$cv_end)\t",
+ "Length: $seqlen bp\nType: $cv_type\t";
+
+ if ($output_codon) {
+ print SECSTRUCT "Codon: ",&RevCompSeq(*cv_anticodon)," at ";
+ }
+ else {
+ print SECSTRUCT "Anticodon: $cv_anticodon at ";
+ }
+
+ if ($cv_anticodon eq "???") {
+ print SECSTRUCT "0-0 (0-0)\t";
+ }
+ else {
+ print SECSTRUCT "$acodonIndex-",
+ $acodonIndex+2;
+ if ($sense_strand) {
+ print SECSTRUCT " (",$acodonIndex+$cv_start-1,"-",
+ $acodonIndex+$cv_start+1,")\t";
+ }
+ else {
+ print SECSTRUCT " (",$cv_start-$acodonIndex+1,"-",
+ $cv_start-$acodonIndex-1,")\t";
+ }
+ }
+
+ print SECSTRUCT "Score: $score\n";
+ if ($intron) {
+ print SECSTRUCT "Possible intron: $istart-$iend ";
+ if ($sense_strand) {
+ print SECSTRUCT "(",$istart+$cv_start-1,"-",
+ $iend+$cv_start-1,")\n"; }
+ else {
+ print SECSTRUCT "(",$cv_start-$istart+1,"-",
+ $cv_start-$iend+1,")\n"; }
+ }
+ if ($pseudo_gene_flag) {
+ printf SECSTRUCT
+ "Possible pseudogene: HMM Sc=%.2f\tSec struct Sc=%.2f\n",
+ $hmm_score,$ss_score;
+ }
+ elsif ($get_hmm_score) {
+ printf SECSTRUCT
+ "HMM Sc=%.2f\tSec struct Sc=%.2f\n",$hmm_score,$ss_score;
+ }
+
+ print SECSTRUCT " ",substr($ruler,0,$seqlen-1),"\n";
+ print SECSTRUCT "Seq: $covseq\nStr: $covss\n\n";
+ close(SECSTRUCT);
+}
+
+sub Save_Acedb_from_cov {
+
+ local($pseudo_gene_flag) = @_;
+
+ &open_for_append(ACEOUT,$out_file);
+
+ print ACEOUT "Sequence\t$SeqName\nSubsequence\t$SeqName.t$cv_trnact $cv_start $cv_end\n\n";
+ print ACEOUT "Sequence\t$SeqName.t$cv_trnact\nSource\t\t$SeqName\n";
+ if ($intron) {
+ print ACEOUT "Source_Exons\t1 ",$istart-1,"\n";
+ print ACEOUT "Source_Exons\t",$iend+1," ",abs($cv_end-$cv_start)+1,"\n";
+ }
+ print ACEOUT "Brief_identification tRNA-$cv_type\n",
+ "Transcript tRNA \"";
+
+ if ($output_codon) {
+ print ACEOUT &RevCompSeq(*cv_anticodon);
+ }
+ else {
+ print ACEOUT $cv_anticodon;
+ }
+
+ print ACEOUT " $cv_type ",$OneLetTransMap{$cv_type},
+ "\"\nScore $program_id $score\n";
+
+ if ($pseudo_gene_flag) {
+ printf ACEOUT "Remark \"Likely pseudogene (HMM Sc=%.2f / Sec struct Sc=%.2f)\"\n",
+ $hmm_score,$ss_score;
+ }
+ print ACEOUT "\n";
+ close ACEOUT;
+}
+
+sub Parse_tabular_output {
+
+ local (*Seqname,*trnact,*cv_trnact,*trnaName,
+ *ts_start,*ts_end,*ts_len,*sense_strand,
+ *ts_SeqID,*ts_SeqLen, *ts_type, *ts_anticodon,
+ *hit_source,$Padding,*seqinfo_flag) = @_;
+
+ if (/^(\S+)\s+(\d+)\s+(\d+)\s+(\d+)\s+(\S+)\s+(\S+)\s+(\d+)\s+(\d+)\s+(\S+)/o) {
+
+ $SeqName = $1;
+ $trnact = $2;
+ if ($trnact == 1) { # initialize cove-detected trna counter
+ $cv_trnact = 0; } # at new sequence
+
+ $trnaName = $1.".t".$2;
+ $ts_start = $3; # trna subseq absolute start index
+ $ts_end = $4; # trna subseq absolute end index
+ $ts_type = $5;
+ $ts_anticodon = $6;
+ $ts_SeqID = $7;
+ $ts_SeqLen = $8;
+ $score = $9;
+ $hit_source = $';
+ $hit_source =~ s/[\s\t\n]//g;
+
+
+ # if seqinfo_flag not set, file does not have SeqID info in
+ # 7th column of output, don't mistake number read for SeqID
+
+ if (!$seqinfo_flag) {
+ $ts_SeqID = 0;
+ }
+
+ if ($ts_end > $ts_start) {
+ $sense_strand = 1; # flag for forward or reverse strand
+
+ # pad ends of sequence only if EufindtRNA is being used
+ # and $seqinfo_flag is set (we know the seq lengths)
+ if ($Eufind_mode && $seqinfo_flag) {
+ $ts_start = &Max(1,$ts_start - $Padding);
+ $ts_end = &Min($ts_SeqLen,$ts_end + $Padding)
+ }
+ $ts_len = $ts_end - $ts_start + 1;
+ }
+ else {
+ $sense_strand = 0;
+ if ($Eufind_mode && $seqinfo_flag) {
+ $ts_start = &Min($ts_SeqLen,$ts_start + $Padding);
+ $ts_end = &Max(1,$ts_end - $Padding);
+ }
+ $ts_len = $ts_start - $ts_end + 1;
+ }
+ if ($ts_end == $ts_start) {
+ print STDERR "Error reading $firstpass_result_file: tRNA of length 0";
+ }
+
+ return 1;
+ }
+ else {
+ if (/Type\tCodon\tSeqID\tSeqLen/) {
+ $seqinfo_flag = 1;
+ }
+ return 0;
+ }
+}
+
+sub Parse_Covels_output {
+
+ local($covels_hit,*score,*subseq_start,*subseq_end,*trna_len,
+ *cv_start,*cv_end,*hit_seqname,$ts_start,*sense_strand) = @_;
+
+ my $covels_hit_found = 0;
+
+ if ($covels_hit =~ /^\s*(\S+)\s+(\d+)\s+(\d+).+: (\S+)\s*/o) {
+ $score = $1;
+ $subseq_start = $2;
+ $subseq_end = $3;
+ $hit_seqname = $4;
+ $covels_hit_found = 1;
+ }
+
+ if ($covels_hit_found) {
+
+ if ($sense_strand) {
+ $trna_len = $subseq_end - $subseq_start +1;
+ $cv_start = $ts_start + $subseq_start - 1;
+ $cv_end = $ts_start + $subseq_end -1; }
+ else {
+ $trna_len = $subseq_end + $subseq_start -1;
+ $cv_start = $ts_start - $subseq_start + 1;
+ $cv_end = $ts_start - $subseq_end + 1; }
+ return 1;
+ }
+ else {
+ return 0;
+ }
+}
+
+sub Write_tRNA {
+
+ local ($tRNAseq,$SeqName,$SeqDescription,
+ *basect,$dest_file,$overwrite) = @_;
+ local($tempseq, $tRNA_len, $TempSeqName);
+
+ $tRNA_len = length($tRNAseq);
+ $basect += $tRNA_len;
+
+ # write current tRNA to fasta file
+
+ if ($overwrite) {
+ open (TRNA_HANDLE,">$dest_file") ||
+ die "FATAL: Unable to open file $dest_file to save tRNA\n\n";
+ }
+ else {
+ open (TRNA_HANDLE,">>$dest_file") ||
+ die "FATAL: Unable to open file $dest_file to save tRNA\n\n";
+ }
+
+ &write_fasta($SeqName,$SeqDescription,$tRNA_len,
+ *tRNAseq,TRNA_HANDLE);
+
+ close TRNA_HANDLE;
+}
+
+
+# Run covels, return hits in $covel_hit_list array
+
+sub Run_Covels {
+ local (*covels_hit_list, *cur_cm_file,$tmp_trnaseq,$ts_len,$ts_type) = @_;
+ local ($scanlen, $covels_cmd, $covels_output, $junk, $allhits, $ct,
+ $total_hits,$trnaDesc,$report_cutoff, $over_cutoff, $fulltrnaDesc);
+
+ # don't set Covels '-w' param over 200 bp if a pre-scanner is being used,
+ # use max window of 150 bp if Cove only (too slow otherwise)
+
+ if ($Eufind_mode || $Tscan_mode || $use_prev_ts_run) {
+ $scanlen = &Min($ts_len,$Max_tRNA_length);
+ }
+ else {
+ $scanlen = $Max_Cove_tRNA_length;
+ }
+
+ # set correct CM file for current tRNA
+
+ $cur_cm_file = $Main_cm_file_path;
+ if ($Eufind_mode) {
+ if ($ts_type eq "SeCp") { # use arch/prok selcys model
+ $cur_cm_file = $Pselc_cm_file_path;
+ }
+ elsif ($ts_type eq "SeCe") { # use euk selcys model
+ $cur_cm_file = $Eselc_cm_file_path;
+ }
+ }
+
+ # set covels reporting threshold below 0 (default) if -X param is
+ # set below 0 by user
+
+ $report_cutoff = &Min(0,$Cutoff);
+
+ # run Covels
+
+ $covels_cmd = "$covels_bin -w$scanlen -t$report_cutoff $cur_cm_file $tmp_trnaseq";
+ $covels_output = `$covels_cmd`;
+
+ if (&Error_exit_status("Covels-SE",$SeqName)) {
+ print "Exit first loop at 1\n";
+ return 0;
+ }
+
+ ($junk,$allhits) = split(/----------\n\n/,$covels_output);
+ @covels_hit_list = split(/\n/,$allhits);
+
+ # count no. of hits over cutoff
+
+ $total_hits = 0;
+
+ foreach $covels_hit (@covels_hit_list) {
+ $score = 0;
+ if ((&Parse_Covels_output($covels_hit,*score,*subseq_start,
+ *subseq_end,*trna_len,*cv_start,
+ *cv_end,*hit_seqname,$ts_start,
+ *sense_strand)) &&
+ ($score >= $Cutoff)) {
+ $total_hits++;
+ }
+ }
+
+ # if no tRNAs detected when using a selenocysteine cove model,
+ # try main model and run again before giving up
+
+ if (($total_hits == 0) &&
+ (($cur_cm_file eq $Pselc_cm_file_path) ||
+ ($cur_cm_file eq $Eselc_cm_file_path))) {
+ $cur_cm_file = $Main_cm_file_path;
+
+ # re-run Covels with main model
+
+ $covels_cmd = "$covels_bin -w$scanlen -t$report_cutoff $cur_cm_file $tmp_trnaseq";
+ $covels_output = `$covels_cmd`;
+ if (&Error_exit_status("Covels-SE",$SeqName)) {
+ print "Exit first loop at 2\n";
+ return 0;
+ }
+ ($junk,$allhits) = split(/----------\n\n/,$covels_output);
+ @covels_hit_list = split(/\n/,$allhits);
+ }
+
+ # Go thru hit list, save info for tRNA hits with sub-cutoff scores
+
+ $ct = 0;
+ $over_cutoff = 0;
+ $trnaDesc = "";
+
+ foreach $covels_hit (@covels_hit_list) {
+ if (&Parse_Covels_output($covels_hit,*score,*subseq_start,
+ *subseq_end,*trna_len,*cv_start,*cv_end,
+ *hit_seqname,$ts_start,*sense_strand)) {
+ $ct++;
+ if ($score >= $Cutoff) {
+ $over_cutoff++;
+ }
+ else {
+ print LOGFILE "Low covels score for $trnaName.$ct: $score\n";
+ $trnaDesc .= "(Cove Hit#$ct: $cv_start-$cv_end,".
+ " Sc: $score, Len: ".(abs($cv_start-$cv_end)+1).") ";
+ }
+ }
+ }
+
+ # report if no scores over 0 bit reporting threshold
+
+ if ($over_cutoff == 0) {
+ if ((!$results_to_stdout) &&
+ ($Eufind_mode || $Tscan_mode || $use_prev_ts_run)) {
+ print LOGFILE "Covels score(s) below cutoff for $trnaName. Skipping...\n";
+ }
+ if ($save_falsepos) {
+ $fulltrnaDesc = "(Fp Hit: $ts_start-$ts_end, ".
+ (abs($ts_start-$ts_end)+1)." bp, Src: $hit_source) ".$trnaDesc;
+
+ &Write_tRNA($Sequence,$trnaName,$fulltrnaDesc,
+ *fpos_base_ct,$falsepos_file,0);
+ }
+ }
+
+ return 1;
+}
+
+
+
+sub Run_Coves {
+
+ local($tmp_trnaseq,$SeqName,$cm_file) = @_;
+ local($covseq,$covss,$coves_output, at coves_lines,$sec_struct,
+ $coves_score);
+
+ $coves_cmd = "$coves_bin -s $cm_file $tmp_trnaseq";
+
+ $coves_output = `$coves_cmd`;
+
+ if (&Error_exit_status("Coves-SE",$SeqName)) {
+ print STDERR "Skipping tRNA anticodon & type prediction\n\n";
+ return ("Error","",-1);
+ }
+
+ ($junk,$sec_struct) = split(/----------\n\n/,$coves_output);
+ @coves_lines = split(/\n/,$sec_struct);
+ $covseq = '';
+ $covss = '';
+ $coves_score = -1000;
+ $SeqName =~ s/(\W)/\\$1/g;
+
+ foreach (@coves_lines) {
+ if (/^\s+$SeqName\s([a-zA-Z\-]{1,60})\s*/)
+ { $covseq .= $1; }
+ if (/^\s+$SeqName\s([\.\<\>\ ]{1,60})/)
+ { $covss .= $1; }
+ if (/^\s*(\S+)\sbits\s:\s$SeqName/) {
+ $coves_score = $1;
+ }
+ }
+
+ $covss =~ s/\s//g; # take spaces out of alignment
+ $covseq =~ s/-//g; # take '-' gaps out of seq
+
+ if (($covseq eq '') || ($covss eq '')) {
+ print STDERR "Could not complete coves successfully for $SeqName\n",
+ "because unable to parse coves secondary structure string.\n",
+ "Skipping tRNA anticodon & type prediction\n";
+ return ("Error","",-1);
+ }
+
+ return ($covseq,$covss,$coves_score);
+}
+
+# Is_pseudo_gene
+#
+# Runs a covariance model without secondary structure
+# information on predicted tRNA, puts this value
+# in "hmm_score".
+# Contribution to total score from secondary structure
+# derived by subtracting hmm_score from total score
+# Returns non-zero if tRNA scores fall below minima
+# for either primary or secondary structure components
+# of score
+
+sub Is_pseudo_gene {
+ local(*hmm_score,*ss_score,$score,$tmp_trnaseq,$SeqName,
+ $get_hmm_score) = @_;
+ local($dummy1,$dummy2);
+
+ $ss_score = $hmm_score = -1000; # clear values to be returned
+ $dummy1 = $dummy2 = ""; # return values not used
+
+ # skip check for pseudo gene if score is above 55 bits or
+ # -D (disable pseudogene checking) is specified
+ # AND -H option (get hmm scores) is NOT specified
+
+ if ((($score >= $Min_pseudo_filter_score) || $skip_pseudo_filter)
+ && !$get_hmm_score) {
+ return 0;
+ }
+
+ ($dummy1,$dummy2,$hmm_score) =
+ &Run_Coves($tmp_trnaseq,$SeqName,$MainNS_cm_file_path);
+ $ss_score = $score - $hmm_score; # calc secondary structure
+ # contribution to total bit score
+
+ if ((($ss_score < $Min_ss_score) || ($hmm_score < $Min_hmm_score)) &&
+ ($score < $Min_pseudo_filter_score)) {
+ return 1;
+ }
+}
+
+
+sub Find_anticodon { # find anticodon loop & a-codon
+
+ local($covseq,$covss) = @_;
+ local($antiloopIndex,$antiloop,$antiloopLen,
+ $antiloopEnd,$acIndex,$anticodon,$verify_ac);
+
+
+# Match pattern in secondary structure output,
+# looking for second stem-loop structure ">>>>...<<<<"
+# that should be the anitocodon stem-loop
+
+ if ($covss =~ /^([>.]+<[<.]+>[>.]*)>([.]{4,})<+/o) {
+
+ # set to index position of first base in anticodon loop
+ $antiloopIndex = length($1)+1;
+ $antiloopLen = length($2); # anticodon loop length
+
+ # index of end of anticodon loop
+ $antiloopEnd = $antiloopIndex + $antiloopLen -1;
+
+ $antiloop = substr($covseq,$antiloopIndex,$antiloopLen);
+
+ # remove '-' gaps from loop
+ $antiloop =~ s/[\-]//g;
+ # remove introns & non-canonical bases
+ $antiloop =~ s/[a-z]//g;
+
+ # Don't guess if even number of bp in
+ # anticodon loop
+ if ((length($antiloop) < 5) ||
+ ((length($antiloop) % 2) == 0)) {
+ return ("???",-1,-1,-1);
+ }
+ # get anticodon
+ $acIndex = (length($antiloop)-3)/2;
+ $anticodon = substr($antiloop,$acIndex,3);
+ $verify_ac = substr($covseq,$acIndex+$antiloopIndex,3);
+
+ # check to see if anticodon extracted from the entire
+ # trna sequence (coveseq) is same as that extracted from
+ # just the anticodon loop sequence (antiloop)
+
+ if ($verify_ac ne $anticodon) {
+# print STDERR "WARNING: Problem placing anticodon for tRNA ",
+# "($SeqName.t","$cv_trnact)\n";
+ return ("???",-1,-1,-1);
+ }
+ return ($anticodon,$antiloopIndex,$antiloopEnd,
+ $acIndex+$antiloopIndex+1);
+ }
+ else {
+ return ("???",-1,-1,-1);
+ }
+}
+
+sub Find_intron {
+
+ local($covseq,$antiloopIndex,$antiloopEnd) = @_;
+ local($intron,$istart,$iend,$tmpstr,$antiloopSeq);
+
+ # check to see if it was unable
+ # to determine the anticodon loop
+ if ($antiloopIndex == -1) {
+ return(0,0,0);
+ }
+ # get subsequence from start of anticodon loop
+ # to end of anticodon loop -- look for intron in it
+ $antiloopSeq = substr($covseq,$antiloopIndex,$antiloopEnd-$antiloopIndex+1);
+
+ if ($antiloopSeq =~ /^(.*[^a-z]+)([a-z]{$Min_intron_length,})[^a-z]+/o) {
+ $intron = $2;
+
+ # make sure to get the base index for the last (not nec. only) occurrence
+ # of the intron sequence string up to end of anticodon loop
+ $tmpstr = substr($covseq,0,$antiloopEnd+1);
+ $istart = index($tmpstr,$intron) + 1;
+ $iend = length($intron) + $istart - 1;
+ }
+ else {
+ $intron = 0;
+ }
+ return ($intron,$istart,$iend);
+}
+
+sub Save_firstpass_stats {
+
+ local(*STATS) = @_;
+
+ print STATS "First-pass (tRNAscan/EufindtRNA) Stats:\n",
+ "---------------\n";
+ print STATS "Sequences read: $numscanned\n";
+ print STATS "Seqs w/at least 1 hit: $seqs_hit\n";
+ print STATS "Bases read: $first_pass_base_ct (x2 for both strands)\n";
+ print STATS "Bases in tRNAs: $fpass_trna_base_ct\n";
+ print STATS "tRNAs predicted: $trnatotal\n";
+ printf STATS "Av. tRNA length: %d\n",
+ int($fpass_trna_base_ct/&Max(1,$trnatotal));
+ printf STATS "Script CPU time: %.2f s\n",
+ $fp_end_time[0]-$fp_start_time[0];
+ printf STATS "Scan CPU time: %.2f s\n",
+ $fp_end_time[1]-$fp_start_time[1];
+ printf STATS "Scan speed: %.1f Kbp/sec\n", $first_pass_base_ct*2/
+ (&Max(0.001,$fp_end_time[1]-$fp_start_time[1]))/1000;
+ print STATS "\nFirst pass search(es) ended: ",`date`,"\n";
}
+
+sub Save_final_stats {
+
+ local(*STATS) = @_;
+
+ if ($Cove_mode) {
+ print STATS "Cove Stats:\n-----------\n";
+
+ if ($Tscan_mode || $Eufind_mode) {
+ print STATS "Candidate tRNAs read: $firstpass_trna_ct\n";
+ }
+ else {
+ print STATS "Sequences read: $numscanned\n";
+ push(@fp_end_time, at fp_start_time);
+ }
+ print STATS "Cove-confirmed tRNAs: $total_covels_ct\n";
+ print STATS "Bases scanned by covels: $covels_base_ct\n";
+ printf STATS "%% seq scanned by covels: %2.1f %%\n",
+ &Min(($covels_base_ct/&Max(1,$first_pass_base_ct*2))*100,100);
+ printf STATS "Script CPU time: %2.2f s\n",$cv_end_time[0]-$fp_end_time[0];
+ printf STATS "Cove CPU time: %2.2f s\n",$cv_end_time[1]-$fp_end_time[1];
+ printf STATS "Scan speed: %.1f bp/sec\n", $covels_base_ct/
+ &Max(0.001,$cv_end_time[1]-$fp_end_time[1]);
+ print STATS "\nCove analysis of tRNAs ended: ",`date`,"\n";
+ if ($Tscan_mode || $Eufind_mode) {
+ print STATS "Summary\n--------\n";
+ }
+ }
+ $total_time = ($cv_end_time[0]-$fp_start_time[0]) +
+ ($cv_end_time[1]-$fp_start_time[1]);
+ printf STATS "Overall scan speed: %.1f bp/sec\n",
+ &Max($first_pass_base_ct*2,$covels_base_ct)/&Max(0.001,$total_time);
+
+ &Output_Summary(STATS);
+
+ close STATS;
+}
+
+sub Output_Summary {
+
+ local(*STATS) = @_;
+
+ local ($trna_ct, $selcys_ct, $stop_sup_ct, $undet_ct, $pseudo_ct,
+ $total, $intron_ct, $line);
+ local (%iso_AR, %ac_AR, %intron_ac_AR);
+ local ($iso, $ac, $istart, $aa);
+
+
+ $trna_ct = 0;
+ $selcys_ct = 0;
+ $pseudo_ct = 0;
+ $undet_ct = 0;
+ $intron_ct = 0;
+ $stop_sup_ct = 0;
+ $total = 0;
+
+ $line = shift(@Tab_Results);
+
+ while ($line ne '') {
+
+ if ($line =~ /^(\S+)\s+(\d+)\s+(\d+)\s+(\d+)\s+(\S+)\s+(\S+)\s+(\d+)\s+(\d+)\s+(\S+)/) {
+ $iso = $5;
+ $ac = $6;
+ $istart = $7;
+
+ if ($iso eq "Undet" || $iso eq "Unknown") {
+ $undet_ct++;
+ }
+
+ elsif ($iso =~ /Pseudo/) {
+ $pseudo_ct++;
+ $iso_AR{"Pseudo"}++;
+ }
+ elsif ($iso =~ /SeC/) {
+ $selcys_ct++;
+ $iso_AR{"SelCys"}++;
+ $ac_AR{$ac}++;
+ }
+ elsif ($iso eq "Sup") {
+ $iso_AR{"Supres"}++;
+ $stop_sup_ct++;
+ $ac_AR{$ac}++;
+ }
+
+ else {
+ $trna_ct++;
+ $iso_AR{$iso}++;
+ $ac_AR{$ac}++;
+ }
+
+ if ($istart) {
+ $intron_ct++;
+ $intron_ac_AR{$ac}++;
+ }
+
+ }
+ $line = shift(@Tab_Results);
+
+ }
+
+ $total = $trna_ct + $selcys_ct + $pseudo_ct + $undet_ct + $stop_sup_ct;
+
+
+ print STATS "\n",
+ "tRNAs decoding Standard 20 AA: $trna_ct\n",
+ "Selenocysteine tRNAs (TCA): $selcys_ct\n",
+ "Possible suppressor tRNAs (CTA,TTA): $stop_sup_ct\n",
+ "tRNAs with undetermined/unknown isotypes: $undet_ct\n",
+ "Predicted pseudogenes: $pseudo_ct\n",
+ " -------\n",
+ "Total tRNAs: $total\n\n",
+
+ "tRNAs with introns: \t$intron_ct\n\n";
+
+ foreach $aa (@Isotypes) {
+
+ foreach $acset ($ACList{$aa}) {
+
+ foreach $ac (@$acset) {
+
+ if (defined($intron_ac_AR{$ac})) {
+
+ print STATS "| $aa-$ac: $intron_ac_AR{$ac} ";
+ }
+ }
+ }
+ }
+ print STATS "|\n\n";
+
+ print STATS "Isotype / Anticodon Counts:\n\n";
+
+ foreach $aa (@Isotypes) {
+
+ $iso_count = $iso_AR{$aa} + 0;
+ printf STATS ("%-6s: %d\t",$aa,$iso_count);
+
+ foreach $acset ($ACList{$aa}) {
+ foreach $ac (@$acset) {
+
+ if ($ac eq " ") {
+ print STATS " ";
+ }
+ else {
+ printf STATS ("%5s: %-6s",$ac,$ac_AR{$ac});
+ }
+ }
+ }
+
+ print STATS "\n";
+
+ }
+ print STATS "\n";
+}
+
+
+sub cleanup { # clean up temp files
+
+ system("rm -f $temp_dir/tscan$$".'*');
+ system("rm -f $fafile.pid");
+
+}
+
+sub Error_Handler {
+
+ print "\nAborting tRNAscan-SE\n\n";
+
+ $ppid = $$;
+ $psout = `ps -ef`;
+ @ps_lines = split(/\n/,$psout);
+ foreach $line (0..$#ps_lines) {
+ if ($ps_lines[$line] =~/^\s+\S+\s+(\d+)\s+($ppid)\s/) {
+# print STDERR "Killing process $1:\n",$ps_lines[$line],"\n";
+ $killct = kill 'KILL', $1;
+# print STDERR "$killct jobs received the kill signal\n";
+ }
+ }
+
+ &cleanup();
+ exit(1);
+}
+
+sub open_for_write {
+ local(*FHAND, $fname) = @_;
+ local($ans,$ansline);
+
+ if ((-e $fname) && ($prompt_for_overwrite)) {
+ print STDERR "\nWARNING: $fname exists already.\n\n",
+ " (O)verwrite file, (A)ppend to file, or (Q)uit program? ";
+ $ansline = <STDIN>;
+ $ans = substr($ansline,0,1);
+ while ($ans !~ /[AOQaoq]/) {
+ print STDERR "\nReply (O)verwrite (A)ppend, or (Q)uit [O/A/Q]: ";
+ $ansline = <STDIN>;
+ $ans = substr($ansline,0,1);
+ }
+ if (uc($ans) eq 'Q') {
+ die "\ntRNAscan-SE aborted.\n\n";
+ }
+ elsif (uc($ans) eq 'A') {
+ print STDERR "\n Appending to $fname...\n";
+ open(FHAND,">>$fname") ||
+ die "Unable to open $fname for appending. ",
+ "Aborting program.\n";
+ return; # successful exit status
+ }
+ else { # $ans eq 'O'verwrote
+ print STDERR "\n Overwriting $fname...\n";
+ }
+ }
+ open(FHAND,">$fname") ||
+ die "Unable to open $fname for writing. Aborting program.\n";
+}
+
+
+# Perl code for reading FASTA-formatted sequence files
+# SRE, Sat Feb 19 19:10:43 1994
+
+# These subroutines read a FASTA formatted file one sequence at a time.
+# open_fasta(filename) opens a file for reading.
+# close_fasta() closes it when you're done.
+#
+# read_fasta() returns 1 on success and 0 on failure (end of file).
+# When it returns success, the following global variables are set:
+#
+# $SeqName = name of sequence (1st word on FASTA title line)
+# $SeqDescription = description (remainder of FASTA title line)
+# $SeqLength = length of sequence
+# $Sequence = sequence, gaps and newlines removed
+#
+# Modified by TMJL 11/95 for use in tRNAscan-SE
+
+sub open_fasta {
+ local($fname, *FAHANDLE) = @_;
+ open(FAHANDLE,$fname) || die("FATAL: Failed to open FASTA file $fname\n");
+ $SavedLine = "";
+ $SeqID = 0;
+ 1;
+}
+sub close_fasta {
+ local (*FAHANDLE) = @_;
+ close(FAHANDLE);
+ 1;
+}
+
+# Reads length of sequence first, then pre-extends to total length
+# before reading it in (important optimization for very long sequences)
+# Also, will search for sequence name matching $key
+
+sub read_fasta {
+ local ($key,*key_found,$TargetSeqID,*SeqName,*SeqDescription,*SeqLength,$SequenceP,
+ *SavedLine, *FAHANDLE,
+ *buffer_overlap_seq, *buffer_end_index, *Seq_buf_overrun, *BufferLength,
+ $AllSeqIndices) = @_;
+
+ local ($Seqlen, $filepos, $pre_extend_len, $SeqIndexStep, @SeqIndex);
+
+# if $key is not the global $seq_key (non-alphanumerics already
+# escaped out for $seq_key) then escape out '\' problem causing char's
+ if ($key ne $seq_key) {
+ $key =~ s/(\W)/\\$1/g;
+ }
+
+ while ((!eof(FAHANDLE))
+ && (($SavedLine =~ /^>/) || ($SavedLine = <FAHANDLE>)))
+ {
+ if (($SavedLine =~ /^>\s*($key)\s+(.*)$/) ||
+ ($start_at_key) && ($key_found) &&
+ ($SavedLine =~ /^>\s*(\S*)\s+(.*)$/o))
+ {
+ $SeqID++;
+
+ # if searching for a particular SeqID go on to next seq
+ # if target and current seqid's don't match
+ if ($TargetSeqID && ($SeqID != $TargetSeqID)) {
+ $SavedLine = <FAHANDLE>;
+ next;
+ }
+
+ $key_found = 1;
+ $SeqName = $1;
+ $SeqDescription = $2;
+ $$SequenceP = "";
+ @SeqIndex = ();
+ $SeqIndexStep = $SeqIndexInc; # set first bp position to save
+
+ $filepos = tell(FAHANDLE);
+ $Seqlen = 0;
+ push(@SeqIndex, $Seqlen, tell(FAHANDLE));
+ $pre_extend_len = 0;
+# print LOGFILE "At pos: ";
+
+ while ($SavedLine = <FAHANDLE>)
+ {
+ if ($SavedLine =~ /^>/) { last; }
+ $SavedLine =~ s/[ \n\t\d]//g; # strip whitespace & numbers
+ $Seqlen += length($SavedLine);
+
+ # Save the start position of this chunk of seq for later easy return
+ if ($Seqlen > $SeqIndexStep) {
+ push(@SeqIndex, $Seqlen, tell(FAHANDLE));
+ $SeqIndexStep += $SeqIndexInc;
+# print LOGFILE "($Seqlen) ";
+ }
+
+ if (($pre_extend_len == 0) && ($Seqlen >= $MaxSeqBuffer)) {
+ $pre_extend_len = $Seqlen;
+ }
+ }
+ push(@SeqIndex, $Seqlen, tell(FAHANDLE));
+ $SeqLength = $Seqlen;
+# print LOGFILE " ";
+
+ $AllSeqIndices->[$SeqID] = [@SeqIndex];
+
+ seek(FAHANDLE,$filepos,0);
+ $$SequenceP = 'X' x $pre_extend_len; # pre-extending string for efficiency
+ $Seqlen = 0;
+ while (($Seqlen < $MaxSeqBuffer) && ($SavedLine = <FAHANDLE>))
+ {
+ if ($SavedLine =~ /^>/) { last; }
+ $SavedLine =~ s/[ \n\t\d]//g; # strip whitespace & numbers
+ substr($$SequenceP,$Seqlen,length($SavedLine)) = $SavedLine;
+ $Seqlen += length($SavedLine);
+ }
+
+ # if sequence is longer than MaxSeqBuffer length,
+ # then save last ~200 nt to allow overlap with next buffer frame
+ # this prevents tRNAs on the border between buffers from being chopped
+ # in half (and missed!)
+
+ if ($Seqlen >= $MaxSeqBuffer) {
+ $buffer_overlap_seq = substr($$SequenceP,$Seqlen-$SeqBufOverlap);
+ $buffer_end_index = $Seqlen - length($buffer_overlap_seq);
+ $Seq_buf_overrun = 1;
+ }
+ else {
+ $Seq_buf_overrun = 0;
+ }
+
+ $BufferLength = length($$SequenceP);
+ $$SequenceP = uc($$SequenceP);
+ $$SequenceP =~ s/U/T/g;
+ $$SequenceP =~ s/X/N/g;
+
+ ## Remove long runs of N's from consideration by pre-scanners
+ ## By doing this, pre-scanner false-pos rate is normal, even
+ ## when scanning unfinished genomes with long N insert "placeholders"
+ $$SequenceP =~ s/NNNNNNNNNN/CCCCCCCCCC/g;
+
+ return 1;
+ }
+ else {
+ if ($SavedLine =~ /^>/) {
+ $SeqID++;
+ }
+ $SavedLine = <FAHANDLE>;
+ }
+ }
+ 0;
+}
+
+sub read_fasta_subseq {
+ local ($key,*key_found,$TargetSeqID,*SeqName,*SeqDescription,*SeqLength,*Sequence,
+ *SavedLine, *FAHANDLE, $subseq_start, $subseq_len, $AllSeqIndices) = @_;
+
+ local ($Seqlen, $filepos, $curpos, $Tempseq, $index_pos, $ct);
+
+ # find closest position in desired sequence from file position index
+
+ $ct=0;
+ while ($AllSeqIndices->[$TargetSeqID][$ct] < $subseq_start) {
+ $ct+=2;
+ }
+ $Seqlen = $AllSeqIndices->[$TargetSeqID][$ct-2];
+ $index_pos = $AllSeqIndices->[$TargetSeqID][$ct-1];
+ seek (FAHANDLE,$index_pos,0);
+
+ $Sequence = "";
+ $Tempseq = "";
+
+ # scan until I get to the sequence position
+
+ while (($Seqlen < $subseq_start) && ($SavedLine = <FAHANDLE>))
+ {
+ if ($SavedLine =~ /^>/) {
+ return 0;
+ }
+ $SavedLine =~ s/[ \n\t\d]//g; # strip whitespace & numbers
+ $Seqlen += length($SavedLine);
+ }
+
+ $Tempseq = 'X' x $subseq_len; # pre-extending string for efficiency
+
+ $curpos = $Seqlen - length($SavedLine);
+ $seq_head = substr($SavedLine,$subseq_start-$curpos-1);
+ substr($Tempseq,0,length($seq_head)) = $seq_head;
+
+ $Seqlen = length($seq_head);
+
+ while (($Seqlen < $subseq_len) && ($SavedLine = <FAHANDLE>))
+ {
+ if ($SavedLine =~ /^>/) { last; }
+ $SavedLine =~ s/[ \n\t\d]//g; # strip whitespace & numbers
+ substr($Tempseq,$Seqlen,length($SavedLine)) = $SavedLine;
+ $Seqlen += length($SavedLine);
+ }
+
+ $Sequence = substr($Tempseq,0,$subseq_len);
+
+ $Sequence = uc($Sequence);
+ $Sequence =~ s/U/T/g;
+ $Sequence =~ s/X/N/g;
+ return 1;
+}
+
+sub read_fasta_subseq_slow {
+ local ($key,*key_found,$TargetSeqID,*SeqName,*SeqDescription,*SeqLength,*Sequence,
+ *SavedLine, *FAHANDLE, $subseq_start, $subseq_len) = @_;
+
+ local ($Seqlen, $filepos, $curpos, $Tempseq);
+
+# if $key is not the global $seq_key (non-alphanumerics already
+# escaped out for $seq_key) then escape out '\' problem causing char's
+ if ($key ne $seq_key) {
+ $key =~ s/(\W)/\\$1/g;
+ }
+
+ while ((!eof(FAHANDLE))
+ && (($SavedLine =~ /^>/) || ($SavedLine = <FAHANDLE>)))
+ {
+ if (($SavedLine =~ /^>\s*($key)\s+(.*)$/) ||
+ ($start_at_key) && ($key_found) &&
+ ($SavedLine =~ /^>\s*(\S*)\s+(.*)$/o))
+ {
+ $SeqID++;
+
+ # if searching for a particular SeqID go on to next seq
+ # if target and current seqid's don't match
+ if ($TargetSeqID && ($SeqID != $TargetSeqID)) {
+ $SavedLine = <FAHANDLE>;
+ next;
+ }
+
+ $filepos = tell(FAHANDLE); # save position of last fasta header
+ $last_header = $SavedLine;
+
+ $key_found = 1;
+ $SeqName = $1;
+ $SeqDescription = $2;
+ $Sequence = "";
+ $Tempseq = "";
+
+ $Seqlen = 0;
+ while (($Seqlen < $subseq_start) && ($SavedLine = <FAHANDLE>))
+ {
+ if ($SavedLine =~ /^>/) { last; }
+ $SavedLine =~ s/[ \n\t\d]//g; # strip whitespace & numbers
+ $Seqlen += length($SavedLine);
+ }
+
+ $Tempseq = 'X' x $subseq_len; # pre-extending string for efficiency
+
+ $curpos = $Seqlen - length($SavedLine);
+ $seq_head = substr($SavedLine,$subseq_start-$curpos-1);
+ substr($Tempseq,0,length($seq_head)) = $seq_head;
+
+ $Seqlen = length($seq_head);
+
+ while (($Seqlen < $subseq_len) && ($SavedLine = <FAHANDLE>))
+ {
+ if ($SavedLine =~ /^>/) { last; }
+ $SavedLine =~ s/[ \n\t\d]//g; # strip whitespace & numbers
+ substr($Tempseq,$Seqlen,length($SavedLine)) = $SavedLine;
+ $Seqlen += length($SavedLine);
+ }
+
+ $Sequence = substr($Tempseq,0,$subseq_len);
+
+ $Sequence = uc($Sequence);
+ $Sequence =~ s/U/T/g;
+ $Sequence =~ s/X/N/g;
+ seek(FAHANDLE,$filepos,0); # return file position to beginning of this seq
+ $SeqID--; # rewind seqid by 1
+ $SavedLine = $last_header; # restore to original seq header line
+ return 1;
+ }
+ else {
+ if ($SavedLine =~ /^>/) {
+ $SeqID++;
+ }
+ $SavedLine = <FAHANDLE>;
+ }
+ }
+ 0;
+}
+
+## read_more_fasta
+## Reads remaining portion of large fasta file (size>$MaxSeqBuffer)
+## Only reads in $MaxSeqBuffer amount or less each time
+
+sub read_more_fasta {
+
+ local ($SequenceP,*SavedLine, *FAHANDLE,
+ *buffer_overlap_seq, *buffer_end_index, *Seq_buf_overrun, *BufferLength) = @_;
+
+ local ($Seqlen, $filepos);
+
+ $filepos = tell(FAHANDLE);
+ $Seqlen = 0;
+ while (($Seqlen+$SeqBufOverlap < $MaxSeqBuffer) && ($SavedLine = <FAHANDLE>))
+ {
+ if ($SavedLine =~ /^>/) { last; }
+ $SavedLine =~ s/[ \n\t\d]//g; # strip whitespace & numbers
+ $Seqlen += length($SavedLine);
+ }
+
+ if ($Seqlen == 0) {
+ return 0;
+ }
+
+ seek(FAHANDLE,$filepos,0);
+
+ $$SequenceP = $buffer_overlap_seq. 'X' x $Seqlen; # pre-extending string for efficiency
+ $Seqlen = length($buffer_overlap_seq);
+
+ while (($Seqlen < $MaxSeqBuffer) && ($SavedLine = <FAHANDLE>))
+ {
+ if ($SavedLine =~ /^>/) { last; }
+ $SavedLine =~ s/[ \n\t\d]//g; # strip whitespace & numbers
+ substr($$SequenceP,$Seqlen,length($SavedLine)) = $SavedLine;
+ $Seqlen += length($SavedLine);
+ }
+
+ # if sequence is longer than MaxSeqBuffer length,
+ # then save last ~200 nt to allow overlap with next buffer frame
+ # this prevents tRNAs on the border between buffers from being chopped
+ # in half (and missed!)
+
+ if ($Seqlen >= $MaxSeqBuffer) {
+ $buffer_overlap_seq = substr($$SequenceP,$Seqlen-$SeqBufOverlap);
+ $buffer_end_index += $Seqlen - length($buffer_overlap_seq);
+ $Seq_buf_overrun = 1;
+ }
+ else {
+ $Seq_buf_overrun = 0;
+ }
+
+ $BufferLength = length($$SequenceP);
+ $$SequenceP = uc($$SequenceP);
+ $$SequenceP =~ s/U/T/g;
+ $$SequenceP =~ s/X/N/g;
+
+ ## Remove long runs of N's from consideration by pre-scanners
+ ## By doing this, pre-scanner false-pos rate is normal, even
+ ## when scanning unfinished genomes with long N insert "placeholders"
+ $$SequenceP =~ s/NNNNNNNNNN/CCCCCCCCCC/g;
+
+ return 1;
+}
+
+
+sub Check_for_duplicate_seqnames {
+ local(*SeqNameList) = @_;
+ local($dup_flag,$SeqName);
+
+ $dup_flag = 0;
+ foreach $SeqName (sort keys(%SeqNameList)) {
+ if ($SeqNameList{$SeqName} > 1) {
+ $dup_flag++;
+ print STDERR "ERROR: The fasta sequence name \"$SeqName\" appears ",
+ "$SeqNameList{$SeqName} times in the\n input sequence files.\n"
+ }
+ }
+ return $dup_flag;
+}
+
+
+sub write_fasta {
+ local($name, $description, $length, *sequence,*FAHANDLE) = @_;
+ local($pos, $line);
+
+ print FAHANDLE ">$name $description\n";
+ for ($pos = 0; $pos < $length; $pos += 60)
+ {
+ $line = substr($sequence,$pos,60);
+ print FAHANDLE $line, "\n";
+ }
+ 1;
+}
+
+
+# Function: tempname
+# by SE, modification by TMJL
+# Returns a unique temporary filename.
+#
+# Normally puts temp files to /tmp. This directory can
+# be overridden by an environment variable TMPDIR.
+#
+
+sub tempname {
+ local ($exten) = @_;
+ local ($name);
+
+ $name = "$temp_dir/tscan$$"."$exten";
+ return $name;
+
+}
+
+
+# getopts.pl - a better getopt.pl
+
+# Usage:
+# do Getopts('a:bc'); # -a takes arg. -b & -c not. Sets opt_* as a
+# # side effect.
+
+sub Getopts {
+ local($argumentative) = @_;
+ local(@args,$_,$first,$rest,$pos);
+ local($errs) = 0;
+ local($[) = 0;
+
+ @args = split( / */, $argumentative );
+ while(@ARGV && ($_ = $ARGV[0]) =~ /^-(.)(.*)/) {
+ ($first,$rest) = ($1,$2);
+ $pos = index($argumentative,$first);
+ if($pos >= $[) {
+ if($args[$pos+1] eq ':') {
+ shift(@ARGV);
+ if($rest eq '') {
+ ++$errs unless @ARGV;
+ $rest = shift(@ARGV);
+ }
+ eval "\$opt_$first = \$rest;";
+ }
+ else {
+ eval "\$opt_$first = 1";
+ if($rest eq '') {
+ shift(@ARGV);
+ }
+ else {
+ $ARGV[0] = "-$rest";
+ }
+ }
+ }
+ else {
+ print STDERR "\nFATAL: Unknown option -$first\n";
+ ++$errs;
+ if($rest ne '') {
+ $ARGV[0] = "-$rest";
+ }
+ else {
+ shift(@ARGV);
+ }
+ die "Type 'tRNAscan-SE' alone to see list of available options.\n\n";
+ }
+ }
+ $errs == 0;
+}
+
+# default codon->AA translation table follows after "END" label
+# Format: <Codon> <3-letter AA abbreviation> <One letter AA abbrev>
+# (codons may use degenerate nucleotides)
+
+__END__
+GCN Ala A
+TGY Cys C
+GAY Asp D
+GAR Glu E
+TTY Phe F
+GGN Gly G
+CAY His H
+ATH Ile I
+AAR Lys K
+TTR Leu L
+CTN Leu L
+ATG Met M
+AAY Asn N
+CCN Pro P
+CAR Gln Q
+AGR Arg R
+CGN Arg R
+AGY Ser S
+TCN Ser S
+ACN Thr T
+GTN Val V
+TGG Trp W
+TAY Tyr Y
+TAR Sup ?
+TGA SeC Z
+
+
+
+
+
diff --git a/tRNAscanSE/CM.pm b/tRNAscanSE/CM.pm
deleted file mode 100644
index ee33eee..0000000
--- a/tRNAscanSE/CM.pm
+++ /dev/null
@@ -1,2561 +0,0 @@
-# tRNAscanSE/CM.pm
-# This class contains parameters and functions for running CM tRNA search used in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-# --------------------------------------------------------------
-#
-
-package tRNAscanSE::CM;
-
-use strict;
-use tRNAscanSE::Utils;
-use tRNAscanSE::ScanResult;
-use tRNAscanSE::SS;
-use tRNAscanSE::Sequence;
-
-sub new {
- my $class = shift;
- my $self = {};
-
- initialize($self);
-
- bless ($self, $class);
- return $self;
-}
-
-sub DESTROY
-{
- my $self = shift;
-}
-
-sub initialize
-{
- my $self = shift;
-
- $self->{CM_mode} = "cove";
-
- $self->{cm_cutoff} = 20; # default cutoff score for covels reporting of tRNA
-
- $self->{nci_scan_cutoff} = 70; # default cutoff score for rescanning noncanonical introns
-
- $self->{split_tRNA_scan_cutoff} = 38; # default cutoff score for rescanning split tRNA
-
- $self->{half_tRNA_cutoff} = 15; # default cutoff score for half tRNA
-
- $self->{BHB_cm_cutoff} = 5.5; # default score for considering non-canonical intron
-
- $self->{max_tRNA_length} = 500; # max size of -w parameter passed to covels
- # when using a pre-scanner (eufind or tRNAscan)
-
- $self->{max_cove_tRNA_length} = 250; # max size of -w param if only
- # Cove is being used (too slow otherwise)
-
- $self->{max_cmsearch_tRNA_length} = 250; # max size of -w param if only
- # cmsearch is being used (too slow otherwise)
-
- $self->{CM_check_for_introns} = 0; # check for non-canonical introns
-
- $self->{CM_check_for_split_halves} = 0; # check for split tRNA fragments
-
- $self->{min_tRNA_no_intron} = 76; # min length for average tRNA with no intron
-
- $self->{left_splicing_len} = 27;
- $self->{right_splicing_len} = 28;
-
- $self->{min_intron_length} = 5; # min size of introns detected by parsing of
- # coves output
-
- $self->{skip_pseudo_filter} = 0; # enable filter for psuedogenes (Cove score <40,
- # primary struct score <10 bits, secondary
- # structure score < 5 bits)
-
- $self->{min_cove_pseudo_filter_score} = 55; # Below this score, tRNAs are checked
- # for min primary and secondary structure
- # scores to catch pseudogene repeats
- # like rat ID & rodent B2 elements
-
- $self->{min_cmsearch_pseudo_filter_score} = 55; # Below this score, tRNAs are checked
- # for min primary and secondary structure
- # scores to catch pseudogene repeats
- # like rat ID & rodent B2 elements
-
- $self->{min_ss_score} = 5; # Below this secondary structure score,
- # tRNA is considered a pseudogene
-
- $self->{min_hmm_score} = 10; # Below this primary structure score,
- # tRNA is considered a pseudogene
-
- $self->{get_hmm_score} = 0; # also score tRNA with covariance model
- # without sec structure info, similar
- # to getting hmm score for match of
- # seq to tRNA hmm (-H option)
-
- $self->{alt_cm_file} = ''; # alternate covariance model file (-c option)
-
- $self->{main_cm_file} = ''; # Convariance model file name
- $self->{mainNS_cm_file} = '';
- $self->{arch_gw_scan_cm_file} = '';
- $self->{arch_intron_cm_file} = '';
- $self->{arch_five_half_cm_file} = '';
- $self->{arch_three_half_cm_file} = '';
- $self->{Pselc_cm_file} = '';
- $self->{Eselc_cm_file} = '';
-
- $self->{main_cm_file_path} = ''; # Convariance model file path
- $self->{mainNS_cm_file_path} = '';
- $self->{arch_gw_scan_cm_file_path} = '';
- $self->{arch_intron_cm_file_path} = '';
- $self->{arch_five_half_cm_file_path} = '';
- $self->{arch_three_half_cm_file_path} = '';
- $self->{Pselc_cm_file_path} = '';
- $self->{Eselc_cm_file_path} = '';
-
- $self->{covels_bin} = "covels-SE"; # Application executable name
- $self->{coves_bin} = "coves-SE";
- $self->{cmsearch_bin} = "cmsearch";
-
- $self->{tab_results} = +[];
-}
-
-sub CM_mode
-{
- my $self = shift;
- if (@_) { $self->{CM_mode} = shift; }
- return $self->{CM_mode};
-}
-
-sub cove_mode
-{
- my $self = shift;
- return ($self->{CM_mode} eq 'cove');
-}
-
-sub infernal_mode
-{
- my $self = shift;
- return ($self->{CM_mode} eq 'infernal');
-}
-
-sub cm_cutoff
-{
- my $self = shift;
- if (@_) { $self->{cm_cutoff} = shift; }
- return $self->{cm_cutoff};
-}
-
-sub BHB_cm_cutoff
-{
- my $self = shift;
- if (@_) { $self->{BHB_cm_cutoff} = shift; }
- return $self->{BHB_cm_cutoff};
-}
-
-sub max_tRNA_length
-{
- my $self = shift;
- if (@_) { $self->{max_tRNA_length} = shift; }
- return $self->{max_tRNA_length};
-}
-
-sub max_cove_tRNA_length
-{
- my $self = shift;
- if (@_) { $self->{max_cove_tRNA_length} = shift; }
- return $self->{max_cove_tRNA_length};
-}
-
-sub max_cmsearch_tRNA_length
-{
- my $self = shift;
- if (@_) { $self->{max_cmsearch_tRNA_length} = shift; }
- return $self->{max_cmsearch_tRNA_length};
-}
-
-sub CM_check_for_introns
-{
- my $self = shift;
- if (@_) { $self->{CM_check_for_introns} = shift; }
- return $self->{CM_check_for_introns};
-}
-
-sub CM_check_for_split_halves
-{
- my $self = shift;
- if (@_) { $self->{CM_check_for_split_halves} = shift; }
- return $self->{CM_check_for_split_halves};
-}
-
-sub min_tRNA_no_intron
-{
- my $self = shift;
- if (@_) { $self->{min_tRNA_no_intron} = shift; }
- return $self->{min_tRNA_no_intron};
-}
-
-sub min_intron_length
-{
- my $self = shift;
- if (@_) { $self->{min_intron_length} = shift; }
- return $self->{min_intron_length};
-}
-
-sub skip_pseudo_filter
-{
- my $self = shift;
- if (@_) { $self->{skip_pseudo_filter} = shift; }
- return $self->{skip_pseudo_filter};
-}
-
-sub min_pseudo_filter_score
-{
- my $self = shift;
- if (@_) { $self->{min_pseudo_filter_score} = shift; }
- return $self->{min_pseudo_filter_score};
-}
-
-sub min_ss_score
-{
- my $self = shift;
- if (@_) { $self->{min_ss_score} = shift; }
- return $self->{min_ss_score};
-}
-
-sub min_hmm_score
-{
- my $self = shift;
- if (@_) { $self->{min_hmm_score} = shift; }
- return $self->{min_hmm_score};
-}
-
-sub get_hmm_score
-{
- my $self = shift;
- if (@_) { $self->{get_hmm_score} = shift; }
- return $self->{get_hmm_score};
-}
-
-sub alt_cm_file
-{
- my $self = shift;
- if (@_) { $self->{alt_cm_file} = shift; }
- return $self->{alt_cm_file};
-}
-
-sub main_cm_file
-{
- my $self = shift;
- if (@_) { $self->{main_cm_file} = shift; }
- return $self->{main_cm_file};
-}
-
-sub mainNS_cm_file
-{
- my $self = shift;
- if (@_) { $self->{mainNS_cm_file} = shift; }
- return $self->{mainNS_cm_file};
-}
-
-sub arch_intron_cm_file
-{
- my $self = shift;
- if (@_) { $self->{arch_intron_cm_file} = shift; }
- return $self->{arch_intron_cm_file};
-}
-
-sub Pselc_cm_file
-{
- my $self = shift;
- if (@_) { $self->{Pselc_cm_file} = shift; }
- return $self->{Pselc_cm_file};
-}
-
-sub Eselc_cm_file
-{
- my $self = shift;
- if (@_) { $self->{Eselc_cm_file} = shift; }
- return $self->{Eselc_cm_file};
-}
-
-sub main_cm_file_path
-{
- my $self = shift;
- if (@_) { $self->{main_cm_file_path} = shift; }
- return $self->{main_cm_file_path};
-}
-
-sub mainNS_cm_file_path
-{
- my $self = shift;
- if (@_) { $self->{mainNS_cm_file_path} = shift; }
- return $self->{mainNS_cm_file_path};
-}
-
-sub arch_intron_cm_file_path
-{
- my $self = shift;
- if (@_) { $self->{arch_intron_cm_file_path} = shift; }
- return $self->{arch_intron_cm_file_path};
-}
-
-sub Pselc_cm_file_path
-{
- my $self = shift;
- if (@_) { $self->{Pselc_cm_file_path} = shift; }
- return $self->{Pselc_cm_file_path};
-}
-
-sub Eselc_cm_file_path
-{
- my $self = shift;
- if (@_) { $self->{Eselc_cm_file_path} = shift; }
- return $self->{Eselc_cm_file_path};
-}
-
-sub covels_bin
-{
- my $self = shift;
- if (@_) { $self->{covels_bin} = shift; }
- return $self->{covels_bin};
-}
-
-sub coves_bin
-{
- my $self = shift;
- if (@_) { $self->{coves_bin} = shift; }
- return $self->{coves_bin};
-}
-
-sub cmsearch_bin
-{
- my $self = shift;
- if (@_) { $self->{cmsearch_bin} = shift; }
- return $self->{cmsearch_bin};
-}
-
-sub tab_results
-{
- my $self = shift;
- if (@_) { $self->{tab_results} = shift; }
- return $self->{tab_results};
-}
-
-sub set_file_paths {
-
- my $self = shift;
- my $opts = shift;
-
- if ($opts->general_mode()) {
- if ($self->infernal_mode()) {
- $self->{main_cm_file} = "TRNAinf-c.cm"; # use original covariance model
- $self->{mainNS_cm_file} = "TRNAinf-ns-c.cm"; # no sec struct
- }
- elsif ($self->cove_mode()) {
- $self->{main_cm_file} = "TRNA2.cm"; # use original covariance model
- $self->{mainNS_cm_file} = "TRNA2ns.cm"; # no sec struct
- }
- }
- elsif ($opts->bact_mode()) {
- if ($self->infernal_mode()) {
- $self->{main_cm_file} = "TRNAinf-bact-c.cm"; # use bacterial covariance model
- $self->{mainNS_cm_file} = "TRNAinf-bact-ns-c.cm"; # no sec struct
- }
- elsif ($self->cove_mode()) {
- $self->{main_cm_file} = "TRNA2-bact.cm"; # use bacterial covariance model
- $self->{mainNS_cm_file} = "TRNA2-bactns.cm"; # no sec struct
- }
- }
- elsif ($opts->arch_mode()) {
- $self->{arch_intron_cm_file} = "Archaea-BHB-noncan.cm"; # model for finding noncanonical tRNAs
- $self->{arch_five_half_cm_file} = "TRNAinf-arch-5h-nc.cm"; # model for finding 5'half
- $self->{arch_three_half_cm_file} = "TRNAinf-arch-3h-nc.cm"; # model for finding 3'half
- $self->{arch_gw_scan_cm_file} = 'TRNAinf-arch-c.cm';
- if ($self->infernal_mode()) {
- $self->{main_cm_file} = "TRNAinf-arch-c.cm"; # use archae covariance model
- $self->{mainNS_cm_file} = "TRNAinf-arch-ns-c.cm"; # no sec struct
- }
- elsif ($opts->cove_mode()) {
- $self->{main_cm_file} = "TRNA2-arch.cm"; # use archae covariance model
- $self->{mainNS_cm_file} = "TRNA2-archns.cm"; # no sec struct
- }
- }
- else {
- if ($self->infernal_mode()) {
- $self->{main_cm_file} = "TRNAinf-euk-c.cm"; # default to eukar cove model
- $self->{mainNS_cm_file} = "TRNAinf-euk-ns-c.cm"; # no secondary struct
- }
- elsif ($self->cove_mode()) {
- $self->{main_cm_file} = "TRNA2-euk.cm"; # default to eukar cove model
- $self->{mainNS_cm_file} = "TRNA2-eukns.cm"; # no secondary struct
- }
- }
-
- if ($self->{alt_cm_file} ne '') {
- $self->{main_cm_file} = $self->{Alt_cm_file}; # use alternate cm file specified
- # on command line with -c param
- if ($self->infernal_mode()) {
- $self->{mainNS_cm_file} = "TRNAinf-ns-c.cm";
- }
- elsif ($self->cove_mode()) {
- $self->{mainNS_cm_file} = "TRNA2ns.cm";
- }
- }
-
- if ($self->infernal_mode()) {
- $self->{Pselc_cm_file} = "PSELCinf-c.cm";
- $self->{Eselc_cm_file} = "ESELCinf-c.cm";
- }
- elsif ($self->cove_mode()) {
- $self->{Pselc_cm_file} = "PSELC.cm";
- $self->{Eselc_cm_file} = "ESELC.cm";
- }
-}
-
-sub check_lib_files {
-
- my $self = shift;
- my $opts = shift;
- my $lib_dir = shift;
-
- if (-r $self->{main_cm_file}) {
- $self->{main_cm_file_path} = $self->{main_cm_file};
- }
- elsif (-r $lib_dir.$self->{main_cm_file}) {
- $self->{main_cm_file_path} = $lib_dir.$self->{main_cm_file};
- }
- else {
- die "FATAL: Unable to open ".$self->{main_cm_file}." covariance model file\n\n";
- }
-
- if (-r $self->{mainNS_cm_file}) {
- $self->{mainNS_cm_file_path} = $self->{mainNS_cm_file};
- }
- elsif (-r $lib_dir.$self->{mainNS_cm_file}) {
- $self->{mainNS_cm_file_path} = $lib_dir.$self->{mainNS_cm_file};
- }
- else {
- die "FATAL: Unable to open ".$self->{mainNS_cm_file}." covariance model file\n\n";
- }
-
- if (-r $self->{Pselc_cm_file}) {
- $self->{Pselc_cm_file_path} = $self->{Pselc_cm_file};
- }
- elsif (-r $lib_dir.$self->{Pselc_cm_file}) {
- $self->{Pselc_cm_file_path} = $lib_dir.$self->{Pselc_cm_file};
- }
- else {
- die "FATAL: Unable to open ".$self->{Pselc_cm_file}." covariance model file\n\n";
- }
-
- if (-r $self->{Eselc_cm_file}) {
- $self->{Eselc_cm_file_path} = $self->{Eselc_cm_file};
- }
- elsif (-r $lib_dir.$self->{Eselc_cm_file}) {
- $self->{Eselc_cm_file_path} = $lib_dir.$self->{Eselc_cm_file};
- }
- else {
- die "FATAL: Unable to open ".$self->{Eselc_cm_file}." covariance model file\n\n";
- }
- if ($opts->arch_mode() && ($self->infernal_mode() || $self->cove_mode())) {
- if (-r $self->{arch_gw_scan_cm_file}) {
- $self->{arch_gw_scan_cm_file_path} = $self->{arch_gw_scan_cm_file};
- }
- elsif (-r $lib_dir.$self->{arch_gw_scan_cm_file}) {
- $self->{arch_gw_scan_cm_file_path} = $lib_dir.$self->{arch_gw_scan_cm_file};
- }
- else {
- die "FATAL: Unable to open ".$self->{arch_gw_scan_cm_file}." covariance model file\n\n";
- }
- if (-r $self->{arch_intron_cm_file}) {
- $self->{arch_intron_cm_file_path} = $self->{arch_intron_cm_file};
- }
- elsif (-r $lib_dir.$self->{arch_intron_cm_file}) {
- $self->{arch_intron_cm_file_path} = $lib_dir.$self->{arch_intron_cm_file};
- }
- else {
- die "FATAL: Unable to open ".$self->{arch_intron_cm_file}." covariance model file\n\n";
- }
- if (-r $self->{arch_five_half_cm_file}) {
- $self->{arch_five_half_cm_file_path} = $self->{arch_five_half_cm_file};
- }
- elsif (-r $lib_dir.$self->{arch_five_half_cm_file}) {
- $self->{arch_five_half_cm_file_path} = $lib_dir.$self->{arch_five_half_cm_file};
- }
- else {
- die "FATAL: Unable to open ".$self->{arch_five_half_cm_file}." covariance model file\n\n";
- }
- if (-r $self->{arch_three_half_cm_file}) {
- $self->{arch_three_half_cm_file_path} = $self->{arch_three_half_cm_file};
- }
- elsif (-r $lib_dir.$self->{arch_three_half_cm_file}) {
- $self->{arch_three_half_cm_file_path} = $lib_dir.$self->{arch_three_half_cm_file};
- }
- else {
- die "FATAL: Unable to open ".$self->{arch_three_half_cm_file}." covariance model file\n\n";
- }
- }
-}
-
-sub set_bin {
-
- my $self = shift;
- my $bindir = shift;
-
- if ($^O =~ /^MSWin/) {
- $self->{cmsearch_bin} .= ".exe";
- $self->{covels_bin} .= ".exe";
- $self->{coves_bin} .= ".exe";
- }
- if ($self->infernal_mode()) {
- if (!(-x $self->{cmsearch_bin})) {
- $self->{cmsearch_bin} = $bindir.$self->{cmsearch_bin};
- if (!(-x $self->{cmsearch_bin})) {
- die "FATAL: Unable to find ".$self->{cmsearch_bin}." executable\n\n";
- }
- }
- }
- if ($self->cove_mode()) {
- if (!(-x $self->{covels_bin})) {
- $self->{covels_bin} = $bindir.$self->{covels_bin};
- if (!(-x $self->{covels_bin})) {
- die "FATAL: Unable to find ".$self->{covels_bin}." executable\n\n";
- }
- }
- if (!(-x $self->{coves_bin})) {
- $self->{coves_bin} = $bindir.$self->{coves_bin};
- if (!(-x $self->{coves_bin})) {
- die "FATAL: Unable to find ".$self->{coves_bin}." executable\n\n";
- }
- }
- }
-}
-
-sub set_search_params {
-
- my $self = shift;
- my $opts = shift;
- my ($r_scan_len, $r_cur_cm_file,
- $max_search_tRNA_length, $trna_len, $trna_isotype, $ns_cm) = @_;
-
- # don't set '-W' param over 200 bp if a pre-scanner is being used,
- # use max window of 150 bp if cmsearch only (too slow otherwise)
-
- if ($opts->eufind_mode() || $opts->tscan_mode() || $opts->use_prev_ts_run()) {
- $$r_scan_len = &min($trna_len, $self->{max_tRNA_length});
- }
- else {
- $$r_scan_len = $max_search_tRNA_length;
- }
-
- # set correct CM file for current tRNA
- if ($ns_cm) {
- $$r_cur_cm_file = $self->{mainNS_cm_file_path};
- }
- else {
- $$r_cur_cm_file = $self->{main_cm_file_path};
-
- if ($opts->eufind_mode()) {
- if ($trna_isotype eq "SeCp") { # use arch/prok selcys model
- $$r_cur_cm_file = $self->{Pselc_cm_file_path};
- }
- elsif ($trna_isotype eq "SeCe") { # use euk selcys model
- $$r_cur_cm_file = $self->{Eselc_cm_file_path};
- }
- }
- }
-}
-
-# find anticodon loop & a-codon from coves or cmsearch output
-
-sub find_anticodon {
-
- my $self = shift;
- my ($seq, $ss, $undef_anticodon) = @_;
- my ($antiloop_index, $antiloop, $antiloop_len, $antiloop_end, $ac_index, $anticodon, $verify_ac);
-
- # Match pattern in secondary structure output,
- # looking for second stem-loop structure ">>>>...<<<<"
- # that should be the anitocodon stem-loop
-
- if ($ss =~ /^([>.]+<[<.]+>[>.]*)>([.]{4,})<+/o) {
-
- # set to index position of first base in anticodon loop
- $antiloop_index = length($1) + 1;
- $antiloop_len = length($2); # anticodon loop length
-
- # index of end of anticodon loop
- $antiloop_end = $antiloop_index + $antiloop_len - 1;
-
- $antiloop = substr($seq, $antiloop_index, $antiloop_len);
-
- # remove '-' gaps from loop
- $antiloop =~ s/[\-]//g;
- # remove introns & non-canonical bases
- $antiloop =~ s/[a-z]//g;
-
- # Don't guess if even number of bp in
- # anticodon loop
- if ((length($antiloop) < 5) || ((length($antiloop) % 2) == 0)) {
- return ($undef_anticodon, -1, -1, -1);
- }
- # get anticodon
- $ac_index = (length($antiloop) - 3) / 2;
- $anticodon = substr($antiloop, $ac_index, 3);
- $verify_ac = substr($seq, $ac_index + $antiloop_index, 3);
-
- # check to see if anticodon extracted from the entire
- # trna sequence (coveseq) is same as that extracted from
- # just the anticodon loop sequence (antiloop)
-
- if ($verify_ac ne $anticodon) {
- return ($undef_anticodon, -1, -1, -1);
- }
- return ($anticodon, $antiloop_index, $antiloop_end, $ac_index + $antiloop_index + 1);
- }
- else {
- return ($undef_anticodon, -1, -1, -1);
- }
-}
-
-sub find_intron {
-
- my $self = shift;
- my ($trna_seq, $antiloop_index, $antiloop_end) = @_;
- my ($intron, $istart, $iend, $tmpstr, $antiloop_seq);
- my $min_intron_length = $self->{min_intron_length};
-
- # check to see if it was unable
- # to determine the anticodon loop
- if ($antiloop_index == -1) {
- return(0, 0, 0);
- }
- # get subsequence from start of anticodon loop
- # to end of anticodon loop -- look for intron in it
- $antiloop_seq = substr($trna_seq, $antiloop_index, $antiloop_end - $antiloop_index + 1);
-
- if ($antiloop_seq =~ /^(.*[^a-z]+)([a-z]{$min_intron_length,})[^a-z]+/o) {
- $intron = $2;
-
- # make sure to get the base index for the last (not nec. only) occurrence
- # of the intron sequence string up to end of anticodon loop
- $tmpstr = substr($trna_seq, 0, $antiloop_end+1);
- $istart = index($tmpstr, $intron) + 1;
- $iend = length($intron) + $istart - 1;
- }
- else {
- $intron = 0;
- }
- return ($intron, $istart, $iend);
-}
-
-# is_pseudo_gene
-#
-# Runs a covariance model without secondary structure
-# information on predicted tRNA, puts this value
-# in "hmm_score".
-# Contribution to total score from secondary structure
-# derived by subtracting hmm_score from total score
-# Returns non-zero if tRNA scores fall below minima
-# for either primary or secondary structure components
-# of score
-
-sub is_pseudo_gene {
-
- my $self = shift;
- my $opts = shift;
- my ($r_hmm_score, $r_ss_score, $score, $tmp_trnaseq_file, $trna_name, $tRNA_len) = @_;
- my ($dummy1, $dummy2, $hit_start, $hit_end, $hit_ct, $min_pseudo_filter_score);
-
- $$r_ss_score = $$r_hmm_score = -1000; # clear values to be returned
- $dummy1 = $dummy2 = ""; # return values not used
-
- # skip check for pseudo gene if score is above minimum
- # -D (disable pseudogene checking) is specified
- # AND -H option (get hmm scores) is NOT specified
- if ($self->cove_mode()) {
- $min_pseudo_filter_score = $self->{min_cove_pseudo_filter_score};
- }
- elsif ($self->infernal_mode()) {
- $min_pseudo_filter_score = $self->{min_cmsearch_pseudo_filter_score};
- }
-
- if ((($score >= $min_pseudo_filter_score) || $self->{skip_pseudo_filter}) && !$self->{get_hmm_score}) {
- return 0;
- }
-
- if ($self->cove_mode())
- {
- ($dummy1, $dummy2, $$r_hmm_score) =
- $self->run_coves($tmp_trnaseq_file, $trna_name, $self->{mainNS_cm_file_path});
- }
- elsif ($self->infernal_mode())
- {
- ($$r_hmm_score, $hit_start, $hit_end, $hit_ct) =
- $self->cmsearch_bestscore($opts, $tmp_trnaseq_file, $trna_name, $tRNA_len, $self->{mainNS_cm_file_path});
- }
- else {
- return -1; # Error - no second pass scanner selected
- }
- $$r_ss_score = $score - $$r_hmm_score; # calc secondary structure
- # contribution to total bit score
-
- if ((($$r_ss_score < $self->{min_ss_score}) || ($$r_hmm_score < $self->{min_hmm_score})) &&
- ($score < $min_pseudo_filter_score)) {
- return 1;
- }
-}
-
-# Get tRNA anticodon, isotype, intron location, and pseudogene status
-
-sub decode_tRNA_properties {
-
- my $self = shift;
- my $opts = shift;
- my $gc = shift;
- my $log = shift;
- my ($trna_score, $trna_seq, $trna_ss, $r_prescan_tRNA, $trna_start, $trna_end, $cur_cm_file, $tmp_trnaseq_file) = @_;
-
- my ($anticodon, $acodon_index, $trna_type, $intron, $istart, $iend, @introns,
- $hmm_score, $ss_score, $pseudo_gene_flag,
- $antiloop_index, $antiloop_end, $trna_len, $scan_len);
-
- $anticodon = "ERR";
-
- if ($self->cove_mode() || $self->infernal_mode()) {
- ($anticodon, $antiloop_index, $antiloop_end, $acodon_index) =
- $self->find_anticodon($trna_seq, $trna_ss, $gc->undef_anticodon());
- }
- else {
- die "Second pass mode not selected -- can't decode tRNA type\n\n";
- }
-
- # check for problem parsing anticodon loop
- if (($anticodon eq $gc->undef_anticodon()) || ($trna_seq eq 'Error'))
- {
- $anticodon = $gc->undef_anticodon();
- $trna_type = $gc->undef_isotype();
- $intron = 0;
-
- if ($opts->save_odd_struct()) {
- open(ODDTRNA, ">>".$opts->odd_struct_file()) ||
- die "FATAL: Can't open ".$opts->odd_struct_file()." to save seconary structures\n\n";
- print ODDTRNA "$r_prescan_tRNA->{name} ($trna_start-$trna_end):\n$trna_seq\n$trna_ss\n\n";
- close(ODDTRNA);
- }
- }
- else { # continue tRNA struct parsing
- ($intron, $istart, $iend) =
- $self->find_intron($trna_seq, $antiloop_index, $antiloop_end);
-
- if ($intron) {
- push(@introns, {seq=>$intron, start=>$istart, end=>$iend, type=>"CI"});
- }
-
- if (defined $r_prescan_tRNA->{acodon}) {
- if (($anticodon ne (uc($r_prescan_tRNA->{acodon}))) &&
- ($opts->tscan_mode() || $opts->eufind_mode()) && ($opts->strict_params())) {
- $log->write_line("\n$r_prescan_tRNA->{name} - anticondon conflict\t".$opts->second_pass_label().": $anticodon\tfirstpass ($r_prescan_tRNA->{hit_source})".
- ": $r_prescan_tRNA->{acodon}\n$trna_seq\n$trna_ss\n");
- }
- }
-
- $trna_type = $gc->get_tRNA_type($self, $anticodon, $cur_cm_file);
- }
-
- $pseudo_gene_flag = 0;
- $hmm_score = $ss_score = 0;
-
- # Write current tRNA to temp file for re-analysis with other models
- $trna_len = length($trna_seq);
- &write_tRNA($tmp_trnaseq_file, $r_prescan_tRNA->{name}, "", $trna_seq, 1);
-
- if (($trna_type !~ /SeC/) &&
- ($self->is_pseudo_gene($opts, \$hmm_score, \$ss_score, $trna_score, $tmp_trnaseq_file, $r_prescan_tRNA->{name}, $trna_len)) &&
- (!$self->{skip_pseudo_filter}))
- {
- $pseudo_gene_flag = 1; # set to non-zero for likely
- } # pseudogenes
-
- return ($anticodon, $acodon_index, $trna_type, \@introns,
- $hmm_score, $ss_score, $pseudo_gene_flag);
-}
-
-
-sub scan_split_tRNAs {
-
- my $self = shift;
- my $opts = shift;
- my $constants = shift;
- my $stats = shift;
- my $gc = shift;
- my $log = shift;
- my $r_sec_pass_hits = shift;
-
- my $r_pair = {};
- my ($r_pairs_index, $r_five_half_hits, $r_three_half_hits) = $self->scan_split_tRNA_halves($opts, $constants, $stats, $gc, $log, $r_sec_pass_hits);
- my ($r_pairs) = $self->scan_split_tRNAs_in_long_introns($opts, $constants, $stats, $gc, $log, $r_sec_pass_hits);
-
- if (scalar(@$r_pairs) > 0) {
- my $five_half_count = scalar(@$r_five_half_hits);
- my $three_half_count = scalar(@$r_three_half_hits);
-
- for (my $ct = 0; $ct < scalar(@$r_pairs); $ct++) {
- push(@$r_five_half_hits, $r_pairs->[$ct]->{"5h"});
- push(@$r_three_half_hits, $r_pairs->[$ct]->{"3h"});
- $r_pair = {};
- $r_pair->{"5h"} = $five_half_count;
- $r_pair->{"3h"} = $three_half_count;
- push(@$r_pairs_index, $r_pair);
- $five_half_count++;
- $three_half_count++;
- }
- }
-
- &output_split_fragments($opts, $r_pairs_index, $r_five_half_hits, $r_three_half_hits);
-}
-
-sub scan_split_tRNA_halves {
-
- my $self = shift;
- my $opts = shift;
- my $constants = shift;
- my $stats = shift;
- my $gc = shift;
- my $log = shift;
- my $r_sec_pass_hits = shift;
-
- my $tmp_trnaseq_file = $constants->tmp_trnaseq_file();
-
- my (@five_half_hits, @three_half_hits, $five_half_count, $three_half_count, $r_five_half_hit, $r_three_half_hit, $index_5h, $index_3h,
- $acceptor_half_seq, $rc_seq, $rc_acceptor_half_seq, $r_pair, @pairs);
-
- my ($r_valid, $match, $intron_len, $r_intron, $split_trna_ct);
-
- my ($cur_cm_file, $cms_output, @half_hit_list, $r_cm_hit);
-
- $split_trna_ct = 0;
-
- my $seq_file = tRNAscanSE::Sequence->new;
- my @sorted_cm_hits = sort sort_cm_hits_by_start @$r_sec_pass_hits;
-
- # find 5'half and 3'half tRNA hits using cmsearch
- $seq_file->mask_out_sequence($opts->fasta_file(), $constants->tmp_masked_fa(), \@sorted_cm_hits);
- $cur_cm_file = $self->{arch_five_half_cm_file_path};
- if (!$self->run_gw_cmsearch($opts, $log, \@five_half_hits, \$cur_cm_file, $constants->tmp_masked_fa(), "", 1)) {
- return 0;
- }
- $cur_cm_file = $self->{arch_three_half_cm_file_path};
- if (!$self->run_gw_cmsearch($opts, $log, \@three_half_hits, \$cur_cm_file, $constants->tmp_masked_fa(), "", 1)) {
- return 0;
- }
-
- foreach $r_cm_hit (@$r_sec_pass_hits) {
- $intron_len = 0;
- $match = 0;
- if (scalar(@{$r_cm_hit->{introns}}) > 0) {
- foreach $r_intron (@{$r_cm_hit->{introns}}) {
- if ($r_intron->{type} eq "CI") {
- $intron_len = length($r_intron->{seq});
- }
- }
- }
- if ($r_cm_hit->{score} < $self->{split_tRNA_scan_cutoff}) {
- $r_valid = &valid_structure($r_cm_hit->{ss}, $intron_len);
- if (!$r_valid->{tRNA}) {
- @half_hit_list = ();
- &write_tRNA($tmp_trnaseq_file, $r_cm_hit->{seqname}, " ", $r_cm_hit->{seq}, 1);
- $cur_cm_file = $self->{arch_five_half_cm_file_path};
- if (!$self->exec_cmsearch(0, \$cur_cm_file, 0, $tmp_trnaseq_file, $r_cm_hit->{seqname}, \$cms_output)) {
- return 0;
- }
- $self->parse_cmsearch($cms_output, \@half_hit_list, 0, $r_cm_hit, 1);
- foreach $r_five_half_hit (@half_hit_list) {
- if ($r_five_half_hit->{score} >= $self->{half_tRNA_cutoff}) {
- push(@five_half_hits, $r_five_half_hit);
- $match = 1;
- last;
- }
- }
-
- if (!$match) {
- @half_hit_list = ();
- $cur_cm_file = $self->{arch_three_half_cm_file_path};
- if (!$self->exec_cmsearch(0, \$cur_cm_file, 0, $tmp_trnaseq_file, $r_cm_hit->{seqname}, \$cms_output)) {
- return 0;
- }
- $self->parse_cmsearch($cms_output, \@half_hit_list, 0, $r_cm_hit, 1);
- foreach $r_three_half_hit (@half_hit_list) {
- if ($r_three_half_hit->{score} >= $self->{half_tRNA_cutoff}) {
- push(@three_half_hits, $r_three_half_hit);
- $match = 1;
- last;
- }
- }
- }
- }
- }
- }
-
- $five_half_count = 0; $three_half_count = 0;
- foreach $r_five_half_hit (@five_half_hits) {
- $r_five_half_hit->{seqname} = $r_five_half_hit->{hit_seqname};
- $r_five_half_hit->{start} = $r_five_half_hit->{tRNA_start};
- $r_five_half_hit->{end} = $r_five_half_hit->{tRNA_end};
- $five_half_count++ if ($r_five_half_hit->{score} >= $self->{half_tRNA_cutoff});
- }
- foreach $r_three_half_hit (@three_half_hits) {
- $r_three_half_hit->{seqname} = $r_three_half_hit->{hit_seqname};
- $r_three_half_hit->{start} = $r_three_half_hit->{tRNA_start};
- $r_three_half_hit->{end} = $r_three_half_hit->{tRNA_end};
- $three_half_count++ if ($r_three_half_hit->{score} >= $self->{half_tRNA_cutoff});
- }
-
- @five_half_hits = sort sort_cm_hits_by_start @five_half_hits;
- @three_half_hits = sort sort_cm_hits_by_start @three_half_hits;
-
- if ($five_half_count >= $three_half_count) {
- for ($index_5h = 0; $index_5h < scalar(@five_half_hits); $index_5h++) {
- if ($five_half_hits[$index_5h]->{score} >= $self->{half_tRNA_cutoff}) {
- $acceptor_half_seq = uc(&get_acceptor_half($five_half_hits[$index_5h]->{seq}, $five_half_hits[$index_5h]->{ss}, "5h"));
- $rc_seq = &rev_comp_seq($acceptor_half_seq);
- $rc_seq =~ s/C/\[CT\]/g;
- foreach ($index_3h = 0; $index_3h < scalar(@three_half_hits); $index_3h++) {
- if ($three_half_hits[$index_3h]->{score} >= $self->{half_tRNA_cutoff}) {
- $rc_acceptor_half_seq = uc(&get_acceptor_half($three_half_hits[$index_3h]->{seq}, $three_half_hits[$index_3h]->{ss}, "3h"));
- if ($rc_acceptor_half_seq =~ /$rc_seq/) {
- $r_pair = {};
- $r_pair->{"5h"} = $index_5h;
- $r_pair->{"3h"} = $index_3h;
- push(@pairs, $r_pair);
- $five_half_hits[$index_5h]->{pair} = 1;
- $three_half_hits[$index_3h]->{pair} = 1;
- }
- }
- }
- }
- }
- }
- else {
- for ($index_3h = 0; $index_3h < scalar(@three_half_hits); $index_3h++) {
- if ($three_half_hits[$index_3h]->{score} >= $self->{half_tRNA_cutoff}) {
- $acceptor_half_seq = uc(&get_acceptor_half($three_half_hits[$index_3h]->{seq}, $three_half_hits[$index_3h]->{ss}, "3h"));
- $rc_seq = &rev_comp_seq($acceptor_half_seq);
- $rc_seq =~ s/C/\[CT\]/g;
- foreach ($index_5h = 0; $index_5h < scalar(@five_half_hits); $index_5h++) {
- if ($five_half_hits[$index_5h]->{score} >= $self->{half_tRNA_cutoff}) {
- $rc_acceptor_half_seq = uc(&get_acceptor_half($five_half_hits[$index_5h]->{seq}, $five_half_hits[$index_5h]->{ss}, "5h"));
- if ($rc_acceptor_half_seq =~ /$rc_seq/) {
- $r_pair = {};
- $r_pair->{"5h"} = $index_5h;
- $r_pair->{"3h"} = $index_3h;
- push(@pairs, $r_pair);
- $five_half_hits[$index_5h]->{pair} = 1;
- $three_half_hits[$index_3h]->{pair} = 1;
- }
- }
- }
- }
- }
- }
-
- for ($index_5h = 0; $index_5h < scalar(@five_half_hits); $index_5h++) {
- if ($five_half_hits[$index_5h]->{score} >= $self->{half_tRNA_cutoff}) {
- if (!defined $five_half_hits[$index_5h]->{pair}) {
- $r_pair = {};
- $r_pair->{"5h"} = $index_5h;
- push(@pairs, $r_pair);
- }
- }
- }
- for ($index_3h = 0; $index_3h < scalar(@three_half_hits); $index_3h++) {
- if ($three_half_hits[$index_3h]->{score} >= $self->{half_tRNA_cutoff}) {
- if (!defined $three_half_hits[$index_3h]->{pair}) {
- $r_pair = {};
- $r_pair->{"3h"} = $index_3h;
- push(@pairs, $r_pair);
- }
- }
- }
-
- return (\@pairs, \@five_half_hits, \@three_half_hits);
-}
-
-sub scan_split_tRNAs_in_long_introns {
-
- my $self = shift;
- my $opts = shift;
- my $constants = shift;
- my $stats = shift;
- my $gc = shift;
- my $log = shift;
- my $r_sec_pass_hits = shift;
-
- my $tmp_trnaseq_file = $constants->tmp_trnaseq_file();
- my ($r_valid, $scan_flag, $intron_len, $skip, $scan_trna_seq, $over_cutoff_count,
- @rescan_trna_hits, @five_half_hit_list, @three_half_hit_list, @pairs, $r_pair, $trna_ct, $split_trna_ct);
-
- my ($cur_cm_file, $cms_output, $r_cm_hit, $r_cm_hit2, $r_cm_hit_temp, $r_intron, @intron_hit_list, $intron_idx);
-
- $split_trna_ct = 0;
- foreach $r_cm_hit (@$r_sec_pass_hits) {
- $scan_flag = 0;
- $intron_len = 0;
- $intron_idx = -1;
- if (scalar(@{$r_cm_hit->{introns}}) > 0) {
- foreach $r_intron (@{$r_cm_hit->{introns}}) {
- $intron_idx++;
- if ((length($r_intron->{seq}) > 100) && ($r_cm_hit->{isotype} ne "Trp") && ($r_cm_hit->{isotype} ne "Tyr")) {
- $scan_flag = 1;
- last;
- }
- }
- }
- if ($scan_flag) {
- $r_cm_hit_temp = {};
- $r_cm_hit_temp->{start} = 1;
- $r_cm_hit_temp->{strand} = 1;
- $r_cm_hit_temp->{hit_source} = $r_cm_hit->{hit_source};
- $r_cm_hit_temp->{seqname} = $r_cm_hit->{seqname};
- $r_cm_hit_temp->{src_seqname} = $r_cm_hit->{seqname};
- $r_cm_hit_temp->{upstream} = "";
- $r_cm_hit_temp->{downstream} = "";
-
- $scan_trna_seq = uc(substr($r_cm_hit->{seq}, $r_cm_hit->{introns}->[$intron_idx]->{start} - 13, $self->{left_splicing_len}) .
- substr($r_cm_hit->{seq}, $r_cm_hit->{introns}->[$intron_idx]->{end} - $self->{right_splicing_len} + 8, $self->{right_splicing_len}));
-
- &write_tRNA($tmp_trnaseq_file, $r_cm_hit->{seqname}, " ", $scan_trna_seq, 1);
-
- $cur_cm_file = $self->{arch_intron_cm_file_path};
- if (!$self->run_cmsearch_intron($opts, $log, \@intron_hit_list, \$cur_cm_file, $r_cm_hit, $tmp_trnaseq_file, \$over_cutoff_count)) {
- return 0;
- }
- if ($over_cutoff_count > 0) {
- $scan_trna_seq = $r_cm_hit->{seq};
- $scan_trna_seq =~ s/$r_cm_hit->{introns}->[$intron_idx]->{seq}//;
- $r_cm_hit_temp->{seq} = $scan_trna_seq;
- $r_cm_hit_temp->{len} = length($scan_trna_seq);
- $r_cm_hit_temp->{end} = $r_cm_hit_temp->{len};
- &write_tRNA($tmp_trnaseq_file, $r_cm_hit->{seqname}, " ", $scan_trna_seq, 1);
-
- if ($opts->cove_mode())
- {
- $trna_ct = $self->analyze_with_cove($opts, $constants, $stats, $gc, $log, "tRNAscan-SE",
- $r_cm_hit_temp, $tmp_trnaseq_file, \$trna_ct, \@rescan_trna_hits);
- }
- elsif ($opts->infernal_mode())
- {
- $trna_ct = $self->analyze_with_cmsearch($opts, $constants, $stats, $gc, $log, "tRNAscan-SE",
- $r_cm_hit_temp, $tmp_trnaseq_file, \$trna_ct, \@rescan_trna_hits);
- }
-
- if ((scalar(@rescan_trna_hits) > 0) && ($rescan_trna_hits[0]->{score} >= $r_cm_hit->{score})) {
- $split_trna_ct++;
-
- &write_tRNA($tmp_trnaseq_file, $r_cm_hit->{seqname}, " ", $scan_trna_seq, 1);
-
- $cur_cm_file = $self->{arch_five_half_cm_file_path};
- if (!$self->exec_cmsearch(0, \$cur_cm_file, 0, $tmp_trnaseq_file, $r_cm_hit->{seqname}, \$cms_output)) {
- return 0;
- }
- $self->parse_cmsearch($cms_output, \@five_half_hit_list, 0, $rescan_trna_hits[0], 1);
-
- $cur_cm_file = $self->{arch_three_half_cm_file_path};
- if (!$self->exec_cmsearch(0, \$cur_cm_file, 0, $tmp_trnaseq_file, $r_cm_hit->{seqname}, \$cms_output)) {
- return 0;
- }
- $self->parse_cmsearch($cms_output, \@three_half_hit_list, 0, $rescan_trna_hits[0], 1);
-
- if (scalar(@five_half_hit_list) > 0 && scalar(@three_half_hit_list) > 0) {
- $five_half_hit_list[0]->{tRNA_start} = $r_cm_hit->{start};
- if ($r_cm_hit->{strand}) {
- $five_half_hit_list[0]->{tRNA_end} = ($r_cm_hit->{introns}->[$intron_idx]->{start} + $r_cm_hit->{start} - 2);
- $three_half_hit_list[0]->{tRNA_start} = ($r_cm_hit->{introns}->[$intron_idx]->{end} + $r_cm_hit->{start});
- }
- else {
- $five_half_hit_list[0]->{tRNA_end} = ($r_cm_hit->{start} - $r_cm_hit->{introns}->[$intron_idx]->{start} + 2);
- $three_half_hit_list[0]->{tRNA_start} = ($r_cm_hit->{start} - $r_cm_hit->{introns}->[$intron_idx]->{end});
- }
- $three_half_hit_list[0]->{tRNA_end} = $r_cm_hit->{end};
- $r_pair = {};
- $r_pair->{"5h"} = $five_half_hit_list[0];
- $r_pair->{"3h"} = $three_half_hit_list[0];
- push(@pairs, $r_pair);
- }
- }
- }
- }
- }
- return \@pairs;
-}
-
-sub scan_noncanonical_introns {
-
- my $self = shift;
- my $opts = shift;
- my $constants = shift;
- my $stats = shift;
- my $gc = shift;
- my $log = shift;
- my $seq_file = shift;
- my $r_sec_pass_hits = shift;
-
- my $tmp_trnaseq_file = $constants->tmp_trnaseq_file();
- my ($r_valid, $scan_flag, $skip, $ci_intron_index, $scan_trna_seq, $over_cutoff_count,
- $best_score, $total_intron_len, $new_start, $r_new_intron, @rescan_trna_hits, $trna_ct);
- my ($partial_scan_trna_seq, @partial_intron_hit_list, $partial_over_cutoff_count, $last_end);
-
- my ($cur_cm_file, $r_cm_hit, $r_cm_hit_temp, @extra_cm_hit_list, $r_intron, $r_intron_hit, @intron_hit_list, $tRNA_seq, $upstream, $downstream);
- my ($anticodon, $acodon_index, $isotype, $r_introns, $hmm_score, $ss_score, $pseudo_gene_flag);
- my ($cur_tRNA_ct) = 0;
-
- my $masked_seq_file = tRNAscanSE::Sequence->new;
- my @sorted_cm_hits = sort sort_cm_hits_by_start @$r_sec_pass_hits;
-
- # find extra tRNA hits using cmsearch
- $masked_seq_file->mask_out_sequence($opts->fasta_file(), $constants->tmp_masked_fa(), \@sorted_cm_hits);
- if (!$self->run_gw_cmsearch($opts, $log, \@extra_cm_hit_list, \$cur_cm_file, $constants->tmp_masked_fa(), "", 0)) {
- return 0;
- }
-
- foreach my $r_extra_hit (@extra_cm_hit_list)
- {
- if ($r_extra_hit->{score} >= $self->{cm_cutoff}) {
- ($tRNA_seq, $upstream, $downstream) = $seq_file->get_tRNA_sequence($r_extra_hit->{hit_seqname}, $r_extra_hit->{strand},
- $r_extra_hit->{tRNA_start}, $r_extra_hit->{tRNA_end},
- $log, $opts, $constants);
- $r_extra_hit->{name} = $r_extra_hit->{hit_seqname};
-
- &write_tRNA($tmp_trnaseq_file, $r_extra_hit->{hit_seqname}, " ", $r_extra_hit->{seq}, 1);
-
- ($anticodon, $acodon_index, $isotype, $r_introns, $hmm_score, $ss_score, $pseudo_gene_flag) =
- $self->decode_tRNA_properties ($opts, $gc, $log, $r_extra_hit->{score}, $r_extra_hit->{seq}, $r_extra_hit->{ss}, $r_extra_hit,
- $r_extra_hit->{tRNA_start}, $r_extra_hit->{tRNA_end}, $cur_cm_file, $tmp_trnaseq_file);
-
- $r_cm_hit = {};
- $r_cm_hit =
- {seqname =>$r_extra_hit->{hit_seqname}, score=>$r_extra_hit->{score}, ss=>$r_extra_hit->{ss}, seq=>$r_extra_hit->{seq}, model=>$r_extra_hit->{model},
- start=>$r_extra_hit->{tRNA_start}, end=>$r_extra_hit->{tRNA_end}, len=>$r_extra_hit->{tRNA_len}, ID=>$r_extra_hit->{name},
- acodon=>$anticodon, acodon_pos =>$acodon_index, isotype=>$isotype,
- introns=>$r_introns, hmm_score=>$hmm_score,
- ss_score=>$ss_score, is_pseudo=>$pseudo_gene_flag,
- src_seqlen=>3, src_seqname=>$r_extra_hit->{hit_seqname},
- strand=>$r_extra_hit->{strand}, hit_source=>"Inf",
- upstream=>$upstream, downstream=>$downstream, extra=>1};
-
- push (@$r_sec_pass_hits, $r_cm_hit);
- }
- }
-
- # scan for noncanonical introns
- $cur_cm_file = $self->{arch_intron_cm_file_path};
- foreach $r_cm_hit (sort sort_cm_hits_for_output @$r_sec_pass_hits) {
-
- $scan_flag = 0;
-
- # renumber tRNA hits
- $cur_tRNA_ct++;
- $r_cm_hit->{ID} = $r_cm_hit->{seqname}.".t".$cur_tRNA_ct;
-
- if ($r_cm_hit->{extra}) {
- $scan_flag = 1;
- }
- else {
- if (scalar(@{$r_cm_hit->{introns}}) > 0) {
- $r_valid = &valid_structure($r_cm_hit->{ss}, length($r_cm_hit->{introns}->[0]->{seq}));
- }
- else {
- $r_valid = &valid_structure($r_cm_hit->{ss}, 0);
- }
- if (scalar(@{$r_cm_hit->{introns}}) > 0) {
- $scan_flag = 1;
- }
- elsif ($r_cm_hit->{acodon} eq "???") {
- $scan_flag = 1;
- }
- elsif ($r_cm_hit->{score} < $self->{nci_scan_cutoff}) {
- if (!$r_valid->{tRNA}) {
- $scan_flag = 1;
- }
- }
- }
-
- if ($scan_flag) {
-
- $log->write_line("Scan for noncanonical intron ".$r_cm_hit->{ID}."-".$r_cm_hit->{isotype}.$r_cm_hit->{acodon});
-
- $total_intron_len = 0;
- @intron_hit_list = ();
- $best_score = $r_cm_hit->{score};
- $r_cm_hit_temp = {};
- $r_cm_hit_temp->{start} = 1;
- $r_cm_hit_temp->{strand} = 1;
- $r_cm_hit_temp->{hit_source} = $r_cm_hit->{hit_source};
- $r_cm_hit_temp->{seqname} = $r_cm_hit->{seqname};
- $r_cm_hit_temp->{src_seqname} = $r_cm_hit->{seqname};
- $r_cm_hit_temp->{upstream} = "";
- $r_cm_hit_temp->{downstream} = "";
-
- $scan_trna_seq = uc($r_cm_hit->{upstream}.$r_cm_hit->{seq}.$r_cm_hit->{downstream});
- $partial_scan_trna_seq = uc($r_cm_hit->{upstream}.substr($r_cm_hit->{seq}, 0, 12));
- $r_cm_hit_temp->{seq} = $scan_trna_seq;
- $r_cm_hit_temp->{precursor} = $scan_trna_seq;
- $r_cm_hit_temp->{len} = length($scan_trna_seq);
- $r_cm_hit_temp->{end} = $r_cm_hit_temp->{len};
-
- &write_tRNA($tmp_trnaseq_file, $r_cm_hit->{seqname}, " ", $scan_trna_seq, 1);
-
- if (!$self->run_cmsearch_intron($opts, $log, \@intron_hit_list, \$cur_cm_file, $r_cm_hit, $tmp_trnaseq_file, \$over_cutoff_count)) {
- return 0;
- }
-
- &write_tRNA($tmp_trnaseq_file, $r_cm_hit->{seqname}, " ", $partial_scan_trna_seq, 1);
-
- if (!$self->run_cmsearch_intron($opts, $log, \@partial_intron_hit_list, \$cur_cm_file, $r_cm_hit, $tmp_trnaseq_file, \$partial_over_cutoff_count)) {
- return 0;
- }
- foreach $r_intron_hit (@intron_hit_list) {
- $skip = 0;
- $ci_intron_index = -1;
- $r_intron_hit->{overlap} = $ci_intron_index;
- if ($r_intron_hit->{score} >= $self->{BHB_cm_cutoff}) {
- foreach $r_intron (@{$r_cm_hit->{introns}}) {
- $ci_intron_index++;
- if ($r_intron->{type} eq "CI") {
- if ($r_intron_hit->{intron_seq} eq uc($r_intron->{seq})) {
- $skip = 1;
- last;
- }
- elsif (($r_intron_hit->{start} >= $r_intron->{start} && $r_intron_hit->{start} <= $r_intron->{end}) ||
- ($r_intron_hit->{end} >= $r_intron->{start} && $r_intron_hit->{end} <= $r_intron->{end})) {
- $r_intron_hit->{overlap} = $ci_intron_index;
- last;
- }
- }
- }
- if (!$skip) {
- if (($r_intron_hit->{tRNA_start} < $r_cm_hit->{start} && $r_cm_hit->{strand}) ||
- ($r_intron_hit->{tRNA_start} > $r_cm_hit->{start} && !$r_cm_hit->{strand})) {
- if ($r_valid->{acceptor}) {
- $skip = 1;
- }
- }
- }
- if (!$skip) {
- @rescan_trna_hits = ();
- my $idx_intron = index($scan_trna_seq, $r_intron_hit->{intron_seq});
- $scan_trna_seq = substr($scan_trna_seq, 0, $idx_intron) . substr($scan_trna_seq, $idx_intron + $r_intron_hit->{intron_len});
- $r_cm_hit_temp->{seq} = $scan_trna_seq;
- $r_cm_hit_temp->{len} = length($scan_trna_seq);
- $r_cm_hit_temp->{end} = $r_cm_hit_temp->{len};
- &write_tRNA($tmp_trnaseq_file, $r_cm_hit->{seqname}, " ", $scan_trna_seq, 1);
-
- if ($opts->cove_mode())
- {
- $trna_ct = $self->analyze_with_cove($opts, $constants, $stats, $gc, $log, "tRNAscan-SE",
- $r_cm_hit_temp, $tmp_trnaseq_file, \$trna_ct, \@rescan_trna_hits);
- }
- elsif ($opts->infernal_mode())
- {
- $trna_ct = $self->analyze_with_cmsearch($opts, $constants, $stats, $gc, $log, "tRNAscan-SE",
- $r_cm_hit_temp, $tmp_trnaseq_file, \$trna_ct, \@rescan_trna_hits);
- }
-
- if (scalar(@rescan_trna_hits) > 0) {
- if ($rescan_trna_hits[0]->{score} > $best_score) {
- $best_score = $rescan_trna_hits[0]->{score};
- $total_intron_len += $r_intron_hit->{intron_len};
- $r_cm_hit->{acodon} = $rescan_trna_hits[0]->{acodon};
- $r_cm_hit->{acodon_pos} = $rescan_trna_hits[0]->{acodon_pos};
- $r_cm_hit->{isotype} = $rescan_trna_hits[0]->{isotype};
- $r_cm_hit->{score} = $rescan_trna_hits[0]->{score};
- $r_cm_hit->{hmm_score} = $rescan_trna_hits[0]->{hmm_score};
- $r_cm_hit->{ss_score} = $rescan_trna_hits[0]->{ss_score};
- $r_cm_hit->{is_pseudo} = $rescan_trna_hits[0]->{is_pseudo};
- $r_cm_hit->{ss} = $rescan_trna_hits[0]->{ss};
- $r_cm_hit->{seq} = $rescan_trna_hits[0]->{seq};
- $r_cm_hit->{precursor} = substr($r_cm_hit_temp->{precursor}, $rescan_trna_hits[0]->{start} - 1, $rescan_trna_hits[0]->{len} + $total_intron_len);
- $r_cm_hit->{model} = $rescan_trna_hits[0]->{model};
- $r_cm_hit->{len} = $rescan_trna_hits[0]->{len} + $total_intron_len;
- $new_start = $rescan_trna_hits[0]->{start};
- if ($r_intron_hit->{overlap} > -1) {
- $r_cm_hit->{introns}->[$r_intron_hit->{overlap}]->{seq} = $r_intron_hit->{intron_seq};
- $r_cm_hit->{introns}->[$r_intron_hit->{overlap}]->{start} = $r_intron_hit->{start};
- $r_cm_hit->{introns}->[$r_intron_hit->{overlap}]->{end} = $r_intron_hit->{end};
- $r_cm_hit->{introns}->[$r_intron_hit->{overlap}]->{type} = "NCI";
- }
- else {
- push(@{$r_cm_hit->{introns}}, {seq=>$r_intron_hit->{intron_seq}, start=>$r_intron_hit->{start},
- end=>$r_intron_hit->{end}, type=>"NCI"});
- }
- if (scalar(@{$rescan_trna_hits[0]->{introns}}) > 0) {
- $r_new_intron = $rescan_trna_hits[0]->{introns}->[0];
- my $set_ci = 0;
- foreach $r_intron (@{$r_cm_hit->{introns}}) {
- if ($r_intron->{type} eq "CI") {
- $r_intron = $r_new_intron;
- $set_ci = 1;
- }
- }
- if (!$set_ci) {
- push(@{$r_cm_hit->{introns}}, {seq=>$r_new_intron->{seq}, start=>$r_new_intron->{start},
- end=>$r_new_intron->{end}, type=>"CI"});
- }
- }
- else {
- foreach $r_intron (@{$r_cm_hit->{introns}}) {
- if ($r_intron->{type} eq "CI") {
- $r_intron = undef;
- }
- }
- }
- }
- }
- }
- }
- }
- if ($total_intron_len > 0) {
- if ($r_cm_hit->{strand}) {
- $r_cm_hit->{start} = $r_cm_hit->{start} - length($r_cm_hit->{upstream}) + $new_start - 1;
- $r_cm_hit->{end} = $r_cm_hit->{start} + $r_cm_hit->{len} - 1;
- }
- else {
- $r_cm_hit->{start} = $r_cm_hit->{start} + length($r_cm_hit->{upstream}) - $new_start + 1;
- $r_cm_hit->{end} = $r_cm_hit->{start} - $r_cm_hit->{len} + 1;
- }
- foreach $r_intron (@{$r_cm_hit->{introns}}) {
- if (defined $r_intron) {
- $r_intron->{start} = index($r_cm_hit->{precursor}, uc($r_intron->{seq})) + 1;
- $r_intron->{end} = $r_intron->{start} + length($r_intron->{seq}) - 1;
- if (($r_intron->{start} == ($r_cm_hit->{acodon_pos}+4)) && ($r_intron->{type} eq "NCI")) {
- $r_intron->{type} = "CI";
- }
- }
- }
- @{$r_cm_hit->{introns}} = sort sort_intron_by_start @{$r_cm_hit->{introns}};
- $last_end = -1;
- for (my $ct = 0; $ct < scalar(@{$r_cm_hit->{introns}}); $ct++) {
- if ($last_end == $r_cm_hit->{introns}->[$ct]->{start} - 1) {
- $last_end = $r_cm_hit->{introns}->[$ct]->{end};
- $r_cm_hit->{introns}->[$ct]->{start} = $r_cm_hit->{introns}->[$ct - 1]->{start};
- $r_cm_hit->{introns}->[$ct]->{seq} = $r_cm_hit->{introns}->[$ct - 1]->{seq} . $r_cm_hit->{introns}->[$ct]->{seq};
- $r_cm_hit->{introns}->[$ct - 1] = undef;
- }
- $last_end = $r_cm_hit->{introns}->[$ct]->{end};
- }
- }
- elsif(!$r_valid->{acceptor} && $r_cm_hit->{score} > $self->{split_tRNA_scan_cutoff}) {
- foreach $r_intron_hit (@partial_intron_hit_list) {
- $skip = 0;
- $ci_intron_index = -1;
- $r_intron_hit->{overlap} = $ci_intron_index;
- if ($r_intron_hit->{score} >= $self->{BHB_cm_cutoff}) {
- @rescan_trna_hits = ();
- my $idx_intron = index($partial_scan_trna_seq, $r_intron_hit->{intron_seq});
- $partial_scan_trna_seq = substr($partial_scan_trna_seq, 0, $idx_intron) . substr($partial_scan_trna_seq, $idx_intron + $r_intron_hit->{intron_len}) .
- substr($r_cm_hit->{seq}, 12) . $r_cm_hit->{downstream};
- $r_cm_hit_temp->{seq} = $partial_scan_trna_seq;
- $r_cm_hit_temp->{len} = length($partial_scan_trna_seq);
- $r_cm_hit_temp->{end} = $r_cm_hit_temp->{len};
- &write_tRNA($tmp_trnaseq_file, $r_cm_hit->{seqname}, " ", $partial_scan_trna_seq, 1);
-
- if ($opts->cove_mode())
- {
- $trna_ct = $self->analyze_with_cove($opts, $constants, $stats, $gc, $log, "tRNAscan-SE",
- $r_cm_hit_temp, $tmp_trnaseq_file, \$trna_ct, \@rescan_trna_hits);
- }
- elsif ($opts->infernal_mode())
- {
- $trna_ct = $self->analyze_with_cmsearch($opts, $constants, $stats, $gc, $log, "tRNAscan-SE",
- $r_cm_hit_temp, $tmp_trnaseq_file, \$trna_ct, \@rescan_trna_hits);
- }
-
- if (scalar(@rescan_trna_hits) > 0) {
- if ($rescan_trna_hits[0]->{score} > $best_score) {
- $best_score = $rescan_trna_hits[0]->{score};
- $total_intron_len += $r_intron_hit->{intron_len};
- $r_cm_hit->{acodon} = $rescan_trna_hits[0]->{acodon};
- $r_cm_hit->{acodon_pos} = $rescan_trna_hits[0]->{acodon_pos};
- $r_cm_hit->{isotype} = $rescan_trna_hits[0]->{isotype};
- $r_cm_hit->{score} = $rescan_trna_hits[0]->{score};
- $r_cm_hit->{hmm_score} = $rescan_trna_hits[0]->{hmm_score};
- $r_cm_hit->{ss_score} = $rescan_trna_hits[0]->{ss_score};
- $r_cm_hit->{is_pseudo} = $rescan_trna_hits[0]->{is_pseudo};
- $r_cm_hit->{ss} = $rescan_trna_hits[0]->{ss};
- $r_cm_hit->{seq} = $rescan_trna_hits[0]->{seq};
- $r_cm_hit->{precursor} = substr($r_cm_hit_temp->{precursor}, $rescan_trna_hits[0]->{start} - 1, $rescan_trna_hits[0]->{len} + $total_intron_len);
- $r_cm_hit->{model} = $rescan_trna_hits[0]->{model};
- $r_cm_hit->{len} = $rescan_trna_hits[0]->{len} + $total_intron_len;
- $new_start = $rescan_trna_hits[0]->{start};
- if (scalar(@{$rescan_trna_hits[0]->{introns}}) > 0) {
- $r_new_intron = $rescan_trna_hits[0]->{introns}->[0];
- }
- push(@{$r_cm_hit->{introns}}, {seq=>$r_intron_hit->{intron_seq}, start=>$r_intron_hit->{start},
- end=>$r_intron_hit->{end}, type=>"NCI"});
- }
- }
- }
- }
- if ($total_intron_len > 0) {
- if ($r_cm_hit->{strand}) {
- $r_cm_hit->{start} = $r_cm_hit->{start} - length($r_cm_hit->{upstream}) + $new_start - 1;
- $r_cm_hit->{end} = $r_cm_hit->{start} + $r_cm_hit->{len} - 1;
- }
- else {
- $r_cm_hit->{start} = $r_cm_hit->{start} + length($r_cm_hit->{upstream}) - $new_start + 1;
- $r_cm_hit->{end} = $r_cm_hit->{start} - $r_cm_hit->{len} + 1;
- }
- foreach $r_intron (@{$r_cm_hit->{introns}}) {
- if (defined $r_intron) {
- # if ((($r_intron->{type} eq "CI") && ($r_intron->{seq} eq $r_new_intron->{seq})) || ($r_intron->{type} eq "NCI")) {
- $r_intron->{start} = index($r_cm_hit->{precursor}, uc($r_intron->{seq})) + 1;
- $r_intron->{end} = $r_intron->{start} + length($r_intron->{seq}) - 1;
- # }
- if (($r_intron->{start} == ($r_cm_hit->{acodon_pos}+4)) && ($r_intron->{type} eq "NCI")) {
- $r_intron->{type} = "CI";
- }
- }
- }
- @{$r_cm_hit->{introns}} = sort sort_intron_by_start @{$r_cm_hit->{introns}};
- $last_end = -1;
- for (my $ct = 0; $ct < scalar(@{$r_cm_hit->{introns}}); $ct++) {
- if ($last_end == $r_cm_hit->{introns}->[$ct]->{start} - 1) {
- $last_end = $r_cm_hit->{introns}->[$ct]->{end};
- $r_cm_hit->{introns}->[$ct]->{start} = $r_cm_hit->{introns}->[$ct - 1]->{start};
- $r_cm_hit->{introns}->[$ct]->{seq} = $r_cm_hit->{introns}->[$ct - 1]->{seq} . $r_cm_hit->{introns}->[$ct]->{seq};
- $r_cm_hit->{introns}->[$ct - 1] = undef;
- }
- $last_end = $r_cm_hit->{introns}->[$ct]->{end};
- }
- }
- }
- if (scalar(@{$r_cm_hit->{introns}}) > 0) {
- if ($r_cm_hit->{introns}->[0]->{type} eq "CI") {
- $r_valid = &valid_structure($r_cm_hit->{ss}, length($r_cm_hit->{introns}->[0]->{seq}));
- }
- else {
- $r_valid = &valid_structure($r_cm_hit->{ss}, 0);
- }
- }
- elsif ($r_cm_hit->{score} > $self->{split_tRNA_scan_cutoff}) {
- $r_valid = &valid_structure($r_cm_hit->{ss}, 0);
- }
- if (!$r_valid->{tRNA} && $r_cm_hit->{score} > $self->{split_tRNA_scan_cutoff}) {
- @intron_hit_list = ();
- &write_tRNA($tmp_trnaseq_file, $r_cm_hit->{seqname}, " ", $scan_trna_seq, 1);
- if (!$self->run_cmsearch_intron($opts, $log, \@intron_hit_list, \$cur_cm_file, $r_cm_hit, $tmp_trnaseq_file, \$over_cutoff_count)) {
- return 0;
- }
- foreach $r_intron_hit (@intron_hit_list) {
- $skip = 0;
- $ci_intron_index = -1;
- $r_intron_hit->{overlap} = $ci_intron_index;
- if ($r_intron_hit->{score} >= $self->{BHB_cm_cutoff}) {
- foreach $r_intron (@{$r_cm_hit->{introns}}) {
- $ci_intron_index++;
- if ($r_intron->{type} eq "CI") {
- if ($r_intron_hit->{intron_seq} eq uc($r_intron->{seq})) {
- $skip = 1;
- last;
- }
- else {
- my $intron_hit_start = index($r_cm_hit->{precursor}, uc($r_intron_hit->{intron_seq})) + 1;
- my $intron_hit_end = $intron_hit_start + length($r_intron_hit->{intron_seq}) - 1;
- if (($intron_hit_start >= $r_intron->{start} && $intron_hit_start <= $r_intron->{end}) ||
- ($intron_hit_end >= $r_intron->{start} && $intron_hit_end <= $r_intron->{end})) {
- $r_intron_hit->{overlap} = $ci_intron_index;
- last;
- }
- }
- }
- }
- if (!$skip) {
- @rescan_trna_hits = ();
- my $idx_intron = index($scan_trna_seq, $r_intron_hit->{intron_seq});
- $scan_trna_seq = substr($scan_trna_seq, 0, $idx_intron) . substr($scan_trna_seq, $idx_intron + $r_intron_hit->{intron_len});
- $r_cm_hit_temp->{seq} = $scan_trna_seq;
- $r_cm_hit_temp->{len} = length($scan_trna_seq);
- $r_cm_hit_temp->{end} = $r_cm_hit_temp->{len};
- &write_tRNA($tmp_trnaseq_file, $r_cm_hit->{seqname}, " ", $scan_trna_seq, 1);
-
- if ($opts->cove_mode())
- {
- $trna_ct = $self->analyze_with_cove($opts, $constants, $stats, $gc, $log, "tRNAscan-SE",
- $r_cm_hit_temp, $tmp_trnaseq_file, \$trna_ct, \@rescan_trna_hits);
- }
- elsif ($opts->infernal_mode())
- {
- $trna_ct = $self->analyze_with_cmsearch($opts, $constants, $stats, $gc, $log, "tRNAscan-SE",
- $r_cm_hit_temp, $tmp_trnaseq_file, \$trna_ct, \@rescan_trna_hits);
- }
-
- if (scalar(@rescan_trna_hits) > 0) {
- if ($rescan_trna_hits[0]->{score} > $best_score) {
- $best_score = $rescan_trna_hits[0]->{score};
- $total_intron_len += $r_intron_hit->{intron_len};
- $r_cm_hit->{acodon} = $rescan_trna_hits[0]->{acodon};
- $r_cm_hit->{acodon_pos} = $rescan_trna_hits[0]->{acodon_pos};
- $r_cm_hit->{isotype} = $rescan_trna_hits[0]->{isotype};
- $r_cm_hit->{score} = $rescan_trna_hits[0]->{score};
- $r_cm_hit->{hmm_score} = $rescan_trna_hits[0]->{hmm_score};
- $r_cm_hit->{ss_score} = $rescan_trna_hits[0]->{ss_score};
- $r_cm_hit->{is_pseudo} = $rescan_trna_hits[0]->{is_pseudo};
- $r_cm_hit->{ss} = $rescan_trna_hits[0]->{ss};
- $r_cm_hit->{seq} = $rescan_trna_hits[0]->{seq};
-# $r_cm_hit->{precursor} = substr($r_cm_hit_temp->{precursor}, $rescan_trna_hits[0]->{start} - 1, $rescan_trna_hits[0]->{len} + $total_intron_len);
- $r_cm_hit->{model} = $rescan_trna_hits[0]->{model};
- $r_cm_hit->{len} = $rescan_trna_hits[0]->{len} + $total_intron_len;
- $new_start = $rescan_trna_hits[0]->{start};
- if ($r_intron_hit->{overlap} > -1) {
- $r_cm_hit->{introns}->[$r_intron_hit->{overlap}]->{seq} = $r_intron_hit->{intron_seq};
- $r_cm_hit->{introns}->[$r_intron_hit->{overlap}]->{start} = $r_intron_hit->{start};
- $r_cm_hit->{introns}->[$r_intron_hit->{overlap}]->{end} = $r_intron_hit->{end};
- $r_cm_hit->{introns}->[$r_intron_hit->{overlap}]->{type} = "NCI";
- }
- else {
- push(@{$r_cm_hit->{introns}}, {seq=>$r_intron_hit->{intron_seq}, start=>$r_intron_hit->{start},
- end=>$r_intron_hit->{end}, type=>"NCI"});
- }
- if (scalar(@{$rescan_trna_hits[0]->{introns}}) > 0) {
- $r_new_intron = $rescan_trna_hits[0]->{introns}->[0];
- my $set_ci = 0;
- foreach $r_intron (@{$r_cm_hit->{introns}}) {
- if ($r_intron->{type} eq "CI") {
- $r_intron = $r_new_intron;
- $set_ci = 1;
- }
- }
- if (!$set_ci) {
- push(@{$r_cm_hit->{introns}}, {seq=>$r_new_intron->{seq}, start=>$r_new_intron->{start},
- end=>$r_new_intron->{end}, type=>"CI"});
- }
- }
- else {
- foreach $r_intron (@{$r_cm_hit->{introns}}) {
- if ($r_intron->{type} eq "CI") {
- $r_intron = undef;
- }
- }
- }
- }
- }
- }
- }
- }
- if ($total_intron_len > 0) {
- if ($r_cm_hit->{strand}) {
- $r_cm_hit->{start} = $r_cm_hit->{start} - length($r_cm_hit->{upstream}) + $new_start - 1;
- $r_cm_hit->{end} = $r_cm_hit->{start} + $r_cm_hit->{len} - 1;
- }
- else {
- $r_cm_hit->{start} = $r_cm_hit->{start} + length($r_cm_hit->{upstream}) - $new_start + 1;
- $r_cm_hit->{end} = $r_cm_hit->{start} - $r_cm_hit->{len} + 1;
- }
- foreach $r_intron (@{$r_cm_hit->{introns}}) {
- if (defined $r_intron) {
- $r_intron->{start} = index($r_cm_hit->{precursor}, uc($r_intron->{seq})) + 1;
- $r_intron->{end} = $r_intron->{start} + length($r_intron->{seq}) - 1;
- if (($r_intron->{start} == ($r_cm_hit->{acodon_pos}+4)) && ($r_intron->{type} eq "NCI")) {
- $r_intron->{type} = "CI";
- }
- }
- }
- @{$r_cm_hit->{introns}} = sort sort_intron_by_start @{$r_cm_hit->{introns}};
- $last_end = -1;
- for (my $ct = 0; $ct < scalar(@{$r_cm_hit->{introns}}); $ct++) {
- if ($last_end == $r_cm_hit->{introns}->[$ct]->{start} - 1) {
- $last_end = $r_cm_hit->{introns}->[$ct]->{end};
- $r_cm_hit->{introns}->[$ct]->{start} = $r_cm_hit->{introns}->[$ct - 1]->{start};
- $r_cm_hit->{introns}->[$ct]->{seq} = $r_cm_hit->{introns}->[$ct - 1]->{seq} . $r_cm_hit->{introns}->[$ct]->{seq};
- $r_cm_hit->{introns}->[$ct - 1] = undef;
- }
- $last_end = $r_cm_hit->{introns}->[$ct]->{end};
- }
- }
- }
- }
- }
- @$r_sec_pass_hits = sort sort_cm_hits_for_output @$r_sec_pass_hits;
-}
-
-# Run Infernal cmsearch for noncanonical introns
-sub run_cmsearch_intron {
-
- my $self = shift;
- my $opts = shift;
- my $log = shift;
- my ($r_intron_hit_list, $r_cm_file, $r_cm_hit, $tmp_trnaseq_file, $r_over_cutoff_count) = @_;
-
- my ($cms_output, $r_intron_hit, $ct, $intronDesc);
- my ($pre_intron, $intron, $post_intron, $intron_start, $intron_span);
-
- if (!$self->exec_cmsearch(0, $r_cm_file, 0, $tmp_trnaseq_file, $r_cm_hit->{seqname}, \$cms_output)) {
- return 0;
- }
- $self->parse_cmsearch($cms_output, $r_intron_hit_list, 0, $r_cm_hit, 0);
- $$r_over_cutoff_count = 0;
- foreach $r_intron_hit (@$r_intron_hit_list) {
- $ct++;
- if ($r_intron_hit->{score} >= $self->{BHB_cm_cutoff}) {
- $$r_over_cutoff_count++;
-
- if ($r_intron_hit->{ss} =~ /^([\<\-\.]{11,})(\-\<[<.]+[_.]{4,}[>.]{9,}\-[.]*\-)([-.>]+)$/) {
- $pre_intron = $1;
- $intron = $2;
- $post_intron = $3;
- $intron_start = length($pre_intron);
- $intron_span = length($intron);
- }
- $r_intron_hit->{intron_seq} = substr($r_intron_hit->{seq}, $intron_start, $intron_span);
- $r_intron_hit->{intron_seq} = uc($r_intron_hit->{intron_seq});
- $r_intron_hit->{intron_seq} =~ s/U/T/g;
- $r_intron_hit->{intron_seq} =~ s/-//g;
- $r_intron_hit->{intron_len} = length($r_intron_hit->{intron_seq});
-
- $r_intron_hit->{subseq_start} += $intron_start;
- $r_intron_hit->{subseq_end} -= length($post_intron);
- $r_intron_hit->{start} = $r_intron_hit->{subseq_start};
- $r_intron_hit->{end} = $r_intron_hit->{subseq_end};
-
- if ($r_intron_hit->{strand}) {
- $r_intron_hit->{tRNA_start} += $intron_start;
- $r_intron_hit->{tRNA_end} -= length($post_intron);
- }
- else {
- $r_intron_hit->{tRNA_start} -= $intron_start;
- $r_intron_hit->{tRNA_end} += length($post_intron);
- }
- $r_intron_hit->{start} -= length($r_cm_hit->{upstream});
- $r_intron_hit->{end} -= length($r_cm_hit->{upstream});
- if ($r_intron_hit->{strand}) {
- $r_intron_hit->{tRNA_start} -= length($r_cm_hit->{upstream});
- $r_intron_hit->{tRNA_end} -= length($r_cm_hit->{upstream});
- }
- else {
- $r_intron_hit->{tRNA_start} += length($r_cm_hit->{upstream});
- $r_intron_hit->{tRNA_end} += length($r_cm_hit->{upstream});
- }
- }
- else {
- $log->write_line("Low infernal score for noncanonical intron detection of $r_cm_hit->{ID} intron$ct: $r_intron_hit->{score}");
- $log->write_line("CMSearch Hit#$ct: $r_intron_hit->{tRNA_start}-$r_intron_hit->{tRNA_end},".
- " Sc: $r_intron_hit->{score}, Len: ".(abs($r_intron_hit->{tRNA_start} - $r_intron_hit->{tRNA_end}) + 1));
- }
- }
-
- return 1;
-}
-
-# Run Infernal cmsearch for genome-wide missing tRNA scanning, return results in $r_cms_hit_list array reference
-
-sub run_gw_cmsearch {
-
- my $self = shift;
- my $opts = shift;
- my $log = shift;
- my ($r_cms_hit_list, $r_cur_cm_file, $tmp_seq_file, $seqname, $halves) = @_;
-
- my ($scan_len, $cms_output, $r_cms_hit, $over_cutoff, $ct, $trnaDesc);
-
- my $cm_file_input = $$r_cur_cm_file;
- $self->set_search_params($opts, \$scan_len, $r_cur_cm_file, $self->{max_cmsearch_tRNA_length},
- $self->{max_tRNA_length}, "", 0);
-
- # run cmsearch
- if ($halves) {
- $$r_cur_cm_file = $cm_file_input;
- }
- else {
- $$r_cur_cm_file = $self->{arch_gw_scan_cm_file_path};
- }
- if (!$self->exec_cmsearch($scan_len, $r_cur_cm_file, 1, $tmp_seq_file, $seqname, \$cms_output)) {
- return 0;
- }
- $self->parse_gw_cmsearch($cms_output, $r_cms_hit_list, 0);
-
- # Go thru hit list, save info for tRNA hits with sub-cutoff scores
-
- if (!$halves) {
- $ct = 0;
- $over_cutoff = 0;
-
- foreach $r_cms_hit (@$r_cms_hit_list) {
- $ct++;
- if ($r_cms_hit->{score} >= $self->{cm_cutoff}) {
- $over_cutoff++;
- }
- else {
- $log->write_line("Low cmsearch score for $ct: $r_cms_hit->{score}");
- $trnaDesc = "(CMSearch Hit#$ct: $r_cms_hit->{tRNA_start}-$r_cms_hit->{tRNA_end},".
- " Sc: $r_cms_hit->{score}, Len: ".(abs($r_cms_hit->{tRNA_start} - $r_cms_hit->{tRNA_end}) + 1).") ";
- if ($opts->save_falsepos()) {
- &write_tRNA($opts->falsepos_file(), $ct, $trnaDesc, $r_cms_hit->{seq}, 0);
- }
- }
- }
-
- # report if no scores over 0 bit reporting threshold
-
- if ($over_cutoff == 0) {
- if (!$opts->results_to_stdout()) {
- $log->write_line("No extra CMSearch hits above cutoff found for $seqname");
- }
- }
- else {
- $log->write_line("Found ".$over_cutoff." extra Infernal hits.");
- }
- }
- return 1;
-}
-
-# Parse the text results of a genome-wide cmsearch into data fields
-
-sub parse_gw_cmsearch {
-
- my $self = shift;
- my ($cms_output, $r_cms_hit_list, $overlaps_OK) = @_;
-
- my (@cms_lines, $subseq_start, $subseq_end, $hit_overlap,
- $cur_seq_name, $line_ct, $cms_hit_ct, $score, $strand, $skip,
- $top_score, $overlapping_hit, $prev_start, $prev_end, $prev_seq_name);
-
- @cms_lines = split(/\n/, $cms_output);
- $cms_hit_ct = -1;
- $score = 0;
-
- for ($line_ct = 0; $line_ct <= $#cms_lines; $line_ct++)
- {
- if ($cms_lines[$line_ct] =~ /^>(\S.+)$/) {
- $prev_seq_name = $cur_seq_name;
- $cur_seq_name = $1;
- $skip = 0;
-
- if ($cur_seq_name ne $prev_seq_name) {
- $top_score = -1;
- $prev_start = -1;
- $prev_end = -1;
- }
- }
- elsif ($cms_lines[$line_ct] =~ /^\s*Plus strand results/)
- {
- $strand = 1;
- }
- elsif ($cms_lines[$line_ct] =~ /^\s*Minus strand results/)
- {
- $strand = 0;
- }
- elsif ($cms_lines[$line_ct] =~ /^\s*Query =\s*(\d+)\s*\-\s*(\d+), Target =\s*(\d+)\s*\-\s*(\d+)/)
- {
- $skip = 0;
- $subseq_start = $3;
- $subseq_end = $4;
-
- $hit_overlap = eval(!$overlaps_OK &&
- (($cur_seq_name eq $prev_seq_name) &&
- (seg_overlap($subseq_start, $subseq_end, $prev_start, $prev_end))));
- }
-# elsif ($cms_lines[$line_ct] =~ /^\s*Score =\s*([0-9.\-]+), E =\s*([0-9e.\-]+), P =\s*([0-9e.\-]+), GC =\s*(\d+)/)
- elsif ($cms_lines[$line_ct] =~ /^\s*Score =\s*([0-9.\-]+), /)
- {
- $score = $1;
-
- # If true, Don't save current hit -- Advance to next set of alignment info
- if (($score < $top_score) && ($hit_overlap))
- {
- $line_ct += 4;
- $skip = 1;
- next;
- }
-
- # Save current hit
- # If it's a new sequence, or the same seq but no overlap, save the last hit
- # by advancing the hit counter
- if (!$hit_overlap)
- {
- # convert cmsearch secondary structure
- if ($cms_hit_ct > -1) {
- ($r_cms_hit_list->[$cms_hit_ct]->{ss}, $r_cms_hit_list->[$cms_hit_ct]->{seq}) =
- $self->format_cmsearch_output($r_cms_hit_list->[$cms_hit_ct]->{ss}, $r_cms_hit_list->[$cms_hit_ct]->{seq});
- }
-
- $cms_hit_ct++;
- push(@$r_cms_hit_list,
- {hit_seqname => "", score=>-1, ss=>"", seq=>"", model=>"",
- tRNA_start=>-1, tRNA_end=>-1,
- strand=>$strand, hit_source=>"Infernal"});
- }
-
- # Save current hit as best non-overlapping hit
- $prev_start = $subseq_start;
- $prev_end = $subseq_end;
- $top_score = $score;
-
- $r_cms_hit_list->[$cms_hit_ct]->{hit_seqname}= $cur_seq_name;
- $r_cms_hit_list->[$cms_hit_ct]->{score} = $score;
- $r_cms_hit_list->[$cms_hit_ct]->{ss} = "";
- $r_cms_hit_list->[$cms_hit_ct]->{seq} = "";
- $r_cms_hit_list->[$cms_hit_ct]->{model} = "";
- $r_cms_hit_list->[$cms_hit_ct]->{subseq_start} = $subseq_start;
- $r_cms_hit_list->[$cms_hit_ct]->{subseq_end} = $subseq_end;
- $r_cms_hit_list->[$cms_hit_ct]->{tRNA_start} = $subseq_start;
- $r_cms_hit_list->[$cms_hit_ct]->{tRNA_end} = $subseq_end;
- $r_cms_hit_list->[$cms_hit_ct]->{tRNA_len} = abs($subseq_end - $subseq_start) + 1;
- }
-
- # Parse model structure line
-
- elsif ($cms_lines[$line_ct] =~ /^\s+([(),<>._\-,\[\]\{\}\:]{1,60})/)
- {
- if (!$skip) {
- $r_cms_hit_list->[$cms_hit_ct]->{ss} .= $1;
-
- # Parse model sequence line
- if ($cms_lines[$line_ct + 1] =~ /^\s+\d+\s+([a-zA-Z\-]{1,60})\s+\d+/) {
- $r_cms_hit_list->[$cms_hit_ct]->{model} .= $1;
- }
- # Parse target sequence line
- if ($cms_lines[$line_ct + 3] =~ /^\s+\d+\s+([a-zA-Z\-]{1,60})\s+\d+/) {
- $r_cms_hit_list->[$cms_hit_ct]->{seq} .= $1;
- }
- }
- # Advance to next set of alignment info
- $line_ct += 3;
- }
- }
- # convert cmsearch secondary structure
- if ($cms_hit_ct > -1) {
- ($r_cms_hit_list->[$cms_hit_ct]->{ss}, $r_cms_hit_list->[$cms_hit_ct]->{seq}) =
- $self->format_cmsearch_output($r_cms_hit_list->[$cms_hit_ct]->{ss}, $r_cms_hit_list->[$cms_hit_ct]->{seq});
- }
-}
-
-sub parse_covels_hit {
-
- my $self = shift;
- my ($covels_hit, $r_covels_hit_elements, $ts_start, $sense_strand) = @_;
-
- my $covels_hit_found = 0;
-
- if ($covels_hit =~ /^\s*(\S+)\s+(\d+)\s+(\d+).+: (\S+)\s*/o) {
- $r_covels_hit_elements->{score} = $1;
- $r_covels_hit_elements->{subseq_start} = $2;
- $r_covels_hit_elements->{subseq_end} = $3;
- $r_covels_hit_elements->{hit_seqname} = $4;
- $covels_hit_found = 1;
- }
-
- if ($covels_hit_found) {
- if ($sense_strand) {
- $r_covels_hit_elements->{tRNA_start} = $ts_start + $r_covels_hit_elements->{subseq_start} - 1;
- $r_covels_hit_elements->{tRNA_end} = $ts_start + $r_covels_hit_elements->{subseq_end} -1;
- }
- else {
- $r_covels_hit_elements->{tRNA_start} = $ts_start - $r_covels_hit_elements->{subseq_start} + 1;
- $r_covels_hit_elements->{tRNA_end} = $ts_start - $r_covels_hit_elements->{subseq_end} + 1;
- }
-
- return 1;
- }
- else {
- return 0;
- }
-}
-
-# Run covels, return hits in $covels_hit_list array
-
-sub run_covels {
-
- my $self = shift;
- my $opts = shift;
- my $stats = shift;
- my $log = shift;
- my ($r_covels_hit_list, $r_cur_cm_file, $tmp_trnaseq_file, $r_prescan_tRNA) = @_;
-
- my ($scan_len, $covels_cmd, $covels_output, $junk, $allhits, $ct,
- $total_hits, $trnaDesc, $report_cutoff, $over_cutoff, $fulltrnaDesc);
-
- my ($covels_hit, $cove_confirmed_ct);
-
- my %covels_hit_elements = ();
-
- $self->set_search_params($opts, \$scan_len, $r_cur_cm_file, $self->{max_cove_tRNA_length},
- $r_prescan_tRNA->{len}, $r_prescan_tRNA->{isotype}, 0);
-
- # set covels reporting threshold below 0 (default) if -X param is
- # set below 0 by user
-
- $report_cutoff = &min(0, $self->{cm_cutoff});
-
- # run Covels
-
- $covels_cmd = $self->covels_bin()." -w$scan_len -t$report_cutoff $$r_cur_cm_file $tmp_trnaseq_file";
- $covels_output = `$covels_cmd`;
-
- if (&error_exit_status("Covels-SE", $r_prescan_tRNA->{src_seqname})) {
- print "Exit first loop at 1\n";
- return 0;
- }
-
- ($junk, $allhits) = split(/----------\n\n/, $covels_output);
- @$r_covels_hit_list = split(/\n/, $allhits);
-
- # count no. of hits over cutoff
-
- $total_hits = 0;
-
- foreach $covels_hit (@$r_covels_hit_list) {
- %covels_hit_elements = ();
- if (($self->parse_covels_hit($covels_hit, \%covels_hit_elements,
- $r_prescan_tRNA->{start}, $r_prescan_tRNA->{strand})) &&
- ($covels_hit_elements{score} >= $self->{cm_cutoff})) {
- $total_hits++;
- }
- }
-
- # if no tRNAs detected when using a selenocysteine cove model,
- # try main model and run again before giving up
-
- if (($total_hits == 0) &&
- (($$r_cur_cm_file eq $self->{Pselc_cm_file_path}) || ($$r_cur_cm_file eq $self->{Eselc_cm_file_path}))) {
- $$r_cur_cm_file = $self->{main_cm_file_path};
-
- # re-run Covels with main model
-
- $covels_cmd = $self->covels_bin()." -w$scan_len -t$report_cutoff $$r_cur_cm_file $tmp_trnaseq_file";
- $covels_output = `$covels_cmd`;
- if (&error_exit_status("Covels-SE", $r_prescan_tRNA->{src_seqname})) {
- print "Exit first loop at 2\n";
- return 0;
- }
-
- ($junk,$allhits) = split(/----------\n\n/,$covels_output);
- @$r_covels_hit_list = split(/\n/, $allhits);
- }
-
- # Go thru hit list, save info for tRNA hits with sub-cutoff scores
-
- $ct = 0;
- $over_cutoff = 0;
- $trnaDesc = "";
-
- foreach $covels_hit (@$r_covels_hit_list) {
- %covels_hit_elements = ();
- if ($self->parse_covels_hit($covels_hit, \%covels_hit_elements,
- $r_prescan_tRNA->{start}, $r_prescan_tRNA->{strand})) {
- $ct++;
- if ($covels_hit_elements{score} >= $self->{cm_cutoff}) {
- $over_cutoff++;
- }
- else {
- $log->write_line("Low covels score for $r_prescan_tRNA->{name}.$ct: $covels_hit_elements{score}");
- $trnaDesc .= "(Cove Hit#$ct: $covels_hit_elements{tRNA_start}-$covels_hit_elements{tRNA_end},".
- " Sc: $covels_hit_elements{score}, Len: ".(abs($covels_hit_elements{tRNA_start} - $covels_hit_elements{tRNA_end}) + 1).") ";
- }
- }
- }
-
- # report if no scores over 0 bit reporting threshold
-
- if ($over_cutoff == 0) {
- if ((!$opts->results_to_stdout()) &&
- ($opts->eufind_mode() || $opts->tscan_mode() || $opts->use_prev_ts_run())) {
- $log->write_line("Covels score(s) below cutoff for $r_prescan_tRNA->{name}. Skipping...");
- }
- if ($opts->save_falsepos()) {
- $fulltrnaDesc = "(Fp Hit: $r_prescan_tRNA->{start}-$r_prescan_tRNA->{end}, ".
- (abs($r_prescan_tRNA->{start} - $r_prescan_tRNA->{end}) + 1)." bp, Src: $r_prescan_tRNA->{hit_source}) ".$trnaDesc;
-
- $stats->increment_fpos_base_ct(length($r_prescan_tRNA->{seq}));
- &write_tRNA($opts->falsepos_file(), $r_prescan_tRNA->{name}, $fulltrnaDesc, $r_prescan_tRNA->{seq}, 0);
- }
- }
-
- return 1;
-}
-
-sub run_coves {
-
- my $self = shift;
- my ($tmp_trnaseq_file, $seq_name, $cm_file) = @_;
-
- my ($covseq, $covss, $coves_output, $junk, @coves_lines, $sec_struct, $coves_score);
-
- my $coves_cmd = $self->{coves_bin}." -s $cm_file $tmp_trnaseq_file";
- $coves_output = `$coves_cmd`;
- if (&error_exit_status("Coves-SE", $seq_name)) {
- print STDERR "Skipping tRNA anticodon & type prediction\n\n";
- return ("Error", "", -1);
- }
-
- ($junk, $sec_struct) = split(/----------\n\n/, $coves_output);
- @coves_lines = split(/\n/,$sec_struct);
- $covseq = '';
- $covss = '';
- $coves_score = -1000;
- $seq_name =~ s/(\W)/\\$1/g;
-
- foreach (@coves_lines) {
- if (/^\s+$seq_name\s([a-zA-Z\-]{1,60})\s*/) {
- $covseq .= $1;
- }
- if (/^\s+$seq_name\s([\.\<\>\ ]{1,60})/) {
- $covss .= $1;
- }
- if (/^\s*(\S+)\sbits\s:\s$seq_name/) {
- $coves_score = $1;
- }
- }
-
- $covss =~ s/\s//g; # take spaces out of alignment
- $covseq =~ s/-//g; # take '-' gaps out of seq
-
- if (($covseq eq '') || ($covss eq '')) {
- print STDERR "Could not complete coves successfully for $seq_name\n",
- "because unable to parse coves secondary structure string.\n",
- "Skipping tRNA anticodon & type prediction\n";
- return ("Error", "", -1);
- }
-
- return ($covseq, $covss, $coves_score);
-}
-
-sub analyze_with_cove {
-
- my $self = shift;
- my $opts = shift;
- my $constants = shift;
- my $stats = shift;
- my $gc = shift;
- my $log = shift;
- my $program_id = shift;
- my ($r_prescan_tRNA, $tmp_trnaseq_file, $r_curseq_trnact, $r_sec_pass_hits) = @_;
-
- my (@covels_hit_list, $cur_cm_file, $covels_hit, $cove_confirmed_ct);
- my ($covseq, $covss, $coves_score, $r_introns);
- my ($cv_anticodon, $acodon_index, $cv_type, $introns, $hmm_score, $ss_score, $pseudo_gene_flag);
- my %covels_hit_elements = ();
- my $cov_hit = {};
-
- $cove_confirmed_ct = 0;
-
- if (!$self->run_covels($opts, $stats, $log, \@covels_hit_list, \$cur_cm_file, $tmp_trnaseq_file, $r_prescan_tRNA)) {
- return 0;
- }
-
- # Loop to parse covels tRNA hit(s) and run Coves on each tRNA
-
- foreach $covels_hit (@covels_hit_list) {
- %covels_hit_elements = ();
- if ((!$self->parse_covels_hit($covels_hit, \%covels_hit_elements,
- $r_prescan_tRNA->{start}, $r_prescan_tRNA->{strand})) ||
- ($covels_hit_elements{score} < $self->{cm_cutoff})) {
- next;
- }
-
- $$r_curseq_trnact++;
-
- $covels_hit_elements{upstream} = $r_prescan_tRNA->{upstream};
- $covels_hit_elements{downstream} = $r_prescan_tRNA->{downstream};
-
- if (($covels_hit_elements{subseq_start} == 1) && ($covels_hit_elements{subseq_end} == $r_prescan_tRNA->{len})) {
- $covels_hit_elements{tRNA_len} = $r_prescan_tRNA->{len};
- }
- else {
- # get correct subseq for coves & save to file
- $covels_hit_elements{tRNA_len} = $covels_hit_elements{subseq_end} - $covels_hit_elements{subseq_start} + 1;
- &write_tRNA($tmp_trnaseq_file, $covels_hit_elements{hit_seqname}, " ",
- substr($r_prescan_tRNA->{seq}, $covels_hit_elements{subseq_start} - 1, $covels_hit_elements{tRNA_len}), 1);
- if ($covels_hit_elements{subseq_start} > 1) {
- $covels_hit_elements{upstream} .= substr($r_prescan_tRNA->{seq}, 0, $covels_hit_elements{subseq_start} - 1);
- }
- if ($covels_hit_elements{subseq_end} < $r_prescan_tRNA->{len}) {
- $covels_hit_elements{downstream} = substr($r_prescan_tRNA->{seq}, $covels_hit_elements{subseq_end}) .
- $covels_hit_elements{downstream};
- }
- }
- $stats->increment_coves_base_ct($covels_hit_elements{tRNA_len});
-
- $covels_hit_elements{name} = $covels_hit_elements{hit_seqname}.".t".$$r_curseq_trnact;
-
- ($covseq, $covss, $coves_score) =
- $self->run_coves($tmp_trnaseq_file, $r_prescan_tRNA->{src_seqname}, $cur_cm_file);
-
- # look for intron
-
- ($cv_anticodon, $acodon_index, $cv_type, $r_introns, $hmm_score, $ss_score, $pseudo_gene_flag) =
- $self->decode_tRNA_properties ($opts, $gc, $log, $coves_score, $covseq, $covss, $r_prescan_tRNA,
- $covels_hit_elements{tRNA_start}, $covels_hit_elements{tRNA_end}, $cur_cm_file, $tmp_trnaseq_file);
-
- $cov_hit = {};
- $cov_hit =
- {seqname =>$covels_hit_elements{hit_seqname}, score=>$coves_score, ss=>$covss, seq=>$covseq, model=>"",
- start=>$covels_hit_elements{tRNA_start}, end=>$covels_hit_elements{tRNA_end}, len=>$covels_hit_elements{tRNA_len},
- ID=>$covels_hit_elements{name},
- acodon=>$cv_anticodon, acodon_pos =>$acodon_index, isotype=>$cv_type,
- introns=>$r_introns, hmm_score=>$hmm_score,
- ss_score=>$ss_score, is_pseudo=>$pseudo_gene_flag,
- src_seqlen=>$r_prescan_tRNA->{src_seqlen}, src_seqname=>$covels_hit_elements{hit_seqname},
- strand=>$r_prescan_tRNA->{strand}, hit_source=>$r_prescan_tRNA->{hit_source},
- upstream=>$covels_hit_elements{upstream}, downstream=>$covels_hit_elements{downstream}, extra=>0};
-
- if (!$self->{CM_check_for_introns}) {
- &output_tRNA($opts, $gc, $log, $self->{tab_results}, $self->{get_hmm_score}, $program_id,
- $r_prescan_tRNA, $cov_hit, $$r_curseq_trnact);
-
- $cove_confirmed_ct++;
- }
- else {
- push (@$r_sec_pass_hits, $cov_hit);
- }
- } # while more covels_hits
-
- return $cove_confirmed_ct;
-}
-
-# Format command and run Infernal cmsearch
-
-sub exec_cmsearch {
-
- my $self = shift;
- my ($scan_len, $r_cm_file, $scan_genome, $tmp_trnaseq_file, $seq_name, $r_cms_output) = @_;
-
- my $cm_options = "-g --fil-no-hmm --toponly";
- if ($scan_genome) {
- $cm_options = "-g";
- }
-
- my $cms_cmd = "$self->{cmsearch_bin} $cm_options $$r_cm_file $tmp_trnaseq_file";
- $$r_cms_output = `$cms_cmd`;
-
- if (&error_exit_status("cmsearch", $seq_name)) {
- print STDERR "Exited at failed cmsearch\n";
- return 0;
- }
-
- return 1;
-}
-
-# Run Infernal cmsearch, return results in $r_cms_hit_list array reference
-
-sub run_cmsearch {
-
- my $self = shift;
- my $opts = shift;
- my $stats = shift;
- my $log = shift;
- my ($r_cms_hit_list, $r_cur_cm_file, $tmp_trnaseq_file, $r_prescan_tRNA) = @_;
-
- my ($scan_len, $cms_cmd, $cms_output, $r_cms_hit, $total_hits, $over_cutoff, $ct, $trnaDesc, $fulltrnaDesc);
-
- $self->set_search_params($opts, \$scan_len, $r_cur_cm_file, $self->{max_cmsearch_tRNA_length},
- $r_prescan_tRNA->{len}, $r_prescan_tRNA->{isotype}, 0);
-
- # run cmsearch
-
- if (!$self->exec_cmsearch($scan_len, $r_cur_cm_file, 0, $tmp_trnaseq_file, $r_prescan_tRNA->{src_seqname}, \$cms_output)) {
- return 0;
- }
-
- $self->parse_cmsearch($cms_output, $r_cms_hit_list, 0, $r_prescan_tRNA, 1);
-
- # count no. of hits over cutoff
-
- $total_hits = 0;
- foreach $r_cms_hit (@$r_cms_hit_list) {
- if ($r_cms_hit->{score} >= $self->{cm_cutoff}) {
- $total_hits++;
- }
- }
-
- # if no tRNAs detected when using a selenocysteine cove model,
- # try main model and run again before giving up
-
- if (($total_hits == 0) &&
- (($$r_cur_cm_file eq $self->{Pselc_cm_file_path}) || ($$r_cur_cm_file eq $self->{Eselc_cm_file_path}))) {
- $$r_cur_cm_file = $self->{main_cm_file_path};
-
- # re-run cmsearch with main model
-
- if (!$self->exec_cmsearch($scan_len, $r_cur_cm_file, 0, $tmp_trnaseq_file, $r_prescan_tRNA->{src_seqname}, \$cms_output)) {
- return 0;
- }
- $self->parse_cmsearch($cms_output, $r_cms_hit_list, 0, $r_prescan_tRNA);
- }
-
- # Go thru hit list, save info for tRNA hits with sub-cutoff scores
-
- $ct = 0;
- $over_cutoff = 0;
- $trnaDesc = "";
-
- foreach $r_cms_hit (@$r_cms_hit_list) {
- $ct++;
- if ($r_cms_hit->{score} >= $self->{cm_cutoff}) {
- $over_cutoff++;
- }
- else {
- $log->write_line("Low covels score for $r_prescan_tRNA->{name}.$ct: $r_cms_hit->{score}");
- $trnaDesc .= "(CMSearch Hit#$ct: $r_cms_hit->{tRNA_start}-$r_cms_hit->{tRNA_end},".
- " Sc: $r_cms_hit->{score}, Len: ".(abs($r_cms_hit->{tRNA_start} - $r_cms_hit->{tRNA_end}) + 1).") ";
- }
- }
-
- # report if no scores over 0 bit reporting threshold
-
- if ($over_cutoff == 0) {
- if ((!$opts->results_to_stdout()) &&
- ($opts->eufind_mode() || $opts->tscan_mode() || $opts->use_prev_ts_run())) {
- $log->write_line("CMSearch score(s) below cutoff for $r_prescan_tRNA->{name}. Skipping...");
- }
- if ($opts->save_falsepos()) {
- $fulltrnaDesc = "(Fp Hit: $r_prescan_tRNA->{start}-$r_prescan_tRNA->{end}, ".
- (abs($r_prescan_tRNA->{start} - $r_prescan_tRNA->{end}) + 1)." bp, Src: $r_prescan_tRNA->{hit_source}) ".$trnaDesc;
-
- $stats->increment_fpos_base_ct(length($r_prescan_tRNA->{seq}));
- &write_tRNA($opts->falsepos_file(), $r_prescan_tRNA->{name}, $fulltrnaDesc, $r_prescan_tRNA->{seq}, 0);
- }
- }
-
- return 1;
-}
-
-# Parse the text results of a cmsearch into data fields
-
-sub parse_cmsearch {
-
- my $self = shift;
- my ($cms_output, $r_cms_hit_list, $overlaps_OK, $r_prescan_tRNA, $format_struct) = @_;
-
- my (@cms_lines, $subseq_start, $subseq_end, $hit_overlap,
- $cur_seq_name, $line_ct, $cms_hit_ct, $score, $skip,
- $top_score, $overlapping_hit, $prev_start, $prev_end, $prev_seq_name);
-
- @cms_lines = split(/\n/, $cms_output);
- $cms_hit_ct = -1;
- $score = 0;
-
- for ($line_ct = 0; $line_ct <= $#cms_lines; $line_ct++)
- {
- if ($cms_lines[$line_ct] =~ /^>(\S.+)$/) {
- $prev_seq_name = $cur_seq_name;
- $cur_seq_name = $1;
- $skip = 0;
-
- if ($cur_seq_name ne $prev_seq_name) {
- $top_score = -1;
- $prev_start = -1;
- $prev_end = -1;
- }
- }
- elsif ($cms_lines[$line_ct] =~ /^\s*Query =\s*(\d+)\s*\-\s*(\d+), Target =\s*(\d+)\s*\-\s*(\d+)/)
- {
- $skip = 0;
- $subseq_start = $3;
- $subseq_end = $4;
-
- $hit_overlap = eval(!$overlaps_OK &&
- (($cur_seq_name eq $prev_seq_name) &&
- (seg_overlap($subseq_start, $subseq_end, $prev_start, $prev_end))));
- }
-# elsif ($cms_lines[$line_ct] =~ /^\s*Score =\s*([0-9.\-]+), E =\s*([0-9e.\-]+), P =\s*([0-9e.\-]+), GC =\s*(\d+)/)
- elsif ($cms_lines[$line_ct] =~ /^\s*Score =\s*([0-9.\-]+), /)
- {
- $score = $1;
-
- # If true, Don't save current hit -- Advance to next set of alignment info
- if (($score < $top_score) && ($hit_overlap))
- {
- $line_ct += 4;
- $skip = 1;
- next;
- }
-
- # Save current hit
- # If it's a new sequence, or the same seq but no overlap, save the last hit
- # by advancing the hit counter
- if (!$hit_overlap)
- {
- # convert cmsearch secondary structure
- if (($cms_hit_ct > -1) && $format_struct) {
- ($r_cms_hit_list->[$cms_hit_ct]->{ss}, $r_cms_hit_list->[$cms_hit_ct]->{seq}) =
- $self->format_cmsearch_output($r_cms_hit_list->[$cms_hit_ct]->{ss}, $r_cms_hit_list->[$cms_hit_ct]->{seq});
- }
-
- $cms_hit_ct++;
- push(@$r_cms_hit_list,
- {hit_seqname => "", score=>-1, ss=>"", seq=>"", model=>"",
- tRNA_start=>-1, tRNA_end=>-1,
- strand=>$r_prescan_tRNA->{strand}, hit_source=>$r_prescan_tRNA->{hit_source}});
- }
-
- # Save current hit as best non-overlapping hit
- $prev_start = $subseq_start;
- $prev_end = $subseq_end;
- $top_score = $score;
-
- $r_cms_hit_list->[$cms_hit_ct]->{hit_seqname}= $cur_seq_name;
- $r_cms_hit_list->[$cms_hit_ct]->{score} = $score;
- $r_cms_hit_list->[$cms_hit_ct]->{ss} = "";
- $r_cms_hit_list->[$cms_hit_ct]->{seq} = "";
- $r_cms_hit_list->[$cms_hit_ct]->{model} = "";
- $r_cms_hit_list->[$cms_hit_ct]->{subseq_start} = $subseq_start;
- $r_cms_hit_list->[$cms_hit_ct]->{subseq_end} = $subseq_end;
-
- if ($r_prescan_tRNA->{strand}) {
- $r_cms_hit_list->[$cms_hit_ct]->{tRNA_start} = $r_prescan_tRNA->{start} + $subseq_start - 1;
- $r_cms_hit_list->[$cms_hit_ct]->{tRNA_end} = $r_prescan_tRNA->{start} + $subseq_end - 1;
- }
- else {
- $r_cms_hit_list->[$cms_hit_ct]->{tRNA_start} = $r_prescan_tRNA->{start} - $subseq_start + 1;
- $r_cms_hit_list->[$cms_hit_ct]->{tRNA_end} = $r_prescan_tRNA->{start} - $subseq_end + 1;
- }
- }
-
- # Parse model structure line
-
- elsif ($cms_lines[$line_ct] =~ /^\s+([(),<>._\-,\[\]\{\}\:]{1,60})/)
- {
- if (!$skip) {
- $r_cms_hit_list->[$cms_hit_ct]->{ss} .= $1;
-
- # Parse model sequence line
- if ($cms_lines[$line_ct + 1] =~ /^\s+\d+\s+([a-zA-Z\-]{1,60})\s+\d+/) {
- $r_cms_hit_list->[$cms_hit_ct]->{model} .= $1;
- }
- # Parse target sequence line
- if ($cms_lines[$line_ct + 3] =~ /^\s+\d+\s+([a-zA-Z\-]{1,60})\s+\d+/) {
- $r_cms_hit_list->[$cms_hit_ct]->{seq} .= $1;
- }
- }
- # Advance to next set of alignment info
- $line_ct += 3;
- }
- }
- # convert cmsearch secondary structure
- if (($cms_hit_ct > -1) && $format_struct) {
- ($r_cms_hit_list->[$cms_hit_ct]->{ss}, $r_cms_hit_list->[$cms_hit_ct]->{seq}) =
- $self->format_cmsearch_output($r_cms_hit_list->[$cms_hit_ct]->{ss}, $r_cms_hit_list->[$cms_hit_ct]->{seq});
- }
-
-}
-
-sub format_cmsearch_output {
-
- my $self = shift;
- my $cmsearch_ss = shift;
- my $cmsearch_seq = shift;
-
- $cmsearch_seq =~ s/U/T/g;
- $cmsearch_seq =~ s/u/t/g;
- for (my $index = 0; $index < length($cmsearch_seq); $index++) {
- if (substr($cmsearch_seq, $index, 1) eq '-') {
- substr($cmsearch_seq, $index, 1) = '*';
- if (length($cmsearch_ss) > $index) {
- substr($cmsearch_ss, $index, 1) = '*';
- }
- }
- }
- $cmsearch_seq =~ s/\*//g;
- $cmsearch_ss =~ s/\*//g;
-
- $cmsearch_ss =~ s/[,_\-:]/./g;
- $cmsearch_ss =~ s/[>)]/@/g;
- $cmsearch_ss =~ s/[(<]/>/g;
- $cmsearch_ss =~ s/@/</g;
-
- my $diff = length($cmsearch_seq) - length($cmsearch_ss);
- for (my $ct = 0; $ct < $diff; $ct++) {
- $cmsearch_ss .= ".";
- }
-
- return ($cmsearch_ss, $cmsearch_seq);
-}
-
-# Runs Infernal cmsearch, and returns the highest score
-
-sub cmsearch_bestscore {
-
- my $self = shift;
- my $opts = shift;
- my ($tmp_trnaseq_file, $seq_name, $tRNA_len, $cm_file) = @_;
-
- my ($cms_output, @cms_hit_list, $scan_len, $cur_cm_file, @cms_lines,
- $subseq_start, $subseq_end, $score, $besthit_score, $line,
- $besthit_start, $besthit_end, $hit_ct);
-
- $self->set_search_params($opts, \$scan_len, \$cur_cm_file, $self->{max_cmsearch_tRNA_length}, $tRNA_len, '', 1);
-
- if (!$self->exec_cmsearch($scan_len, \$cur_cm_file, 0, $tmp_trnaseq_file, $seq_name, \$cms_output)) {
- return 0;
- }
-
- @cms_lines = split(/\n/, $cms_output);
- $hit_ct = 0;
- $score = 0;
- $besthit_score = 0;
-
- foreach $line (@cms_lines)
- {
- if ($line =~ /^\s*Query =\s+(\d+)\s+-\s+(\d+), Target =\s+(\d+)\s+-\s+(\d+)/)
- {
- $subseq_start = $3;
- $subseq_end = $4;
- $hit_ct++;
- }
- elsif ($line =~ /^\s*Score =\s+([0-9.\-]+), GC =\s+(\d+)/)
- {
- $score = $1;
- if ($score > $besthit_score) {
- $besthit_score = $score;
- $besthit_start = $subseq_start;
- $besthit_end = $subseq_end;
- }
- }
- }
- return ($besthit_score, $besthit_start, $besthit_end, $hit_ct);
-}
-
-sub analyze_with_cmsearch {
-
- my $self = shift;
- my $opts = shift;
- my $constants = shift;
- my $stats = shift;
- my $gc = shift;
- my $log = shift;
- my $program_id = shift;
- my ($r_prescan_tRNA, $tmp_trnaseq_file, $r_curseq_trnact, $r_sec_pass_hits) = @_;
-
- my ($cms_confirmed_ct, $cms_output, $cur_cm_file, @cms_hit_list, $cms_hit, $ct);
- my ($cm_anticodon, $acodon_index, $cm_type, $r_introns, $hmm_score, $ss_score, $pseudo_gene_flag);
-
- my $cm_hit = {};
-
- $cms_confirmed_ct = 0;
-
- if (!$self->run_cmsearch($opts, $stats, $log, \@cms_hit_list, \$cur_cm_file, $tmp_trnaseq_file, $r_prescan_tRNA)) {
- return 0;
- }
-
- # Loop to process each cmsearch tRNA hit
-
- foreach $cms_hit (@cms_hit_list) {
-
- if ($cms_hit->{score} < $self->{cm_cutoff}) {
- next;
- }
-
- $$r_curseq_trnact++;
-
- $cms_hit->{upstream} = $r_prescan_tRNA->{upstream};
- $cms_hit->{downstream} = $r_prescan_tRNA->{downstream};
-
- if (($cms_hit->{subseq_start} == 1) && ($cms_hit->{subseq_end} == $r_prescan_tRNA->{len})) {
- $cms_hit->{tRNA_len} = $r_prescan_tRNA->{len};
- }
- else {
- # get correct subseq & save to file
- if ((length($r_prescan_tRNA->{seq}) >= $cms_hit->{subseq_end} + 2) &&
- (uc(substr($r_prescan_tRNA->{seq}, $cms_hit->{subseq_end}, 3)) eq "CCA") &&
- (substr($cms_hit->{ss}, length($cms_hit->{ss}) - 4) ne "....")) {
- $cms_hit->{subseq_end} += 3;
- if ($cms_hit->{strand}) {
- $cms_hit->{tRNA_end} += 3;
- }
- else {
- $cms_hit->{tRNA_end} -= 3;
- }
- $cms_hit->{seq} .= "CCA";
- }
- $cms_hit->{tRNA_len} = $cms_hit->{subseq_end} - $cms_hit->{subseq_start} + 1;
- &write_tRNA($tmp_trnaseq_file, $cms_hit->{hit_seqname}, " ",
- substr($r_prescan_tRNA->{seq}, $cms_hit->{subseq_start} - 1, $cms_hit->{tRNA_len}), 1);
-
- if (uc(substr($r_prescan_tRNA->{seq}, $cms_hit->{subseq_start} - 1, $cms_hit->{tRNA_len})) ne uc($cms_hit->{seq})) {
- $cms_hit->{seq} = substr($r_prescan_tRNA->{seq}, $cms_hit->{subseq_start} - 1, $cms_hit->{tRNA_len});
- }
- if ($cms_hit->{subseq_start} > 1) {
- $cms_hit->{upstream} .= substr($r_prescan_tRNA->{seq}, 0, $cms_hit->{subseq_start} - 1);
- }
- if ($cms_hit->{subseq_end} < $r_prescan_tRNA->{len}) {
- $cms_hit->{downstream} = substr($r_prescan_tRNA->{seq}, $cms_hit->{subseq_end}) . $cms_hit->{downstream};
- }
- }
-
- $cms_hit->{name} = $cms_hit->{hit_seqname}.".t$$r_curseq_trnact";
-
- ($cm_anticodon, $acodon_index, $cm_type, $r_introns, $hmm_score, $ss_score, $pseudo_gene_flag) =
- $self->decode_tRNA_properties ($opts, $gc, $log, $cms_hit->{score}, $cms_hit->{seq}, $cms_hit->{ss}, $r_prescan_tRNA,
- $cms_hit->{tRNA_start}, $cms_hit->{tRNA_end}, $cur_cm_file, $tmp_trnaseq_file);
-
- $cm_hit = {};
- $cm_hit =
- {seqname =>$cms_hit->{hit_seqname}, score=>$cms_hit->{score}, ss=>$cms_hit->{ss}, seq=>$cms_hit->{seq}, model=>$cms_hit->{model},
- start=>$cms_hit->{tRNA_start}, end=>$cms_hit->{tRNA_end}, len=>$cms_hit->{tRNA_len}, ID=>$cms_hit->{name},
- acodon=>$cm_anticodon, acodon_pos =>$acodon_index, isotype=>$cm_type,
- introns=>$r_introns, hmm_score=>$hmm_score,
- ss_score=>$ss_score, is_pseudo=>$pseudo_gene_flag,
- src_seqlen=>$r_prescan_tRNA->{src_seqlen}, src_seqname=>$cms_hit->{hit_seqname},
- strand=>$r_prescan_tRNA->{strand}, hit_source=>$r_prescan_tRNA->{hit_source},
- upstream=>$cms_hit->{upstream}, downstream=>$cms_hit->{downstream}, extra=>0};
-
- if (!$self->{CM_check_for_introns}) {
- &output_tRNA($opts, $gc, $log, $self->{tab_results}, $self->{get_hmm_score}, $program_id,
- $r_prescan_tRNA, $cm_hit, $$r_curseq_trnact);
-
- $cms_confirmed_ct++;
- }
- else {
- push(@$r_sec_pass_hits, $cm_hit);
- }
- } # while more cmsearch hits
-
- return $cms_confirmed_ct;
-}
-
-sub sort_cm_hits_by_start {
-
- my $self = shift;
- my $cms_hits = shift;
-
- my $a_start = $a->{start};
- my $b_start = $b->{start};
-
- if ($a->{strand} == 0) {
- $a_start = $a->{end};
- }
- if ($b->{strand} == 0) {
- $b_start = $b->{end};
- }
-
- return ($a->{seqname} cmp $b->{seqname} ||
- $a_start <=> $b_start);
-}
-
-sub sort_cm_hits_for_output {
-
- my $self = shift;
- my $cms_hits = shift;
-
- if ((($a->{strand} == $b->{strand}) && ($a->{strand} == 1)) ||
- ($a->{strand} != $b->{strand})) {
- return ($a->{seqname} cmp $b->{seqname} ||
- $b->{strand} <=> $a->{strand} ||
- $a->{start} <=> $b->{start});
- }
- if (($a->{strand} == $b->{strand}) && ($a->{strand} == 0)) {
- return ($a->{seqname} cmp $b->{seqname} ||
- $b->{strand} <=> $a->{strand} ||
- $b->{start} <=> $a->{start});
- }
-}
-
-sub sort_intron_by_start {
-
- my $self = shift;
- my $introns = shift;
-
- return ($a->{start} <=> $b->{end});
-}
-
-1;
diff --git a/tRNAscanSE/Constants.pm b/tRNAscanSE/Constants.pm
deleted file mode 100644
index 6e90865..0000000
--- a/tRNAscanSE/Constants.pm
+++ /dev/null
@@ -1,105 +0,0 @@
-# tRNAscanSE/Constants.pm
-# This class defines global constants used in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-# --------------------------------------------------------------
-#
-
-package tRNAscanSE::Constants;
-
-use strict;
-use tRNAscanSE::Utils;
-
-sub new {
- my $class = shift;
- my $self = {};
-
- initialize($self);
-
- bless ($self, $class);
- return $self;
-}
-
-sub DESTROY
-{
- my $self = shift;
-}
-
-sub initialize
-{
- my $self = shift;
-
- $self->{REALLY_BIG_NUMBER} = 1000000000; # largest sequence length imaginable
-
- # Source of first-pass hits table
- # C = Cove, T = tRNAscan, E = EufindtRNA, B = both
-
- my @source_tab = ('Cv', 'Ts', 'Eu', 'Bo');
- $self->{source_tab} = \@source_tab;
-
- $self->{upstream_len} = 60;
- $self->{downstream_len} = 60;
-}
-
-sub REALLY_BIG_NUMBER
-{
- my $self = shift;
- return $self->{REALLY_BIG_NUMBER};
-}
-
-sub source_tab
-{
- my $self = shift;
- return $self->{source_tab};
-}
-
-sub upstream_len
-{
- my $self = shift;
- return $self->{upstream_len};
-}
-
-sub downstream_len
-{
- my $self = shift;
- return $self->{downstream_len};
-}
-
-sub set_temp_file_names
-{
- my $self = shift;
- my $temp_dir = shift;
-
- $self->{tmp_raw} = &tempname($temp_dir, ".raw"); # for raw tscan output
- $self->{tmp_fa} = &tempname($temp_dir, ".fa"); # for current fasta seq file
- $self->{tmp_trnaseq_file} = &tempname($temp_dir, ".trna"); # for current tRNA seq
- $self->{tmp_masked_fa} = &tempname($temp_dir, ".masked.fa"); # for current tRNA seq
-}
-
-sub tmp_raw
-{
- my $self = shift;
- return $self->{tmp_raw};
-}
-
-sub tmp_fa
-{
- my $self = shift;
- return $self->{tmp_fa};
-}
-
-sub tmp_trnaseq_file
-{
- my $self = shift;
- return $self->{tmp_trnaseq_file};
-}
-
-sub tmp_masked_fa
-{
- my $self = shift;
- return $self->{tmp_masked_fa};
-}
-
-1;
diff --git a/tRNAscanSE/Eufind.pm b/tRNAscanSE/Eufind.pm
deleted file mode 100644
index ded9bb2..0000000
--- a/tRNAscanSE/Eufind.pm
+++ /dev/null
@@ -1,261 +0,0 @@
-# tRNAscanSE/Eufind.pm
-# This class contains parameters and functions for running eufindtRNA used in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-# --------------------------------------------------------------
-#
-
-package tRNAscanSE::Eufind;
-
-use strict;
-use tRNAscanSE::Utils;
-
-
-sub new {
- my $class = shift;
- my $self = {};
-
- initialize($self);
-
- bless ($self, $class);
- return $self;
-}
-
-sub DESTROY
-{
- my $self = shift;
-}
-
-sub initialize
-{
- my $self = shift;
- $self->{eufind_params} = "-r"; # relaxed params to be used with
- # eufindtRNA program by default
- # this option selects tRNAs,
- # not looking for poly T
- # pol III termination signal
-
- $self->{eufind_intscore} = -32.10; # Intermediate score cutoff for use
- # with eufindtRNA
-# $self->{eufind_Totscore} = -31.8; # Total score cutoff for use
- # with eufindtRNA in non-relaxed mode
-
- $self->{eufind_bin} = "eufindtRNA";
-
- $self->{eufind_mask} = 2; # Bit-wise masks for source of tRNA hits
-}
-
-sub eufind_params
-{
- my $self = shift;
- if (@_) { $self->{eufind_params} = shift; }
- return $self->{eufind_params};
-}
-
-sub eufind_intscore
-{
- my $self = shift;
- if (@_) { $self->{eufind_intscore} = shift; }
- return $self->{eufind_intscore};
-}
-
-sub eufind_bin
-{
- my $self = shift;
- if (@_) { $self->{eufind_bin} = shift; }
- return $self->{eufind_bin};
-}
-
-sub eufind_mask
-{
- my $self = shift;
- return $self->{eufind_mask};
-}
-
-sub set_bin {
-
- my $self = shift;
- my $bindir = shift;
-
- if ($^O =~ /^MSWin/) {
- $self->{eufind_bin} .= ".exe";
- }
-
- if (!(-x $self->{eufind_bin})) {
- $self->{eufind_bin} = $bindir.$self->{eufind_bin};
- if (!(-x $self->{eufind_bin})) {
- die "FATAL: Unable to find ".$self->{eufind_bin}." executable\n\n";
- }
- }
-}
-
-sub run_eufind {
-
- my $self = shift;
- my ($tmp_fa, $start_index, $max_int_len, $seq_name) = @_;
- my $eufind_bin = $self->{eufind_bin};
- my $eufind_intscore = $self->{eufind_intscore};
- my $eufind_params = $self->{eufind_params};
-
- # run default Eufind using selected param set
- my $eufind_output =
- `$eufind_bin -i $start_index -F -I $eufind_intscore -l $max_int_len $eufind_params $tmp_fa`;
- if (&error_exit_status("EufindtRNA",$seq_name)) {
- $eufind_output = "";
- }
- return $eufind_output;
-}
-
-sub process_Eufind_hits {
-
- my $self = shift;
- my $constants = shift;
- my $stats = shift;
- my $r_hit_list = shift;
- my $eufind_output = shift;
-
- my ($istart, $iend, $from,$ to, $intron, $trnact, $len, $seq_name,
- $anticodon, $iso_type, $sense_strand, $score, $pos, $i, @eufind_lines);
-
- $trnact = 0; # trna count for this sequence
- $istart = 0; $iend = 0; # intron bounds
- $from = 0; $to = 0; # tRNA bounds
- $len = 0; # tRNA length
- $intron = 0; # intron present? flag
- $anticodon = '';
- $iso_type = '';
- $score = 0.0;
-
- @eufind_lines = split(/\n/, $eufind_output);
- foreach (@eufind_lines) {
- if (/^(\S+)\s+(\d+)\s+(\d+)\s+(\d+)\s+(\S+)\s+(\S+)\s+(\d+)\s+(\d+)\s+(\S+)/o)
- {
- $seq_name = $1;
- $trnact = $2;
- $from = $3;
- $to = $4;
- $iso_type = $5;
- $anticodon = $6;
- $score = $9;
-
- $istart = 0;
- $iend = 0;
-
- if ($from < $to) {
- $len = $to - $from + 1;
- $pos = $from;
- $sense_strand = 1; # flag for forward or reverse strand
- }
- else {
- $len = $from - $to + 1;;
- $pos = $constants->REALLY_BIG_NUMBER() - $from + 1;
- $sense_strand = 0;
- }
-
- if ($from == $to) {
- print STDERR "Error reading EufindtRNA results: ",
- "tRNA of length 0";
- }
-
- if (!$self->merge_repeat_hit($stats, $r_hit_list, \$trnact, $from, $to,
- $sense_strand, $iso_type, $score)) {
-
- # insert non-redundant hit in order
- # 'Merge_repeat_hits' depends on list being in order
-
- $i=0;
- while (($i < scalar(@$r_hit_list)) && ($r_hit_list->[$i]{position} < $pos)) {
- $i++;
- }
-
- splice(@$r_hit_list, $i, 0, {
- seqname => $seq_name,
- start => $from, end => $to,
- type => $iso_type, acodon => $anticodon,
- istart => 0, iend => 0,
- sen_strand => $sense_strand,
- position => $pos, score => $score,
- source => $self->{eufind_mask}
- });
-
- $trnact++;
- $stats->increment_trnatotal();
-
- }
- }
- }
-}
-
-# check current hit for redundancy against all previous hits in hitlist
-#
-# if it IS a repeat, merge it with overlapping hit and return 1
-# if it doesn't overlap with any hits, return 0
-
-sub merge_repeat_hit {
-
- my $self = shift;
- my $stats = shift;
- my ($r_hit_list, $r_trnact, $from, $to, $sense_strand, $iso_type, $score) = @_;
- my ($i);
-
- foreach $i (0..(scalar(@$r_hit_list) - 1)) {
-
- if ($sense_strand) {
- if (($r_hit_list->[$i]{sen_strand} == 1) &&
- (&seg_overlap($from, $to, $r_hit_list->[$i]{start}, $r_hit_list->[$i]{end})))
- {
- $r_hit_list->[$i]{start} = &min($from, $r_hit_list->[$i]{start});
- $r_hit_list->[$i]{end} = &max($to, $r_hit_list->[$i]{end});
- $r_hit_list->[$i]{source} = $r_hit_list->[$i]{source} | $self->{eufind_mask};
- $r_hit_list->[$i]{type} = $iso_type;
- $r_hit_list->[$i]{score} = $score;
-
- # check to see if extended endpoint overlaps
- # i+1 hit's start boundary
- # if so, combine hit[i] and hit[i+1] into one
- # hit and delete hit[i+1]
- if (($i != (scalar(@$r_hit_list) - 1)) && ($r_hit_list->[$i+1]{sen_strand})
- && ($r_hit_list->[$i]{end} >= $r_hit_list->[$i+1]{start}))
- {
- $r_hit_list->[$i]{end} = &max($r_hit_list->[$i]{end}, $r_hit_list->[$i+1]{end});
- $r_hit_list->[$i]{source} = $r_hit_list->[$i]{source} | $r_hit_list->[$i+1]{source};
-
- splice(@$r_hit_list,$i+1,1); # toss out overlapping hit
- $$r_trnact--;
- $stats->decrement_trnatotal();
- }
- return 1; # exit loop immediately
- }
- }
- else # else (antisense) strand
- {
- if (($r_hit_list->[$i]{sen_strand} == 0) &&
- (&seg_overlap($to,$from,$r_hit_list->[$i]{end}, $r_hit_list->[$i]{start})))
- {
- $r_hit_list->[$i]{start} = &max($from, $r_hit_list->[$i]{start});
- $r_hit_list->[$i]{end} = &min($to, $r_hit_list->[$i]{end});
- $r_hit_list->[$i]{source} = $r_hit_list->[$i]{source} | $self->{eufind_mask};
- $r_hit_list->[$i]{type} = $iso_type;
- $r_hit_list->[$i]{score} = $score;
-
- if (($i != (scalar(@$r_hit_list) - 1)) &&
- ($r_hit_list->[$i]{end} <= $r_hit_list->[$i+1]{start}))
- {
- $r_hit_list->[$i]{end} = &min($r_hit_list->[$i]{end}, $r_hit_list->[$i+1]{end});
- $r_hit_list->[$i]{source} = $r_hit_list->[$i]{source} | $r_hit_list->[$i+1]{source};
-
- splice(@$r_hit_list,$i+1,1); # toss out overlapping hit
- $$r_trnact--;
- $stats->decrement_trnatotal();
- }
- return 1; # exit loop immediately
- }
- } # else (antisense) strand
-
- } # for each (hit)
-
- return 0; # current hit is not a repeat
-}
-1;
diff --git a/tRNAscanSE/GeneticCode.pm b/tRNAscanSE/GeneticCode.pm
deleted file mode 100644
index 4ae1106..0000000
--- a/tRNAscanSE/GeneticCode.pm
+++ /dev/null
@@ -1,291 +0,0 @@
-# tRNAscanSE/GeneticCode.pm
-# This class describes the genetic codes used in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-# --------------------------------------------------------------
-#
-
-package tRNAscanSE::GeneticCode;
-
-use strict;
-use tRNAscanSE::Utils;
-
-sub new {
- my $class = shift;
- my $self = {};
-
- initialize($self);
-
- bless ($self, $class);
- return $self;
-}
-
-sub DESTROY {
- my $self = shift;
-}
-
-sub initialize {
- my $self = shift;
-
- $self->{undef_anticodon} = "???";
- $self->{undef_isotype} = "Undet";
-
- my @isotypes = ('Ala', 'Gly', 'Pro', 'Thr', 'Val',
- 'Ser', 'Arg', 'Leu',
- 'Phe','Asn', 'Lys', 'Asp', 'Glu', 'His', 'Gln',
- 'Ile', 'Met', 'Tyr', 'Supres', 'Cys', 'Trp', 'SelCys');
- $self->{isotypes} = \@isotypes;
-
- # Amino acid -> Anti-codon list for printing out global tRNA summary
-
- my %ac_list = (
- 'Ala' => [qw/AGC GGC CGC TGC/],
- 'Gly' => [qw/ACC GCC CCC TCC/],
- 'Pro' => [qw/AGG GGG CGG TGG/],
- 'Thr' => [qw/AGT GGT CGT TGT/],
- 'Val' => [qw/AAC GAC CAC TAC/],
-
- 'Ser' => [qw/AGA GGA CGA TGA ACT GCT/],
- 'Arg' => [qw/ACG GCG CCG TCG CCT TCT/],
- 'Leu' => [qw/AAG GAG CAG TAG CAA TAA/],
-
- 'Phe' => [qw/AAA GAA     /],
-
- 'Asn' => [qw/ATT GTT     /],
- 'Lys' => [qw/    CTT TTT/],
-
- 'Asp' => [qw/ATC GTC     /],
- 'Glu' => [qw/    CTC TTC/],
-
- 'His' => [qw/ATG GTG     /],
- 'Gln' => [qw/    CTG TTG/],
-
- 'Tyr' => [qw/ATA GTA     /],
- 'Supres' => [qw/    CTA TTA/],
-
- 'Ile' => [qw/AAT GAT   TAT/],
- 'Met' => [qw/    CAT  /],
-
- 'Cys' => [qw/ACA GCA     /],
- 'Trp' => [qw/    CCA  /],
- 'SelCys' => [qw/      TCA/]
- );
- $self->{ac_list} = \%ac_list;
-
- $self->{trans_map} = +{};
- $self->{one_let_trans_map} = +{};
-}
-
-sub undef_anticodon
-{
- my $self = shift;
- return $self->{undef_anticodon};
-}
-
-sub undef_isotype
-{
- my $self = shift;
- return $self->{undef_isotype};
-}
-
-sub isotypes
-{
- my $self = shift;
- return $self->{isotypes};
-}
-
-sub ac_list
-{
- my $self = shift;
- return $self->{ac_list};
-}
-
-sub one_let_trans_map
-{
- my $self = shift;
- return $self->{one_let_trans_map};
-}
-
-sub read_transl_table {
-
- my $self = shift;
- my $opts = shift;
- my $alt_gcode = $opts->alt_gcode();
- my $gc_file = $opts->gc_file();
-
- my %ambig_trans_map = ();
- my %alt_trans_map = ();
- my ($acodon, @expanded_set, $expanded_ac, $gc_file_path);
-
- # Read in default genetic code table (may contain ambiguous bases) at
- # end of this source file
-
- while (<DATA>) {
- if ((/^[^\#]/) &&
- (/^([ACGTUNRYSWMKBDHV]{3,3})\s+(\S+)\s+(\S)/i)) {
- $acodon = uc($1);
- $ambig_trans_map{&rev_comp_seq($acodon)} = $2;
- $self->{one_let_trans_map}->{$2} = $3;
- }
- }
-
- $self->{one_let_trans_map}->{$self->{undef_isotype}} = "?";
- $self->{one_let_trans_map}->{"SeC(p)"} = "Z";
- $self->{one_let_trans_map}->{"SeC(e)"} = "Z";
-
- # Convert any ambiguous bases to make all non-ambigous codons
- # and save translated amino acid
-
- @expanded_set = ();
- foreach $acodon (sort keys(%ambig_trans_map)) {
- push(@expanded_set, &expand_ambig($acodon));
- foreach $expanded_ac (@expanded_set) {
- $self->{trans_map}->{$expanded_ac} = $ambig_trans_map{$acodon};
- }
- @expanded_set = ();
- }
-
- if ($alt_gcode) {
-
- if (-r $gc_file) {
- $gc_file_path = $gc_file;
- }
- elsif (-r "/usr/local/lib/tRNAscanSE/".$gc_file) {
- $gc_file_path = "/usr/local/lib/tRNAscanSE/".$gc_file;
- }
- else {
- die "FATAL: Could not find $gc_file translation codon file\n\n";
- }
-
- open (GC_TABLE, "$gc_file_path") ||
- die "FATAL: Could not find $gc_file translation codon file\n\n";
-
- # Read in genetic code table (may contain ambiguous bases)
-
- while (<GC_TABLE>) {
- if ((/^[^\#]/)
- && (/^([ACGTUNRYSWMKBDHV]{3,3})\s+(\S+)\s+(\S)/i)) {
- $acodon = uc($1);
- $alt_trans_map{&rev_comp_seq($acodon)} = $2;
- $self->{one_let_trans_map}->{$2} = $3;
- }
- }
- close GC_TABLE;
-
- # Convert any ambiguous bases to make all non-ambigous codons
- # and save translated amino acid
-
- @expanded_set = ();
- foreach $acodon (sort keys(%alt_trans_map)) {
- push(@expanded_set, &expand_ambig($acodon));
- foreach $expanded_ac (@expanded_set) {
- $self->{trans_map}->{$expanded_ac} = $alt_trans_map{$acodon};
- }
- @expanded_set = ();
- }
- }
-}
-
-sub get_tRNA_type {
-
- my $self = shift;
- my $cm = shift;
- my $ac = shift; # anticodon to be decoded
- my $cm_file = shift;
-
- my $Pselc_cm_file_path = $cm->Pselc_cm_file_path();
- my $Eselc_cm_file_path = $cm->Eselc_cm_file_path();
-
- my ($prev_type,$type);
-
- if ($ac eq $self->{undef_anticodon}) {
- return $self->{undef_isotype};
- }
- elsif ($cm_file eq $Pselc_cm_file_path) {
- return 'SeC(p)';
- }
- elsif ($cm_file eq $Eselc_cm_file_path) {
- return 'SeC(e)';
- }
- else {
- $prev_type = 'INIT';
- foreach my $exp_codon (&expand_ambig($ac)) {
- $type = $self->{trans_map}->{$exp_codon};
- if (($type ne $prev_type) && ($prev_type ne 'INIT')) {
- return $self->{undef_isotype};
- }
- $prev_type = $type;
- }
- return $type;
- }
-}
-
-sub expand_ambig {
-
- my ($ac) = @_;
-
- $ac = " ".$ac." ";
-
- while (index($ac, 'N') != -1) {
- $ac =~ s/(.*)\s(\S*)N(\S*)\s(.*)/$1 $2A$3 $2C$3 $2G$3 $2T$3 $4/g;
- }
- &expand2(\$ac, 'Y', 'C', 'T'); &expand2(\$ac, 'R', 'A', 'G');
- &expand2(\$ac, 'W', 'A', 'T'); &expand2(\$ac, 'S', 'C', 'G');
- &expand2(\$ac, 'M', 'A', 'C'); &expand2(\$ac, 'K', 'G', 'T');
-
- &expand3(\$ac, 'V', 'A', 'C', 'G'); &expand3(\$ac, 'B', 'C', 'G', 'T');
- &expand3(\$ac, 'H', 'A', 'C', 'T'); &expand3(\$ac, 'D', 'A', 'G', 'T');
-
- $ac = substr($ac, 1);
- return (split(/ /, $ac));
-}
-
-sub expand2 {
-
- my ($acodon, $ambig_base, $sub1, $sub2) = @_;
-
- while (index($$acodon, $ambig_base) != -1) {
- $$acodon =~ s/(.*)\s(\S*)$ambig_base(\S*)\s(.*)/$1 $2$sub1$3 $2$sub2$3 $4/g;
- }
-}
-
-sub expand3 {
-
- my($acodon, $ambig_base, $sub1, $sub2, $sub3) = @_;
-
- while (index($$acodon, $ambig_base) != -1) {
- $$acodon =~ s/(.*)\s(\S*)$ambig_base(\S*)\s(.*)/$1 $2$sub1$3 $2$sub2$3 $2$sub3$3 $4/g;
- }
-}
-
-1;
-
-__DATA__
-GCN Ala A
-TGY Cys C
-GAY Asp D
-GAR Glu E
-TTY Phe F
-GGN Gly G
-CAY His H
-ATH Ile I
-AAR Lys K
-TTR Leu L
-CTN Leu L
-ATG Met M
-AAY Asn N
-CCN Pro P
-CAR Gln Q
-AGR Arg R
-CGN Arg R
-AGY Ser S
-TCN Ser S
-ACN Thr T
-GTN Val V
-TGG Trp W
-TAY Tyr Y
-TAR Sup ?
-TGA SeC Z
-
diff --git a/tRNAscanSE/LogFile.pm b/tRNAscanSE/LogFile.pm
deleted file mode 100644
index 098c4e8..0000000
--- a/tRNAscanSE/LogFile.pm
+++ /dev/null
@@ -1,87 +0,0 @@
-# tRNAscanSE/LogFile.pm
-# This class defines the log file used in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-# --------------------------------------------------------------
-#
-
-package tRNAscanSE::LogFile;
-
-use strict;
-use tRNAscanSE::Utils;
-
-sub new {
- my $class = shift;
- my $self = {};
-
- initialize($self);
-
- bless ($self, $class);
- return $self;
-}
-
-sub DESTROY
-{
- my $self = shift;
-}
-
-sub initialize
-{
- my $self = shift;
- $self->{file_name} = ""; # name of log file
- $self->{FILE_H} = undef; # file handle
-}
-
-sub file_name
-{
- my $self = shift;
- if (@_) { $self->{file_name} = shift; }
- return $self->{file_name};
-}
-
-sub open_file
-{
- my $self = shift;
- my $file = shift;
-
- my $success = 0;
-
- if (($file eq "-") || ($file eq "/dev/null"))
- {
- $success = open($self->{FILE_H}, ">$file");
- $self->{file_name} = $file;
- }
- else
- {
- &open_for_write(\$self->{FILE_H}, $file);
- select($self->{FILE_H});
- $|=1;
- $self->{file_name} = $file;
- $success = 1;
- }
- return $success;
-}
-
-sub close_file
-{
- my $self = shift;
-
- if (defined $self->{FILE_H})
- {
- close($self->{FILE_H});
- }
-}
-
-sub write_line
-{
- my $self = shift;
- my $line = shift;
-
- my $fh = $self->{FILE_H};
-
- print $fh $line . "\n";
-}
-
-1;
diff --git a/tRNAscanSE/Options.pm b/tRNAscanSE/Options.pm
deleted file mode 100644
index ddaec8b..0000000
--- a/tRNAscanSE/Options.pm
+++ /dev/null
@@ -1,668 +0,0 @@
-# tRNAscanSE/Options.pm
-# This class defines options used in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-# --------------------------------------------------------------
-#
-
-package tRNAscanSE::Options;
-
-use strict;
-use tRNAscanSE::Utils;
-
-sub new {
- my $class = shift;
- my $self = {};
-
- initialize($self);
-
- bless ($self, $class);
- return $self;
-}
-
-sub DESTROY
-{
- my $self = shift;
-}
-
-sub initialize
-{
- my $self = shift;
- $self->{fafile} = "";
- $self->{fasta_file} = ""; # input sequence file
- $self->{multiple_files} = 0; # multiple input sequence files
- $self->{out_file} = "-"; # output result file -- send to
- # stdout ("-") by default
-
- $self->{results_to_stdout} = 1; # send results to stdout by default
-
- $self->{ace_output} = 0; # output in ACeDB format if non-zero
- $self->{brief_output} = 0; # don't print tabular output column headers
- # if non-zero
- $self->{quiet_mode} = 0; # don't print credits & selected run options
- # if non-zero
- $self->{display_progress} = 0; # print program progress info if non-zero
- $self->{save_progress} = 0; # save progress to log file if non-zero
- $self->{log_file} = ""; # name of log file
-
- $self->{seq_key} = ""; # require seq names to match this key
- $self->{raw_seq_key} = ""; # unmodified user-input key
- $self->{start_at_key} = 0; # read all seqs after finding seqname=KEY?
-
- $self->{tscan_mode} = 1; # run tRNAscan if non-zero
- $self->{eufind_mode} = 1; # run eufindtRNA (pavesi) if non-zero
- $self->{strict_params} = 1; # use original strict tRNAscan params
- # if non-zero
-
- $self->{CM_mode} = "cove"; # run covariance model search
- # cove - run Cove if non-zero
- # infernal - run Infernal if non-zero
- # run Infernal by default
-
- $self->{second_pass_label} = "Cove"; # Second scan pass label: Cove by default
-
- $self->{search_mode} = ""; # tRNA search mode when running Cove or cmsearch
- # bacteria - run covariance model for bacteria if set
- # archaea - run archaea cov model if set
- # general - run general cov models (combines tRNAs from all 3 domains)
-
- $self->{org_mode} = 0; # run in organellar mode
- # run eukaryotic model by default
-
- $self->{alt_gcode} = 0; # use alternate genetic translation table
- # file if non-zero
- $self->{gc_file} = ""; # alternate transl table file
-
- $self->{save_stats} = 0; # save statistics for search
- $self->{stats_file} = "";
-
- $self->{save_odd_struct} = 0; # save structures for which Cove
- # was unable to determine anticodon
- $self->{odd_struct_file} = "";
-
- $self->{save_all_struct} = 0; # save secondary structures if nonzero
- $self->{all_struct_file} = ""; # sec struct file, set with -f option
-
- $self->{split_fragment_file} = ""; # split fragment file, set with --split option
-
- $self->{save_verbose} = 0; # save verbose output from tRNAscan
- $self->{verb_file} = "";
-
- $self->{save_firstpass_res} = 0; # save tabular tRNAscan results
- $self->{firstpass_result_file} = "";
-
- $self->{use_prev_ts_run} = 0; # specify result file from previous
- # tRNA search for Cove-confirmation
-
- $self->{default_Padding} = 8;
- $self->{padding} = $self->{default_Padding}; # pad both ends of first-pass hits with this
- # many extra bases before passing to Cove
-
- $self->{save_falsepos} = 0; # save false positive tRNAs in
- # fasta file
- $self->{falsepos_file} = "";
-
- $self->{save_missed} = 0; # save seqs without a hit
- $self->{missed_seq_file} = "";
-
- $self->{save_source} = 0; # save source of first-pass hit
-
- $self->{output_codon} = 0; # output tRNA codon instead of anticodon
- # (off by default)
-
-# $self->{use_orig_cm} = 0; # use original covariance model that
-# # contains tRNAS from all three domains
-
- $self->{def_max_int_len} = 200; # default MAX intron+variable loop region size
- # used in EufindtRNA
-
- $self->{max_int_len} = $self->{def_max_int_len};
-
- $self->{prompt_for_overwrite} = 1; # prompt user before overwriting a pre-existing
- # output file, disabled with -Q option
-}
-
-sub fafile
-{
- my $self = shift;
- if (@_) { $self->{fafile} = shift; }
- return $self->{fafile};
-}
-
-sub fasta_file
-{
- my $self = shift;
- if (@_) { $self->{fasta_file} = shift; }
- return $self->{fasta_file};
-}
-
-sub multiple_files
-{
- my $self = shift;
- if (@_) { $self->{multiple_files} = shift; }
- return $self->{multiple_files};
-}
-
-sub out_file
-{
- my $self = shift;
- if (@_) { $self->{out_file} = shift; }
- return $self->{out_file};
-}
-
-sub results_to_stdout
-{
- my $self = shift;
- if (@_) { $self->{results_to_stdout} = shift; }
- return $self->{results_to_stdout};
-}
-
-sub ace_output
-{
- my $self = shift;
- if (@_) { $self->{ace_output} = shift; }
- return $self->{ace_output};
-}
-
-sub brief_output
-{
- my $self = shift;
- if (@_) { $self->{brief_output} = shift; }
- return $self->{brief_output};
-}
-
-sub quiet_mode
-{
- my $self = shift;
- if (@_) { $self->{quiet_mode} = shift; }
- return $self->{quiet_mode};
-}
-
-sub display_progress
-{
- my $self = shift;
- if (@_) { $self->{display_progress} = shift; }
- return $self->{display_progress};
-}
-
-sub save_progress
-{
- my $self = shift;
- if (@_) { $self->{save_progress} = shift; }
- return $self->{save_progress};
-}
-
-sub log_file
-{
- my $self = shift;
- if (@_) { $self->{log_file} = shift; }
- return $self->{log_file};
-}
-
-sub seq_key
-{
- my $self = shift;
- if (@_) { $self->{seq_key} = shift; }
- return $self->{seq_key};
-}
-
-sub raw_seq_key
-{
- my $self = shift;
- if (@_) { $self->{raw_seq_key} = shift; }
- return $self->{raw_seq_key};
-}
-
-sub start_at_key
-{
- my $self = shift;
- if (@_) { $self->{start_at_key} = shift; }
- return $self->{start_at_key};
-}
-
-sub tscan_mode
-{
- my $self = shift;
- if (@_) { $self->{tscan_mode} = shift; }
- return $self->{tscan_mode};
-}
-
-sub eufind_mode
-{
- my $self = shift;
- if (@_) { $self->{eufind_mode} = shift; }
- return $self->{eufind_mode};
-}
-
-sub strict_params
-{
- my $self = shift;
- if (@_) { $self->{strict_params} = shift; }
- return $self->{strict_params};
-}
-
-sub CM_mode
-{
- my $self = shift;
- if (@_) { $self->{CM_mode} = shift; }
- return $self->{CM_mode};
-}
-
-sub cove_mode
-{
- my $self = shift;
- return ($self->{CM_mode} eq 'cove');
-}
-
-sub infernal_mode
-{
- my $self = shift;
- return ($self->{CM_mode} eq 'infernal');
-}
-
-sub second_pass_label
-{
- my $self = shift;
- if (@_) { $self->{second_pass_label} = shift; }
- return $self->{second_pass_label};
-}
-
-sub search_mode
-{
- my $self = shift;
- if (@_) { $self->{search_mode} = shift; }
- return $self->{search_mode};
-}
-
-sub bact_mode
-{
- my $self = shift;
- return ($self->{search_mode} eq 'bacteria');
-}
-
-sub arch_mode
-{
- my $self = shift;
- return ($self->{search_mode} eq 'archaea');
-}
-
-sub general_mode
-{
- my $self = shift;
- return ($self->{search_mode} eq 'general');
-}
-
-sub org_mode
-{
- my $self = shift;
- if (@_) { $self->{org_mode} = shift; }
- return $self->{org_mode};
-}
-
-sub alt_gcode
-{
- my $self = shift;
- if (@_) { $self->{alt_gcode} = shift; }
- return $self->{alt_gcode};
-}
-
-sub gc_file
-{
- my $self = shift;
- if (@_) { $self->{gc_file} = shift; }
- return $self->{gc_file};
-}
-
-sub save_stats
-{
- my $self = shift;
- if (@_) { $self->{save_stats} = shift; }
- return $self->{save_stats};
-}
-
-sub stats_file
-{
- my $self = shift;
- if (@_) { $self->{stats_file} = shift; }
- return $self->{stats_file};
-}
-
-sub save_odd_struct
-{
- my $self = shift;
- if (@_) { $self->{save_odd_struct} = shift; }
- return $self->{save_odd_struct};
-}
-
-sub odd_struct_file
-{
- my $self = shift;
- if (@_) { $self->{odd_struct_file} = shift; }
- return $self->{odd_struct_file};
-}
-
-sub save_all_struct
-{
- my $self = shift;
- if (@_) { $self->{save_all_struct} = shift; }
- return $self->{save_all_struct};
-}
-
-sub all_struct_file
-{
- my $self = shift;
- if (@_) { $self->{all_struct_file} = shift; }
- return $self->{all_struct_file};
-}
-
-sub split_fragment_file
-{
- my $self = shift;
- if (@_) { $self->{split_fragment_file} = shift; }
- return $self->{split_fragment_file};
-}
-
-sub save_verbose
-{
- my $self = shift;
- if (@_) { $self->{save_verbose} = shift; }
- return $self->{save_verbose};
-}
-
-sub verb_file
-{
- my $self = shift;
- if (@_) { $self->{verb_file} = shift; }
- return $self->{verb_file};
-}
-
-sub save_firstpass_res
-{
- my $self = shift;
- if (@_) { $self->{save_firstpass_res} = shift; }
- return $self->{save_firstpass_res};
-}
-
-sub firstpass_result_file
-{
- my $self = shift;
- if (@_) { $self->{firstpass_result_file} = shift; }
- return $self->{firstpass_result_file};
-}
-
-sub use_prev_ts_run
-{
- my $self = shift;
- if (@_) { $self->{use_prev_ts_run} = shift; }
- return $self->{use_prev_ts_run};
-}
-
-sub default_Padding
-{
- my $self = shift;
- if (@_) { $self->{default_Padding} = shift; }
- return $self->{default_Padding};
-}
-
-sub padding
-{
- my $self = shift;
- if (@_) { $self->{padding} = shift; }
- return $self->{padding};
-}
-
-sub save_falsepos
-{
- my $self = shift;
- if (@_) { $self->{save_falsepos} = shift; }
- return $self->{save_falsepos};
-}
-
-sub falsepos_file
-{
- my $self = shift;
- if (@_) { $self->{falsepos_file} = shift; }
- return $self->{falsepos_file};
-}
-
-sub save_missed
-{
- my $self = shift;
- if (@_) { $self->{save_missed} = shift; }
- return $self->{save_missed};
-}
-
-sub missed_seq_file
-{
- my $self = shift;
- if (@_) { $self->{missed_seq_file} = shift; }
- return $self->{missed_seq_file};
-}
-
-sub save_source
-{
- my $self = shift;
- if (@_) { $self->{save_source} = shift; }
- return $self->{save_source};
-}
-
-sub output_codon
-{
- my $self = shift;
- if (@_) { $self->{output_codon} = shift; }
- return $self->{output_codon};
-}
-
-sub def_max_int_len
-{
- my $self = shift;
- if (@_) { $self->{def_max_int_len} = shift; }
- return $self->{def_max_int_len};
-}
-
-sub max_int_len
-{
- my $self = shift;
- if (@_) { $self->{max_int_len} = shift; }
- return $self->{max_int_len};
-}
-
-sub prompt_for_overwrite
-{
- my $self = shift;
- if (@_) { $self->{prompt_for_overwrite} = shift; }
- return $self->{prompt_for_overwrite};
-}
-
-sub temp_dir
-{
- my $self = shift;
- if (@_) { $self->{temp_dir} = shift; }
- return $self->{temp_dir};
-}
-
-sub display_run_options {
-
- my $self = shift;
- my $cm = shift;
- my $tscan = shift;
- my $eufind = shift;
- my ($FHAND) = shift;
-
- print $FHAND ('-' x 60,"\n",
- "Sequence file(s) to search: ",join(', ', at ARGV),"\n");
- if ($self->{seq_key} ne '\S*') {
- if ($self->{start_at_key}) {
- print $FHAND "Starting at sequence name: $self->{raw_seq_key}\n" }
- else {
- print $FHAND "Search only names matching: $self->{raw_seq_key}\n" }
- }
-
- print $FHAND "Search Mode: ";
- if ($self->bact_mode()) {
- print $FHAND "Bacterial\n";
- }
- elsif ($self->arch_mode()) {
- print $FHAND "Archaeal\n";
- }
- elsif ($self->{org_mode}) {
- print $FHAND "Organellar\n";
- }
- elsif ($self->general_mode()) {
- print $FHAND "General\n";
- }
- else {
- print $FHAND "Eukaryotic\n";
- }
-
- print $FHAND "Results written to: ",
- &print_filename($self->{out_file}),"\n";
-
- print $FHAND "Output format: ";
- if ($self->{ace_output}) {
- print $FHAND "ACeDB\n"; }
- else {
- print $FHAND "Tabular\n"; }
-
- print $FHAND "Searching with: ";
- if ($self->{eufind_mode}) {
- if ($self->{tscan_mode}) {
- if ($self->{CM_mode} =~ /infernal|cove/) {
- print $FHAND "tRNAscan + EufindtRNA -> $self->{second_pass_label}\n"; }
- else {
- print $FHAND "tRNAscan + EufindtRNA (no $self->{second_pass_label})\n"; }
- }
- elsif ($self->{CM_mode} =~ /infernal|cove/) {
- print $FHAND "EufindtRNA->$self->{second_pass_label}\n"; }
- else {
- print $FHAND "EufindtRNA only\n"; }
- }
- elsif ($self->{tscan_mode}) {
- if ($self->{CM_mode} =~ /infernal|cove/) {
- print $FHAND "tRNAscan->$self->{second_pass_label}\n"; }
- else {
- print $FHAND "tRNAscan only\n"; }
- }
- else {
- print $FHAND "$self->{second_pass_label} only\n";
- }
-
- if ($cm->CM_check_for_introns()) {
- print $FHAND "Scan for noncanonical introns\n";
- }
- if ($cm->CM_check_for_split_halves()) {
- print $FHAND "Scan for fragments of split tRNAs\n";
- }
-
- if ($cm->alt_cm_file() eq '') {
- print $FHAND "Covariance model: ".$cm->main_cm_file()."\n";
- }
- else {
- print $FHAND "Use alt. covariance model: ".$cm->alt_cm_file()."\n";
- }
-
- if ($cm->cm_cutoff() != 20.0) {
- print $FHAND "tRNA Cove cutoff score: ".$cm->cm_cutoff()."\n";
- }
-
- if ($self->{use_prev_ts_run}) {
- print $FHAND "Using previous\n",
- "tabular output file: $self->{firstpass_result_file}\n";
- }
-
- if ($tscan->tscan_version() != 1.4) {
- print $FHAND "Alternate tRNAscan version: ".$tscan->tscan_version()."\n";
- }
-
- if ($self->{tscan_mode}) {
- print $FHAND "tRNAscan parameters: ";
- if ($self->{strict_params}) {
- print $FHAND "Strict\n"; }
- else {
- print $FHAND "Relaxed\n"; }
- }
-
- if ($self->{eufind_mode}) {
- print $FHAND "EufindtRNA parameters: ";
- if ($eufind->eufind_params() eq "-r") {
- print $FHAND "Relaxed (Int Cutoff= ".$eufind->eufind_intscore().")\n"; }
- elsif ($eufind->eufind_params() eq "") {
- print $FHAND "Normal\n"; }
- elsif ($eufind->eufind_params() eq "-s") {
- print $FHAND "Strict\n"; }
- else {
- print $FHAND "?\n"; }
- }
-
- if ($self->{padding} != $self->{default_Padding}) {
- print $FHAND "First-pass tRNA hit padding: $self->{padding} bp\n";
- }
-
- if ($self->{alt_gcode}) {
- print $FHAND "Alternate transl code used: ",
- "from file $self->{gc_file}\n";
- }
-
- if ($self->{save_all_struct}) {
- print $FHAND "tRNA secondary structure\n",
- " predictions saved to: ";
- if ($self->{all_struct_file} eq "-") {
- print $FHAND "Standard output\n";
- }
- else {
- print $FHAND "$self->{all_struct_file}\n";
- }
- }
- if ($self->{split_fragment_file} ne "") {
- print $FHAND "split tRNA fragment\n",
- " predictions saved to: ";
- if ($self->{split_fragment_file} eq "-") {
- print $FHAND "Standard output\n";
- }
- else {
- print $FHAND "$self->{split_fragment_file}\n";
- }
- }
- if ($self->{save_odd_struct}) {
- print $FHAND "Sec structures for tRNAs\n",
- " with no anticodon predictn: $self->{odd_struct_file}\n";
- }
- if ($self->{save_firstpass_res}) {
- print $FHAND "First-pass results saved i: ",
- "$self->{firstpass_result_file}\n";
- }
- if ($self-{save_progress}) {
- print $FHAND "Search log saved in: $self->{log_file}\n";
- }
- if ($self->{save_stats}) {
- print $FHAND "Search statistics saved in: $self->{stats_file}\n";
- }
- if ($self->{save_falsepos}) {
- print $FHAND "False positives saved in: $self->{falsepos_file}\n";
- }
- if ($self->{save_missed}) {
- print $FHAND "Seqs with 0 hits saved in: $self->{missed_seq_file}\n";
- }
- if ($cm->skip_pseudo_filter() | $cm->get_hmm_score() | $tscan->keep_tscan_repeats()) {
- print $FHAND "\n";
- }
- if ($self->{max_int_len} != $self->{def_max_int_len}) {
- print $FHAND "Max intron + var. length: $self->{max_int_len}\n";
- }
- if ($cm->skip_pseudo_filter()) {
- print $FHAND "Pseudogene checking disabled\n";
- }
- if ($cm->get_hmm_score()) {
- print $FHAND "Reporting HMM/2' structure score breakdown\n";
- }
- if ($tscan->keep_tscan_repeats()) {
- print $FHAND "Redundant tRNAscan hits not merged\n";
- }
-
- print $FHAND ('-' x 60,"\n\n");
-}
-
-1;
-
diff --git a/tRNAscanSE/SS.pm b/tRNAscanSE/SS.pm
deleted file mode 100644
index 00159e9..0000000
--- a/tRNAscanSE/SS.pm
+++ /dev/null
@@ -1,197 +0,0 @@
-# tRNAscanSE/SS.pm
-# This class contains parameters and functions for secondary structure parsing used in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia P. Chan & Todd M. Lowe
-# --------------------------------------------------------------
-#
-
-package tRNAscanSE::SS;
-
-use strict;
-use tRNAscanSE::Utils;
-
-require Exporter;
-our @ISA = qw(Exporter);
-our @EXPORT = qw(valid_structure get_acceptor_half);
-
-sub valid_structure {
-
- my ($ss, $canonical_intron_len) = @_;
- my $stem_index = 0;
-
- my %valid = ();
- $valid{tRNA} = 1;
- $valid{acceptor} = 1;
- $valid{darm} = 1;
- $valid{anticodon} = 1;
- $valid{variable} = 1;
- $valid{tstem} = 1;
-
- my $total_mismatches = 0;
-
- my ($r_stems, $r_mismatches) = &get_stems($ss);
-
- for ($stem_index = 0; $stem_index < scalar(@$r_mismatches); $stem_index++) {
- $total_mismatches += $r_mismatches->[$stem_index];
- }
- if (($total_mismatches > 1) || (scalar(@$r_stems) < 4) || (scalar(@$r_stems) > 5)) {
- $valid{tRNA} = 0;
- }
-
- if (scalar(@$r_stems) == 5) {
- $valid{acceptor} = 0 if (($r_mismatches->[0] > 1) || (&get_stem_length($r_stems->[0]) != 7));
- $valid{darm} = 0 if (($r_mismatches->[1] > 1) || (&get_stem_length($r_stems->[1]) < 3));
- $valid{anticodon} = 0 if (($r_mismatches->[2] > 1) || (&get_stem_length($r_stems->[2]) != 5));
- $valid{variable} = 0 if (($r_mismatches->[3] > 1) || (&get_stem_length($r_stems->[3]) < 2));
- $valid{tstem} = 0 if (($r_mismatches->[4] > 1) || (&get_stem_length($r_stems->[4]) != 5));
- $valid{tRNA} = $valid{acceptor} && $valid{darm} && $valid{anticodon} && $valid{variable} &&
- $valid{tstem} && (length($ss) - $canonical_intron_len <= 90);
- }
- elsif (scalar(@$r_stems) == 4) {
- $valid{variable} = 0;
- $valid{acceptor} = 0 if (($r_mismatches->[0] > 1) || (&get_stem_length($r_stems->[0]) != 7));
- $valid{darm} = 0 if (($r_mismatches->[1] > 1) || (&get_stem_length($r_stems->[1]) < 3));
- $valid{anticodon} = 0 if (($r_mismatches->[2] > 1) || (&get_stem_length($r_stems->[2]) != 5));
- $valid{tstem} = 0 if (($r_mismatches->[3] > 1) || (&get_stem_length($r_stems->[3]) != 5));
- $valid{tRNA} = $valid{acceptor} && $valid{darm} && $valid{anticodon} && $valid{tstem} && (length($ss) - $canonical_intron_len <= 80);
- }
- elsif (scalar(@$r_stems) == 3) {
- $valid{variable} = 0;
- $valid{acceptor} = 0 if (($r_mismatches->[0] > 1) || (&get_stem_length($r_stems->[0]) != 7));
- if ($r_mismatches->[1] == 0) {
- $valid{darm} = 0 if (($r_mismatches->[1] > 1) || (&get_stem_length($r_stems->[1]) < 3));
- $valid{anticodon} = 0 if (($r_mismatches->[2] > 1) || (&get_stem_length($r_stems->[2]) != 5));
- $valid{tstem} = 0;
- }
- elsif ($r_mismatches->[2] == 0) {
- $valid{darm} = 0;
- $valid{anticodon} = 0 if (($r_mismatches->[1] > 1) || (&get_stem_length($r_stems->[1]) != 5));
- $valid{tstem} = 0 if (($r_mismatches->[2] > 1) || (&get_stem_length($r_stems->[2]) != 5));
- }
- else {
- $valid{acceptor} = 0;
- $valid{darm} = 0;
- $valid{anticodon} = 0;
- $valid{variable} = 0;
- $valid{tstem} = 0;
- }
- }
- else {
- $valid{acceptor} = 0;
- $valid{darm} = 0;
- $valid{anticodon} = 0;
- $valid{variable} = 0;
- $valid{tstem} = 0;
- }
-
- return \%valid;
-}
-
-sub get_stem_length {
- my ($r_stem) = @_;
-
- return ($r_stem->{end_left} - $r_stem->{start_left} + 1);
-}
-
-sub get_stems {
-
- my ($ss) = @_;
- my %pairs = ();
- my @left = ();
- my @right = ();
- my @stems = ();
- my @mismatches = ();
- my $left_index = -1;
- my $right_index = -1;
-
- my $last_right_index = -1;
- my $start_left_index = -1;
- my $end_left_index = -1;
- my $start_right_index = -1;
- my $end_right_index = -1;
-
- for (my $pos = 0; $pos < length($ss); $pos++) {
- if (substr($ss, $pos, 1) eq ">") {
- push(@left, $pos);
- $pairs{$#left} = -1;
- }
- elsif (substr($ss, $pos, 1) eq "<") {
- push(@right, $pos);
- $left_index = scalar(@left) - 1;
- while (($pairs{$left_index} > -1) && ($left_index > -1)) {
- $left_index--;
- }
- if (($left_index > -1) && ($pairs{$left_index} == -1)) {
- $pairs{$left_index} = scalar(@right) - 1;
- }
- }
- }
-
- foreach $left_index (sort { $a <=> $b } keys %pairs) {
- if ($last_right_index == -1) {
- $start_left_index = $left_index;
- $end_right_index = $pairs{$left_index};
- }
- elsif ($pairs{$left_index} != ($last_right_index - 1)) {
- $end_left_index = $left_index - 1;
- $start_right_index = $last_right_index;
- push(@stems, {start_left=>$left[$start_left_index], end_left=>$left[$end_left_index],
- start_right=>$right[$start_right_index], end_right=>$right[$end_right_index]});
- $start_left_index = $left_index;
- $end_right_index = $pairs{$left_index};
- }
- $last_right_index = $pairs{$left_index};
- }
- if ($last_right_index > -1) {
- $end_left_index = $left_index - 1;
- $start_right_index = $last_right_index;
- push(@stems, {start_left=>$left[$start_left_index], end_left=>$left[$end_left_index],
- start_right=>$right[$start_right_index], end_right=>$right[$end_right_index]});
- }
-
- # find mismatches in stems
- for (my $ct = 0; $ct < scalar(@stems); $ct++) {
- $mismatches[$ct] = 0;
- $left_index = $stems[$ct]->{end_left};
- $right_index = $stems[$ct]->{start_right};
- while ($left_index >= $stems[$ct]->{start_left} && $right_index <= $stems[$ct]->{end_right}) {
- if (substr($ss, $left_index, 1) eq ".") {
- if (substr($ss, $right_index, 1) eq ".") {
- $mismatches[$ct] += 1;
- $right_index++;
- }
- $left_index--;
- }
- elsif (substr($ss, $right_index, 1) eq ".") {
- $right_index++;
- }
- else {
- $left_index--;
- $right_index++;
- }
- }
- }
-
- return (\@stems, \@mismatches);
-}
-
-sub get_acceptor_half {
- my ($seq, $ss, $half) = @_;
-
- if ($half eq "5h") {
- return substr($seq, 0, 7);
- }
- elsif ($half eq "3h") {
- if (substr($ss, length($ss) - 12) eq "<...........") {
- return substr($seq, length($seq) - 11, 7);
- }
- else {
- return substr($seq, length($seq) - 8, 7);
- }
- }
- else {
- return "";
- }
-}
\ No newline at end of file
diff --git a/tRNAscanSE/ScanResult.pm b/tRNAscanSE/ScanResult.pm
deleted file mode 100644
index 753703a..0000000
--- a/tRNAscanSE/ScanResult.pm
+++ /dev/null
@@ -1,657 +0,0 @@
-# tRNAscanSE/ScanResult.pm
-# This class describes the outputs of scan results used in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-# --------------------------------------------------------------
-#
-
-package tRNAscanSE::ScanResult;
-
-use strict;
-use tRNAscanSE::Utils;
-use tRNAscanSE::Sequence;
-
-require Exporter;
-our @ISA = qw(Exporter);
-our @EXPORT = qw(init_fp_result_file save_Acedb_from_firstpass save_firstpass_output
- prep_for_secpass_only parse_tabular_output write_tRNA output_tRNA output_split_fragments);
-
-our $printed_header = 0; # keeps track of whether or
- # or not results column header
- # has been printed yet
-our ($max_seq_name_width, $max_seq_len_width);
-
-sub init_fp_result_file {
-
- my ($file) = @_;
-
- &open_for_append(\*FILE_H, $file);
-
- print FILE_H "Sequence\t\ttRNA Bounds\ttRNA\tAnti\t\n";
- print FILE_H "Name \ttRNA #\tBegin\tEnd\tType\tCodon\t",
- "SeqID\tSeqLen\tScore\n";
- print FILE_H "--------\t------\t-----\t---\t----\t-----\t",
- "-----\t------\t-----\n";
-
- close(FILE_H);
-}
-
-sub save_Acedb_from_firstpass {
-
- my ($output_codon, $r_one_let_trans_map, $r_hit_list, $out_file) = @_;
- my($i, $triplet);
-
- &open_for_append(\*FILE_H, $out_file);
-
- foreach $i (0..(scalar(@$r_hit_list) - 1)) {
- printf FILE_H "Sequence\t%s\nSubsequence\t%s.t%d %d %d\n\n",
- $r_hit_list->[$i]{seqname}, $r_hit_list->[$i]{seqname},
- $i + 1, $r_hit_list->[$i]{start}, $r_hit_list->[$i]{end};
-
- printf FILE_H "Sequence\t%s.t%d\nSource\t\t%s\n",
- $r_hit_list->[$i]{seqname}, $i + 1, $r_hit_list->[$i]{seqname};
- if ($r_hit_list->[$i]{istart} > 0) {
- if ($r_hit_list->[$i]{istart} < $r_hit_list->[$i]{iend}) {
- printf FILE_H "Source_Exons\t1 %d\n",
- $r_hit_list->[$i]{istart} - $r_hit_list->[$i]{start};
- printf FILE_H "Source_Exons\t%d %d\n",
- $r_hit_list->[$i]{iend} - $r_hit_list->[$i]{start} + 2,
- $r_hit_list->[$i]{end} - $r_hit_list->[$i]{start} + 1; }
- else {
- printf FILE_H "Source_Exons\t1 %d\n",
- $r_hit_list->[$i]{start} - $r_hit_list->[$i]{istart} + 1;
- printf FILE_H "Source_Exons\t%d %d\n",
- $r_hit_list->[$i]{start} - $r_hit_list->[$i]{iend} + 2,
- $r_hit_list->[$i]{start} - $r_hit_list->[$i]{end} + 1; }
- }
- printf FILE_H "Brief_identification tRNA-%s\n", $r_hit_list->[$i]{type};
-
- # either output Codon or Anticodon for tRNA
- $triplet = uc($r_hit_list->[$i]{acodon});
- if ($output_codon) {
- $triplet = &rev_comp_seq($triplet);
- }
-
- printf FILE_H "Transcript tRNA \"%s %s %s\"\n\n",
- $triplet, $r_hit_list->[$i]{type}, $r_one_let_trans_map->{$r_hit_list->[$i]{type}};
-
- }
- close(FILE_H);
-}
-
-sub print_results_header {
-
- my ($opts, $get_hmm_score, $seq_name_width, $seq_len_width) = @_;
- my ($label, $codon_label) = "";
-
- if ($opts->cove_mode()) {
- $label = "\tCove";
- }
- elsif ($opts->infernal_mode()) {
- $label = "\tCM";
- }
- elsif ($opts->eufind_mode() && !$opts->tscan_mode()) {
- $label = "\tEufind";
- }
-
- if ($opts->output_codon()) {
- $codon_label = " ";
- }
- else {
- $codon_label = "Anti";
- }
-
- if (!($opts->ace_output())) {
- &open_for_append(\*OUTFILE, $opts->out_file());
-
- printf OUTFILE "%-".$seq_name_width."s\t\t","Sequence";
- printf OUTFILE "%-".$seq_len_width."s\t","tRNA";
- printf OUTFILE "%-".$seq_len_width."s\t","Bounds";
- print OUTFILE "tRNA\t$codon_label\tIntron Bounds",$label;
-
- if ($get_hmm_score) {
- print OUTFILE "\tHMM\t2'Str";
- }
- if ($opts->save_source()) {
- print OUTFILE "\tHit";
- }
- if ($opts->search_mode() eq "archaea") {
- print OUTFILE "\tIntron";
- }
- print OUTFILE "\n";
-
- printf OUTFILE "%-".$seq_name_width."s\t","Name";
- print OUTFILE "tRNA \#\t";
- printf OUTFILE "%-".$seq_len_width."s\t","Begin";
- printf OUTFILE "%-".$seq_len_width."s\t","End";
-
- print OUTFILE "Type\tCodon\tBegin\tEnd\tScore";
-
- if ($get_hmm_score) {
- print OUTFILE "\tScore\tScore";
- }
- if ($opts->save_source()) {
- print OUTFILE "\tOrigin";
- }
- if ($opts->search_mode() eq "archaea") {
- print OUTFILE "\tCount";
- }
- print OUTFILE "\n";
-
- printf OUTFILE "%-".$seq_name_width."s\t","--------";
- print OUTFILE "------\t";
- printf OUTFILE "%-".$seq_len_width."s\t","----";
- printf OUTFILE "%-".$seq_len_width."s\t","------";
- print OUTFILE "----\t-----\t-----\t----\t------";
-
- if ($get_hmm_score) {
- print OUTFILE "\t-----\t-----";
- }
- if ($opts->save_source()) {
- print OUTFILE "\t------";
- }
- if ($opts->search_mode() eq "archaea") {
- print OUTFILE "\t----------";
- }
- print OUTFILE "\n";
- }
- close OUTFILE;
-}
-
-sub save_firstpass_output {
-
- my ($opts, $r_hit_list, $r_source_tab, $r_fpass_trna_base_ct, $seq_len, $seq_id) = @_;
- my ($i, $triplet);
-
- if (!$opts->CM_mode()) {
- if (!($opts->brief_output() || $printed_header)) {
- &print_results_header($opts, 0, 20, 20);
- $printed_header = 1;
- }
- &open_for_append(\*TAB_RESULTS, $opts->out_file());
- }
- else {
- &open_for_append(\*TAB_RESULTS, $opts->firstpass_result_file());
- }
-
- foreach $i (0..(scalar(@$r_hit_list) - 1)) {
-
- $triplet = uc($r_hit_list->[$i]{acodon});
- if ($opts->output_codon()) {
- $triplet = &rev_comp_seq($triplet);
- }
-
- printf TAB_RESULTS "%-10s\t%d\t%d\t%d\t%s\t%s\t",
- $r_hit_list->[$i]{seqname}, $i + 1,
- $r_hit_list->[$i]{start}, $r_hit_list->[$i]{end},
- $r_hit_list->[$i]{type}, $triplet;
-
- # save intron bounds if not doing Cove analysis
-
- if (!$opts->CM_mode()) {
- printf TAB_RESULTS "%d\t%d\t%.2f", $r_hit_list->[$i]{istart},
- $r_hit_list->[$i]{iend}, $r_hit_list->[$i]{score};
- }
-
- # save seq id number and source seq length if needed for Cove analysis
-
- else {
- printf TAB_RESULTS "%d\t%d\t%.2f", $seq_id, $seq_len, $r_hit_list->[$i]{score};
- }
-
- if ($opts->save_source()) {
- print TAB_RESULTS " ", $r_source_tab->[$r_hit_list->[$i]{source}];
- }
- print TAB_RESULTS "\n";
-
- $$r_fpass_trna_base_ct += abs($r_hit_list->[$i]{end} - $r_hit_list->[$i]{start}) + 1;
- }
- close TAB_RESULTS;
-}
-
-# Create dummy first-pass result file with all sequences
-sub prep_for_secpass_only {
-
- my ($opts, $stats, $seq_file) = @_;
- my ($saved_line, $targ_seq_id);
-
- $seq_file->open_file($opts->fasta_file(), "read");
-
- &open_for_append(\*RESFILE, $opts->firstpass_result_file());
- $saved_line = '';
- $targ_seq_id = 0; # Don't look for a specific Seq number
-
- while ($seq_file->read_fasta($opts, $targ_seq_id)) {
- print (RESFILE $seq_file->seq_name()."\t1\t1\t".$seq_file->seq_length()."\t???\t???\t".$seq_file->seq_id()."\t".$seq_file->seq_length()." C\n");
- print (RESFILE $seq_file->seq_name()."\t2\t".$seq_file->seq_length()."\t1\t???\t???\t".$seq_file->seq_id()."\t".$seq_file->seq_length()." C\n");
-
- $stats->increment_numscanned();
- }
- close RESFILE;
- $seq_file->close_file();
-}
-
-# read first pass result file one input sequence at a time,
-# putting results in array @prescan_tRNAs
-
-sub parse_tabular_output {
-
- my ($opts, $r_prescan_tRNAs, $r_seqinfo_flag) = @_;
- my $firstpass_result_file = $opts->firstpass_result_file();
- my $padding = $opts->padding();
-
- my ($seq_name, $trnact, $trnaName,
- $ts_start, $ts_end, $ts_len, $sense_strand,
- $ts_seq_id, $ts_seq_len, $score, $ts_type, $ts_anticodon,
- $hit_source);
-
- # open first-pass tabular result file
- open (FIRSTPASS_TRNAS, "$firstpass_result_file") ||
- die "FATAL: Can't open first-pass tRNA output file $firstpass_result_file\n\n" ;
-
- while (<FIRSTPASS_TRNAS>)
- {
- if (/Type\tCodon\tSeqID\tSeqLen/) {
- # Column header present if we record seqID's and lengths
- $$r_seqinfo_flag = 1;
- }
- elsif (/^(\S+)\s+(\d+)\s+(\d+)\s+(\d+)\s+(\S+)\s+(\S+)\s+(\d+)\s+(\d+)\s+(\S+)/o)
- {
- $seq_name = $1;
- $trnact = $2;
- $trnaName = $seq_name.".t".$trnact;
- $ts_start = $3; # trna subseq absolute start index
- $ts_end = $4; # trna subseq absolute end index
- $ts_type = $5;
- $ts_anticodon = $6;
- $ts_seq_id = $7;
- $ts_seq_len = $8;
- $score = $9;
- $hit_source = $';
- $hit_source =~ s/[\s\t\n]//g;
-
- # if seqinfo_flag not set, file does not have SeqID info in
- # 7th column of output, don't mistake number read for SeqID
-
- if (!$$r_seqinfo_flag) {
- $ts_seq_id = 0;
- }
-
- if ($ts_end > $ts_start)
- {
- $sense_strand = 1; # flag for forward or reverse strand
-
- # pad ends of sequence only if EufindtRNA is being used
- # and $seqinfo_flag is set (we know the seq lengths)
-
- if ($opts->eufind_mode() && $$r_seqinfo_flag)
- {
- $ts_start = &max(1, $ts_start - $padding);
- $ts_end = &min($ts_seq_len, $ts_end + $padding);
- }
- $ts_len = $ts_end - $ts_start + 1;
- }
- else {
- $sense_strand = 0;
- if ($opts->eufind_mode() && $$r_seqinfo_flag) {
- $ts_start = &min($ts_seq_len, $ts_start + $padding);
- $ts_end = &max(1, $ts_end - $padding);
- }
- $ts_len = $ts_start - $ts_end + 1;
- }
-
- if ($ts_end == $ts_start) {
- print STDERR "Error reading $firstpass_result_file: tRNA of length 0";
- }
-
- push(@$r_prescan_tRNAs,
- {seq => "", name => $trnaName,
- start => $ts_start, end => $ts_end, len => $ts_len,
- isotype => $ts_type, acodon => $ts_anticodon, score => $score,
- src_seqname => $seq_name, src_seqlen => $ts_seq_len,
- src_seqid => $ts_seq_id, strand => $sense_strand,
- hit_source => $hit_source});
-
- } # while <FIRSTPASS_TRNAS> not at eof
- }
-
- close FIRSTPASS_TRNAS;
-}
-
-sub write_tRNA {
-
- my ($file_name, $seq_name, $seq_desc, $seq, $overwrite) = @_;
-
- my $trna_file = tRNAscanSE::Sequence->new;
- my $write_mode = "append";
- if ($overwrite) {
- $write_mode = "write";
- }
- $trna_file->set_seq_info($seq_name, $seq_desc, length($seq), $seq);
- $trna_file->open_file($file_name, $write_mode);
- $trna_file->write_fasta();
- $trna_file->close_file();
-}
-
-# Write final tRNA prediction to various selected output sources/files
-# Sets globals $MaxSeqNameWidth and $MaxSeqLenWidth and $printed_header
-
-sub output_tRNA {
-
- my ($opts, $gc, $log, $r_tab_results, $get_hmm_score, $program_id,
- $r_fp_tRNA_info, # first pass scanner tRNA info
- $r_tRNA_info, # final tRNA info
- $curseq_trnact) = @_;
-
- my $results_line = "";
-
- if (!$opts->results_to_stdout()) {
- $log->write_line("$r_tRNA_info->{ID}: ".$opts->second_pass_label()." type= $r_tRNA_info->{isotype}\t ".
- "First-pass scan ($r_fp_tRNA_info->{hit_source}) type= $r_fp_tRNA_info->{isotype}\t".
- "Score= $r_tRNA_info->{score}");
- }
- if ($opts->save_all_struct()) {
- &save_allStruct_output($opts, $gc, $get_hmm_score, $r_tRNA_info, $curseq_trnact);
- }
-
- # Create tabular results line, ready for output
-
- if (!$printed_header) {
- $max_seq_name_width = &max(length($r_fp_tRNA_info->{src_seqname}) + 1, 8);
- $max_seq_len_width = length($r_fp_tRNA_info->{src_seqlen});
- }
-
- $results_line = &construct_tab_output($opts, $get_hmm_score, $r_tRNA_info, $curseq_trnact, $max_seq_name_width, $max_seq_len_width);
-
- # Internal copy of results saved for later uses
- push(@$r_tab_results, $results_line);
-
- if ($opts->ace_output()) {
- &save_Acedb_from_secpass($opts, $gc, $r_tRNA_info, $program_id);
- }
- else
- {
- if (!($opts->brief_output() || $printed_header)) {
- &print_results_header($opts, $get_hmm_score, $max_seq_name_width, $max_seq_len_width);
- $printed_header = 1;
- }
- &open_for_append(\*TABOUT, $opts->out_file());
- print TABOUT $results_line;
- close TABOUT;
- }
-}
-
-sub save_allStruct_output {
-
- my ($opts, $gc, $get_hmm_score, $r_tRNA_info, $curseq_trnact) = @_;
-
- my $ruler = ' * |' x 20; # ruler printed out with
- # secondary structure output
-
- my $seqlen = length($r_tRNA_info->{seq});
-
- &open_for_append(\*SECSTRUCT, $opts->all_struct_file());
-
- print SECSTRUCT "$r_tRNA_info->{seqname}.trna$curseq_trnact ($r_tRNA_info->{start}-$r_tRNA_info->{end})\t",
- "Length: $seqlen bp\nType: $r_tRNA_info->{isotype}\t";
-
- if ($opts->output_codon()) {
- print SECSTRUCT "Codon: ", &rev_comp_seq($r_tRNA_info->{acodon}), " at ";
- }
- else {
- print SECSTRUCT "Anticodon: $r_tRNA_info->{acodon} at ";
- }
-
- if ($r_tRNA_info->{acodon} eq $gc->undef_anticodon()) {
- print SECSTRUCT "0-0 (0-0)\t";
- }
- else {
- print SECSTRUCT "$r_tRNA_info->{acodon_pos}-", $r_tRNA_info->{acodon_pos} + 2;
- if (!$opts->arch_mode()) {
- if ($r_tRNA_info->{strand}) {
- print SECSTRUCT " (", $r_tRNA_info->{acodon_pos} + $r_tRNA_info->{start} - 1, "-",
- $r_tRNA_info->{acodon_pos} + $r_tRNA_info->{start} + 1,")\t";
- }
- else {
- print SECSTRUCT " (", $r_tRNA_info->{start} - $r_tRNA_info->{acodon_pos} + 1, "-",
- $r_tRNA_info->{start} - $r_tRNA_info->{acodon_pos} - 1,")\t";
- }
- }
- else {
- print SECSTRUCT " (", $r_tRNA_info->{acodon_pos}, "-", $r_tRNA_info->{acodon_pos} + 2,")\t";
- }
- }
-
- print SECSTRUCT "Score: $r_tRNA_info->{score}\n";
- if (scalar(@{$r_tRNA_info->{introns}}) > 0) {
-
- foreach my $intron (@{$r_tRNA_info->{introns}}) {
- if (defined $intron) {
- if ($intron->{seq} ne "") {
- print SECSTRUCT "Possible intron: $intron->{start}-$intron->{end} ";
- if ($r_tRNA_info->{strand}) {
- print SECSTRUCT "(", $intron->{start} + $r_tRNA_info->{start} - 1, "-",
- $intron->{end} + $r_tRNA_info->{start} - 1,")\n";
- }
- else {
- print SECSTRUCT "(", $r_tRNA_info->{start} - $intron->{start} + 1, "-",
- $r_tRNA_info->{start} - $intron->{end} + 1,")\n";
- }
- }
- }
- }
- }
-
- if ($r_tRNA_info->{is_pseudo}) {
- printf SECSTRUCT
- "Possible pseudogene: HMM Sc=%.2f\tSec struct Sc=%.2f\n",
- $r_tRNA_info->{hmm_score}, $r_tRNA_info->{ss_score};
- }
- elsif ($get_hmm_score) {
- printf SECSTRUCT
- "HMM Sc=%.2f\tSec struct Sc=%.2f\n", $r_tRNA_info->{hmm_score}, $r_tRNA_info->{ss_score};
- }
-
- print SECSTRUCT " ",substr($ruler, 0, $seqlen - 1),"\n";
- print SECSTRUCT "Seq: $r_tRNA_info->{seq}\nStr: $r_tRNA_info->{ss}\n";
- if (defined $r_tRNA_info->{precursor}) {
- foreach my $intron (@{$r_tRNA_info->{introns}}) {
- if (defined $intron) {
- my $intron_seq = uc($intron->{seq});
- if ($intron_seq ne "") {
- $r_tRNA_info->{precursor} =~ s/$intron_seq/\[$intron_seq\]/;
- }
- }
- }
- print SECSTRUCT "Pre: ". uc($r_tRNA_info->{precursor}) ."\n\n";
- }
- else {
- print SECSTRUCT "\n";
- }
- close(SECSTRUCT);
-}
-
-# Save tRNA hits in Tabular output
-
-sub construct_tab_output {
-
- my ($opts, $get_hmm_score, $r_tRNA_info, $curseq_trnact, $max_seq_name_width, $max_seq_len_width) = @_;
-
- my ($result_line, $tRNA_type);
-
- if ($r_tRNA_info->{is_pseudo}) {
- $tRNA_type = "Pseudo";
- }
- else {
- $tRNA_type = $r_tRNA_info->{isotype};
- }
-
- $result_line = sprintf "%-".$max_seq_name_width."s\t", $r_tRNA_info->{seqname};
- $result_line .= "$curseq_trnact\t";
-
- $result_line .= sprintf "%-".$max_seq_len_width."d\t", $r_tRNA_info->{start};
- $result_line .= sprintf "%-".$max_seq_len_width."d\t", $r_tRNA_info->{end};
-
- $result_line .= "$tRNA_type\t";
-
- if ($opts->output_codon()) {
- $result_line .= (&rev_comp_seq($r_tRNA_info->{acodon}))."\t";
- }
- else {
- $result_line .= "$r_tRNA_info->{acodon}\t";
- }
-
- if (scalar(@{$r_tRNA_info->{introns}}) == 0) {
- $result_line .= "0\t0";
- }
- else {
- my $intron_ct = 0;
- for (my $i = 0; $i < scalar(@{$r_tRNA_info->{introns}}); $i++) {
- if (defined $r_tRNA_info->{introns}->[$i]) {
- if ($r_tRNA_info->{introns}->[$i]->{seq} ne "") {
- if ($intron_ct > 0) {
- $result_line .= ",";
- }
- if ($r_tRNA_info->{strand}) {
- $result_line .= ($r_tRNA_info->{introns}->[$i]->{start} + $r_tRNA_info->{start}-1);
- }
- else {
- $result_line .= ($r_tRNA_info->{start} - $r_tRNA_info->{introns}->[$i]->{start}+1);
- }
- $intron_ct++;
- }
- }
- }
- $result_line .= "\t";
- $intron_ct = 0;
- for (my $i = 0; $i < scalar(@{$r_tRNA_info->{introns}}); $i++) {
- if (defined $r_tRNA_info->{introns}->[$i]) {
- if ($r_tRNA_info->{introns}->[$i]->{seq} ne "") {
- if ($intron_ct > 0) {
- $result_line .= ",";
- }
- if ($r_tRNA_info->{strand}) {
- $result_line .= ($r_tRNA_info->{introns}->[$i]->{end} + $r_tRNA_info->{start} - 1);
- }
- else {
- $result_line .= ($r_tRNA_info->{start} - $r_tRNA_info->{introns}->[$i]->{end} + 1);
- }
- $intron_ct++;
- }
- }
- }
- }
- $result_line .= "\t$r_tRNA_info->{score}";
-
- if ($get_hmm_score) {
- $result_line .= sprintf "\t%.2f\t%.2f", $r_tRNA_info->{hmm_score}, $r_tRNA_info->{ss_score};
- }
- if ($opts->save_source()) {
- $result_line .= "\t$r_tRNA_info->{hit_source}";
- }
- if ($opts->search_mode() eq "archaea") {
- if (scalar(@{$r_tRNA_info->{introns}}) == 0) {
- $result_line .= "\t";
- }
- else {
- my $ci_count = 0;
- my $nci_count = 0;
- for (my $i = 0; $i < scalar(@{$r_tRNA_info->{introns}}); $i++) {
- if ($r_tRNA_info->{introns}->[$i]->{type} eq "CI") {
- $ci_count++;
- }
- elsif ($r_tRNA_info->{introns}->[$i]->{type} eq "NCI") {
- $nci_count++;
- }
- }
- $result_line .= "\t";
- if ($ci_count > 0) {
- $result_line .= $ci_count . " CI";
- }
- if (($ci_count > 0) && ($nci_count > 0)) {
- $result_line .= " ";
- }
- if ($nci_count > 0) {
- $result_line .= $nci_count . " NCI";
- }
- }
- }
- $result_line .= "\n";
-
- return $result_line;
-}
-
-sub Save_Acedb_from_secpass {
-
- my ($opts, $gc, $r_tRNA_info, $program_id) = @_;
-
- &open_for_append(\*ACEOUT, $opts->out_file());
-
- print ACEOUT "Sequence\t$r_tRNA_info->{seqname}\nSubsequence\t$r_tRNA_info->{ID} $r_tRNA_info->{start} $r_tRNA_info->{end}\n\n";
- print ACEOUT "Sequence\t$r_tRNA_info->{ID}\nSource\t\t$r_tRNA_info->{seqname}\n";
- if ($r_tRNA_info->{iseq}) {
- print ACEOUT "Source_Exons\t1 ", $r_tRNA_info->{istart} - 1,"\n";
- print ACEOUT "Source_Exons\t", $r_tRNA_info->{iend} + 1," ", abs($r_tRNA_info->{end} - $r_tRNA_info->{start}) + 1,"\n";
- }
- print ACEOUT "Brief_identification tRNA-$r_tRNA_info->{isotype}\n",
- "Transcript tRNA \"";
-
- if ($opts->output_codon()) {
- print ACEOUT &rev_comp_seq($r_tRNA_info->{acodon});
- }
- else {
- print ACEOUT $r_tRNA_info->{acodon};
- }
-
- print ACEOUT " $r_tRNA_info->{isotype} ", $gc->one_let_trans_map()->{$r_tRNA_info->{isotype}},
- "\"\nScore $program_id $r_tRNA_info->{score}\n";
-
- if ($r_tRNA_info->{is_pseudo}) {
- printf ACEOUT "Remark \"Likely pseudogene (HMM Sc=%.2f / Sec struct Sc=%.2f)\"\n",
- $r_tRNA_info->{hmm_score},$r_tRNA_info->{ss_score};
- }
- print ACEOUT "\n";
- close ACEOUT;
-}
-
-sub output_split_fragments {
-
- my ($opts, $r_pairs, $r_5half_hits, $r_3half_hits) = @_;
-
- my ($r_5half, $r_3half);
-
- &open_for_append(\*SPLITFILE, $opts->split_fragment_file());
- printf SPLITFILE "Fragment1\tFragment2\tSeqName1\tStartPos1\tEndPos1\tSeqName2\tStartPos2\tEndPos2\tScore1\tScore2\n";
-
- foreach my $r_pair (@$r_pairs) {
- if (defined $r_pair->{"5h"} && defined $r_pair->{"3h"}) {
- $r_5half = $r_5half_hits->[$r_pair->{"5h"}];
- $r_3half = $r_3half_hits->[$r_pair->{"3h"}];
- print SPLITFILE $r_5half->{seq}."\t".$r_3half->{seq}."\t",
- $r_5half->{hit_seqname}."\t".$r_5half->{tRNA_start}."\t".$r_5half->{tRNA_end}."\t",
- $r_3half->{hit_seqname}."\t".$r_3half->{tRNA_start}."\t".$r_3half->{tRNA_end}."\t",
- $r_5half->{score}."\t".$r_3half->{score}."\n";
- print SPLITFILE $r_5half->{ss}."\t".$r_3half->{ss}."\t\t\t\t\t\t\t\t\n";
- }
- elsif (defined $r_pair->{"5h"} && !defined $r_pair->{"3h"}) {
- $r_5half = $r_5half_hits->[$r_pair->{"5h"}];
- print SPLITFILE $r_5half->{seq}."\t\t",
- $r_5half->{hit_seqname}."\t".$r_5half->{tRNA_start}."\t".$r_5half->{tRNA_end}."\t",
- "\t\t\t",
- $r_5half->{score}."\t\n";
- print SPLITFILE $r_5half->{ss}."\t\t\t\t\t\t\t\t\t\n";
- }
- elsif (!defined $r_pair->{"5h"} && defined $r_pair->{"3h"}) {
- $r_3half = $r_3half_hits->[$r_pair->{"3h"}];
- print SPLITFILE "\t".$r_3half->{seq}."\t",
- "\t\t\t",
- $r_3half->{hit_seqname}."\t".$r_3half->{tRNA_start}."\t".$r_3half->{tRNA_end}."\t",
- "\t".$r_3half->{score}."\n";
- print SPLITFILE "\t".$r_3half->{ss}."\t\t\t\t\t\t\t\t\n";
- }
- }
-}
-
-1;
diff --git a/tRNAscanSE/Sequence.pm b/tRNAscanSE/Sequence.pm
deleted file mode 100644
index 59e993d..0000000
--- a/tRNAscanSE/Sequence.pm
+++ /dev/null
@@ -1,763 +0,0 @@
-# tRNAscanSE/Sequence.pm
-# This class describes a sequence and provides functions for handling fasta files in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-# --------------------------------------------------------------
-#
-# Perl code for reading FASTA-formatted sequence files
-# SRE, Sat Feb 19 19:10:43 1994
-
-# These subroutines read a FASTA formatted file one sequence at a time.
-# Open(filename, open_mode) opens a file for reading or wrting.
-# Close() closes it when you're done.
-#
-# read_fasta() returns 1 on success and 0 on failure (end of file).
-# When it returns success, the following variables are set:
-#
-# $seq_name = name of sequence (1st word on FASTA title line)
-# $seq_description = description (remainder of FASTA title line)
-# $seq_length = length of sequence
-# $sequence = sequence, gaps and newlines removed
-#
-# Modified by TMJL 11/95 for use in tRNAscan-SE
-
-package tRNAscanSE::Sequence;
-
-use strict;
-use tRNAscanSE::Utils;
-use tRNAscanSE::Constants;
-use tRNAscanSE::Options;
-
-
-sub new {
- my $class = shift;
- my $self = {};
-
- initialize($self);
-
- bless ($self, $class);
- return $self;
-}
-
-sub DESTROY
-{
- my $self = shift;
-}
-
-sub initialize
-{
- my $self = shift;
- $self->{file_name} = ""; # name of log file
- $self->{FILE_H} = undef; # file handle
-
- $self->{max_seq_buffer} = 1000000; # Max size of seq buffer read in at once
- $self->{seq_buf_overlap} = 200; # Nucleotides of overlap between buffers
- $self->{seq_index_inc} = 100000;
-
- $self->{saved_line} = "";
- $self->{buffer_overlap_seq} = "";
- $self->{buffer_end_index} = 0;
- $self->{seq_buf_overrun} = 0;
- $self->{buffer_length} = 0;
- $self->{key_found} = 0;
- $self->{all_seq_indices} = +[]; # Keeps track of indexing into seqs for fast retreival
-
- $self->{seq_id} = 0;
- $self->{seq_name} = "";
- $self->{seq_description} = "";
- $self->{seq_length} = 0;
- $self->{sequence} = undef;
-
- $self->{seq_name_map} = {};
-}
-
-sub file_name
-{
- my $self = shift;
- if (@_) { $self->{file_name} = shift; }
- return $self->{file_name};
-}
-
-sub key_found
-{
- my $self = shift;
- if (@_) { $self->{key_found} = shift; }
- return $self->{key_found};
-}
-
-sub seq_id
-{
- my $self = shift;
- if (@_) { $self->{seq_id} = shift; }
- return $self->{seq_id};
-}
-
-sub seq_name
-{
- my $self = shift;
- if (@_) { $self->{seq_name} = shift; }
- return $self->{seq_name};
-}
-
-sub get_seq_id_from_name
-{
- my $self = shift;
- my $name = shift;
- my $id = -1;
- if (defined $self->{seq_name_map}->{$name})
- {
- $id = $self->{seq_name_map}->{$name};
- }
- return $id;
-}
-
-sub seq_description
-{
- my $self = shift;
- if (@_) { $self->{seq_description} = shift; }
- return $self->{seq_description};
-}
-
-sub seq_length
-{
- my $self = shift;
- if (@_) { $self->{seq_length} = shift; }
- return $self->{seq_length};
-}
-
-sub sequence
-{
- my $self = shift;
- if (@_) { $self->{sequence} = shift; }
- return $self->{sequence};
-}
-
-sub release_memory
-{
- my $self = shift;
- undef($self->{sequence});
-}
-
-sub set_seq_info
-{
- my $self = shift;
- $self->{seq_name} = shift;
- $self->{seq_description} = shift;
- $self->{seq_length} = shift;
- $self->{sequence} = shift;
-}
-
-sub reset_buffer_ct
-{
- my $self = shift;
- $self->{buffer_overlap_seq} = "";
- $self->{buffer_end_index} = 0;
- $self->{seq_buf_overrun} = 0;
-}
-
-sub buffer_end_index
-{
- my $self = shift;
- if (@_) { $self->{buffer_end_index} = shift; }
- return $self->{buffer_end_index};
-}
-
-sub seq_buf_overrun
-{
- my $self = shift;
- if (@_) { $self->{seq_buf_overrun} = shift; }
- return $self->{seq_buf_overrun};
-}
-
-sub seekpos {
- my $self = shift;
- my $pos = shift;
-
- seek($self->{FILE_H}, $pos, 0);
-}
-
-sub open_file
-{
- my $self = shift;
- my $file = shift;
- my $mode = shift;
-
- my $success = 0;
-
- if ($mode eq "read") {
- &open_for_read(\$self->{FILE_H}, $file);
- $self->{seq_id} = 0;
- $self->{saved_line} = "";
- }
- elsif ($mode eq "write") {
- &open_for_write(\$self->{FILE_H}, $file);
- }
- elsif ($mode eq "append") {
- &open_for_append(\$self->{FILE_H}, $file);
- }
- $self->{file_name} = $file;
- $success = 1;
-
- return $success;
-}
-
-sub close_file
-{
- my $self = shift;
-
- if (defined $self->{FILE_H}) {
- close($self->{FILE_H});
- }
-}
-
-# Reads length of sequence first, then pre-extends to total length
-# before reading it in (important optimization for very long sequences)
-# Also, will search for sequence name matching $key
-
-sub read_fasta {
-
- my $self = shift;
- my $opts = shift;
- my $target_seq_id = shift;
- my $key = $opts->seq_key();
- my $fh = $self->{FILE_H};
-
- my ($seqlen, $filepos, $pre_extend_len, $seq_index_step, @seq_index);
-
- $self->{seq_name} = "";
- $self->{seq_description} = "";
- $self->{seq_length} = 0;
- $self->{sequence} = "";
-
-# if $key is not the global $seq_key (non-alphanumerics already
-# escaped out for $seq_key) then escape out '\' problem causing char's
-# if ($key ne $seq_key) {
-# $key =~ s/(\W)/\\$1/g;
-# }
-
- while ((!eof($fh))
- && (($self->{saved_line} =~ /^>/) || ($self->{saved_line} = <$fh>)))
- {
- if (($self->{saved_line} =~ /^>\s*($key)\s+(.*)$/) ||
- ($opts->start_at_key()) && ($self->{key_found}) &&
- ($self->{saved_line} =~ /^>\s*(\S*)\s+(.*)$/o))
- {
- $self->{seq_id}++;
-
- # if searching for a particular SeqID go on to next seq
- # if target and current seqid's don't match
- if ($target_seq_id && ($self->{seq_id} != $target_seq_id)) {
- $self->{saved_line} = <$fh>;
- next;
- }
-
- $self->{key_found} = 1;
- $self->{seq_name} = $1;
- $self->{seq_description} = $2;
- $self->{sequence} = "";
- $self->{seq_name_map}->{$self->{seq_name}} = $self->{seq_id};
-
- @seq_index = ();
- $seq_index_step = $self->{seq_index_inc}; # set first bp position to save
-
- $filepos = tell($fh);
- $seqlen = 0;
- push(@seq_index, $seqlen, tell($fh));
- $pre_extend_len = 0;
-# print LOGFILE "At pos: ";
-
- while ($self->{saved_line} = <$fh>)
- {
- if ($self->{saved_line} =~ /^>/) { last; }
- $self->{saved_line} =~ s/[ \n\t\d]//g; # strip whitespace & numbers
- $seqlen += length($self->{saved_line});
-
- # Save the start position of this chunk of seq for later easy return
- if ($seqlen > $seq_index_step) {
- push(@seq_index, $seqlen, tell($fh));
- $seq_index_step += $self->{seq_index_inc};
-# print LOGFILE "($Seqlen) ";
- }
-
- if (($pre_extend_len == 0) && ($seqlen >= $self->{max_seq_buffer})) {
- $pre_extend_len = $seqlen;
- }
- }
- push(@seq_index, $seqlen, tell($fh));
- $self->{seq_length} = $seqlen;
-# print LOGFILE " ";
-
- $self->{all_seq_indices}->[$self->{seq_id}] = [@seq_index];
-
- seek($fh,$filepos,0);
- $self->{sequence} = 'X' x $pre_extend_len; # pre-extending string for efficiency
- $seqlen = 0;
- while (($seqlen < $self->{max_seq_buffer}) && ($self->{saved_line} = <$fh>))
- {
- if ($self->{saved_line} =~ /^>/) { last; }
- $self->{saved_line} =~ s/[ \n\t\d]//g; # strip whitespace & numbers
- substr($self->{sequence}, $seqlen, length($self->{saved_line})) = $self->{saved_line};
- $seqlen += length($self->{saved_line});
- }
-
- # if sequence is longer than MaxSeqBuffer length,
- # then save last ~200 nt to allow overlap with next buffer frame
- # this prevents tRNAs on the border between buffers from being chopped
- # in half (and missed!)
-
- if ($seqlen >= $self->{max_seq_buffer}) {
- $self->{buffer_overlap_seq} = substr($self->{sequence}, $seqlen - $self->{seq_buf_overlap});
- $self->{buffer_end_index} = $seqlen - length($self->{buffer_overlap_seq});
- $self->{seq_buf_overrun} = 1;
- }
- else {
- $self->{seq_buf_overrun} = 0;
- }
-
- $self->{buffer_length} = length($self->{sequence});
- $self->{sequence} = uc($self->{sequence});
- $self->{sequence} =~ s/U/T/g;
- $self->{sequence} =~ s/X/N/g;
-
- ## Remove long runs of N's from consideration by pre-scanners
- ## By doing this, pre-scanner false-pos rate is normal, even
- ## when scanning unfinished genomes with long N insert "placeholders"
- $self->{sequence} =~ s/NNNNNNNNNN/CCCCCCCCCC/g;
-
- return 1;
- }
- else {
- if ($self->{saved_line} =~ /^>/) {
- $self->{seq_id}++;
- }
- $self->{saved_line} = <$fh>;
- }
- }
- 0;
-}
-
-sub read_fasta_subseq {
-
- my $self = shift;
- my $target_seq_id = shift;
- my $subseq_start = shift;
- my $subseq_len = shift;
- my $fh = $self->{FILE_H};
-
- my ($seqlen, $filepos, $curpos, $tempseq, $seq_head, $index_pos, $ct);
-
- $self->{seq_length} = 0;
- $self->{sequence} = "";
-
- # find closest position in desired sequence from file position index
-
- $ct=0;
- if (!defined $self->{all_seq_indices}->[$target_seq_id]) {
- $seqlen = 0;
- $index_pos = 0;
- }
- else {
- while ($self->{all_seq_indices}->[$target_seq_id][$ct] < $subseq_start) {
- $ct+=2;
- }
- $seqlen = $self->{all_seq_indices}->[$target_seq_id][$ct-2];
- $index_pos = $self->{all_seq_indices}->[$target_seq_id][$ct-1];
- }
- seek ($fh, $index_pos, 0);
-
- $tempseq = "";
-
- # scan until I get to the sequence position
-
- while (($seqlen < $subseq_start) && ($self->{saved_line} = <$fh>))
- {
- if ($self->{saved_line} =~ /^>/) {
- return 0;
- }
- $self->{saved_line} =~ s/[ \n\t\d]//g; # strip whitespace & numbers
- $seqlen += length($self->{saved_line});
- }
-
- $tempseq = 'X' x $subseq_len; # pre-extending string for efficiency
-
- $curpos = $seqlen - length($self->{saved_line});
- $seq_head = substr($self->{saved_line}, $subseq_start - $curpos - 1);
- substr($tempseq, 0, length($seq_head)) = $seq_head;
-
- $seqlen = length($seq_head);
-
- while (($seqlen < $subseq_len) && ($self->{saved_line} = <$fh>))
- {
- if ($self->{saved_line} =~ /^>/) { last; }
- $self->{saved_line} =~ s/[ \n\t\d]//g; # strip whitespace & numbers
- substr($tempseq, $seqlen, length($self->{saved_line})) = $self->{saved_line};
- $seqlen += length($self->{saved_line});
- }
-
- $self->{sequence} = substr($tempseq, 0, $subseq_len);
-
- $self->{sequence} = uc($self->{sequence});
- $self->{sequence} =~ s/U/T/g;
- $self->{sequence} =~ s/X/N/g;
- $self->{seq_length} = length($self->{sequence});
- return 1;
-}
-
-sub read_fasta_subseq_slow {
-
- my $self = shift;
- my $opts = shift;
- my $key = shift;
- my $target_seq_id = shift;
- my $subseq_start = shift;
- my $subseq_len = shift;
- my $fh = $self->{FILE_H};
-
- my ($seqlen, $filepos, $curpos, $tempseq);
- my $last_header = "";
- my $seq_head = "";
-
- $self->{seq_length} = 0;
- $self->{sequence} = "";
-
-# if $key is not the global $seq_key (non-alphanumerics already
-# escaped out for $seq_key) then escape out '\' problem causing char's
-# if ($key ne $seq_key) {
- $key =~ s/(\W)/\\$1/g;
-# }
-
- while ((!eof(FAHANDLE))
- && (($self->{saved_line} =~ /^>/) || ($self->{saved_line} = <FAHANDLE>)))
- {
- if (($self->{saved_line} =~ /^>\s*($key)\s+(.*)$/) ||
- ($opts->start_at_key()) && ($self->{key_found}) &&
- ($self->{saved_line} =~ /^>\s*(\S*)\s+(.*)$/o))
- {
- $self->{seq_id}++;
-
- # if searching for a particular SeqID go on to next seq
- # if target and current seqid's don't match
- if ($target_seq_id && ($self->{seq_id} != $target_seq_id)) {
- $self->{saved_line} = <$fh>;
- next;
- }
-
- $filepos = tell($fh); # save position of last fasta header
- $last_header = $self->{saved_line};
-
- $self->{key_found} = 1;
- $self->{seq_name} = $1;
- $self->{seq_description} = $2;
- $self->{sequence} = "";
- $tempseq = "";
-
- $seqlen = 0;
- while (($seqlen < $subseq_start) && ($self->{saved_line} = <$fh>)) {
- if ($self->{saved_line} =~ /^>/) { last; }
- $self->{saved_line} =~ s/[ \n\t\d]//g; # strip whitespace & numbers
- $seqlen += length($self->{saved_line});
- }
-
- $tempseq = 'X' x $subseq_len; # pre-extending string for efficiency
-
- $curpos = $seqlen - length($self->{saved_line});
- $seq_head = substr($self->{saved_line}, $subseq_start - $curpos - 1);
- substr($tempseq, 0, length($seq_head)) = $seq_head;
-
- $seqlen = length($seq_head);
-
- while (($seqlen < $subseq_len) && ($self->{saved_line} = <$fh>)) {
- if ($self->{saved_line} =~ /^>/) { last; }
- $self->{saved_line} =~ s/[ \n\t\d]//g; # strip whitespace & numbers
- substr($tempseq, $seqlen, length($self->{saved_line})) = $self->{saved_line};
- $seqlen += length($self->{saved_line});
- }
-
- $self->{sequence} = substr($tempseq, 0, $subseq_len);
-
- $self->{sequence} = uc($self->{sequence});
- $self->{sequence} =~ s/U/T/g;
- $self->{sequence} =~ s/X/N/g;
- $self->{seq_length} = length($self->{sequence});
- seek($fh, $filepos, 0); # return file position to beginning of this seq
- $self->{seq_id}--; # rewind seqid by 1
- $self->{saved_line} = $last_header; # restore to original seq header line
- return 1;
- }
- else {
- if ($self->{saved_line} =~ /^>/) {
- $self->{seq_id}++;
- }
- $self->{saved_line} = <$fh>;
- }
- }
- 0;
-}
-
-## read_more_fasta
-## Reads remaining portion of large fasta file (size>$MaxSeqBuffer)
-## Only reads in $MaxSeqBuffer amount or less each time
-
-sub read_more_fasta {
-
- my $self = shift;
- my $fh = $self->{FILE_H};
-
- my ($seqlen, $filepos);
-
- $filepos = tell($fh);
- $seqlen = 0;
- while (($seqlen + $self->{seq_buf_overlap} < $self->{max_seq_buffer}) && ($self->{saved_line} = <$fh>))
- {
- if ($self->{saved_line} =~ /^>/) { last; }
- $self->{saved_line} =~ s/[ \n\t\d]//g; # strip whitespace & numbers
- $seqlen += length($self->{saved_line});
- }
-
- if ($seqlen == 0) {
- return 0;
- }
-
- seek($fh, $filepos, 0);
-
- $self->{sequence} = $self->{buffer_overlap_seq}. 'X' x $seqlen; # pre-extending string for efficiency
- $seqlen = length($self->{buffer_overlap_seq});
-
- while (($seqlen < $self->{max_seq_buffer}) && ($self->{saved_line} = <$fh>))
- {
- if ($self->{saved_line} =~ /^>/) { last; }
- $self->{saved_line} =~ s/[ \n\t\d]//g; # strip whitespace & numbers
- substr($self->{sequence}, $seqlen, length($self->{saved_line})) = $self->{saved_line};
- $seqlen += length($self->{saved_line});
- }
-
- # if sequence is longer than MaxSeqBuffer length,
- # then save last ~200 nt to allow overlap with next buffer frame
- # this prevents tRNAs on the border between buffers from being chopped
- # in half (and missed!)
-
- if ($seqlen >= $self->{max_seq_buffer}) {
- $self->{buffer_overlap_seq} = substr($self->{sequence}, $seqlen - $self->{seq_buf_overlap});
- $self->{buffer_end_index} += $seqlen - length($self->{buffer_overlap_seq});
- $self->{seq_buf_overrun} = 1;
- }
- else {
- $self->{seq_buf_overrun} = 0;
- }
-
- $self->{buffer_length} = length($self->{sequence});
- $self->{sequence} = uc($self->{sequence});
- $self->{sequence} =~ s/U/T/g;
- $self->{sequence} =~ s/X/N/g;
-
- ## Remove long runs of N's from consideration by pre-scanners
- ## By doing this, pre-scanner false-pos rate is normal, even
- ## when scanning unfinished genomes with long N insert "placeholders"
- $self->{sequence} =~ s/NNNNNNNNNN/CCCCCCCCCC/g;
-
- return 1;
-}
-
-sub write_fasta {
-
- my $self = shift;
- my $fh = $self->{FILE_H};
-
- my ($pos, $line);
-
- print $fh ">$self->{seq_name} $self->{seq_description}\n";
- for ($pos = 0; $pos < length($self->{sequence}); $pos += 60)
- {
- $line = substr($self->{sequence}, $pos, 60);
- print $fh $line, "\n";
- }
-}
-
-sub get_tRNA_sequence {
-
- my $self = shift;
- my ($src_seq_name, $strand, $start, $end, $log, $opts, $constants) = @_;
-
- $self->{seq_name} = $src_seq_name;
- $self->{seq_description} = "";
-
- my ($upstream_len, $downstream_len, $src_seq_len, $fwd_start, $query_len, $upstream, $downstream, $tRNA_seq);
- my $src_seqid = $self->get_seq_id_from_name($src_seq_name);
-
- $upstream_len = $constants->upstream_len();
- $downstream_len = $constants->downstream_len();
- if ($strand) {
- if ($start - $upstream_len <= 0) {
- $upstream_len = $start - 1;
- }
- $fwd_start = $start - $upstream_len;
- $src_seq_len = $end - $start + 1;
- }
- else {
- if ($end - $downstream_len <= 0) {
- $downstream_len = $end - 1;
- }
- $fwd_start = $end - $downstream_len;
- $src_seq_len = $start - $end + 1;
- }
- $query_len = $upstream_len + $src_seq_len + $downstream_len;
-
- if (!$self->read_fasta_subseq($src_seqid, $fwd_start, $query_len)) {
-
- # if can't find it on first try, reposition
- # to beginning of file & try once more
-
- $log->write_line("Missed $src_seq_name using quick index. Rewinding seq file and trying again with slow search...");
- $self->seekpos(0);
- if (!$self->read_fasta_subseq_slow($opts, $src_seq_name, $src_seqid, $fwd_start, $query_len)) {
- print STDERR "Could not find $src_seq_name in ".$opts->fastafile()."\n";
- $log->write_line("Skipping to next tRNA hit...");
- return 0;
- }
- }
-
- if ($strand) {
- $downstream_len = $self->{seq_length} - $upstream_len - $src_seq_len;
- $upstream = substr($self->{sequence}, 0, $upstream_len);
- $downstream = "";
- if ($downstream_len > 0) {
- $downstream = substr($self->{sequence}, $upstream_len + $src_seq_len);
- }
- $tRNA_seq = substr($self->{sequence}, $upstream_len, $src_seq_len);
- }
- else {
- $upstream_len = $self->{seq_length} - $downstream_len - $src_seq_len;
- $self->{sequence} = &rev_comp_seq($self->{sequence});
- $upstream = "";
- if ($upstream_len > 0) {
- $upstream = substr($self->{sequence}, 0, $upstream_len);
- }
- $downstream = substr($self->{sequence}, $upstream_len + $src_seq_len);
- $tRNA_seq = substr($self->{sequence}, $upstream_len, $src_seq_len);
- }
- return ($tRNA_seq, $upstream, $downstream);
-}
-
-sub mask_out_sequence {
-
- my $self = shift;
- my ($seq_file, $temp_seq_file, $r_sorted_cms_hits) = @_;
-
- my $cms_hit = undef;
- my $fh_seq_in = undef;
- my $fh_seq_out = undef;
- my $line = "";
- my $last_line = "";
- my $seqname = "";
- my %cms_hits = ();
- my $hits = [];
- my $ct = 0;
- my $written_len = 0;
- my $seq_start = 0;
- my $subseq_start = 0;
- my $subseq_len = 0;
- my $N_start = 0;
-
- foreach $cms_hit (@$r_sorted_cms_hits) {
- if (defined $cms_hits{$cms_hit->{seqname}}) {
- push (@{$cms_hits{$cms_hit->{seqname}}}, $cms_hit);
- }
- else {
- $hits = [];
- push (@$hits, $cms_hit);
- $cms_hits{$cms_hit->{seqname}} = $hits;
- }
- }
-
- &open_for_read(\$fh_seq_in, $seq_file);
- &open_for_write(\$fh_seq_out, $temp_seq_file);
-
- while ($line = <$fh_seq_in>) {
- chomp($line);
- if ($line =~ /^>([^\t]+)$/) {
- $seqname = $1;
- $seqname = &trim($seqname);
- if (index($seqname, ' ') > -1) {
- $seqname = substr($seqname, 0, index($seqname, ' '));
- }
- $hits = undef;
- $ct = 0;
- if (defined $cms_hits{$seqname}) {
- $hits = $cms_hits{$seqname};
- $subseq_len = $hits->[$ct]->{len};
- $seq_start = $hits->[$ct]->{start};
- $seq_start = $hits->[$ct]->{end} if ($hits->[$ct]->{strand} == 0);
- }
- $written_len = 0;
- $N_start = 0;
- if ($last_line ne "") {
- print $fh_seq_out $last_line . "\n";
- $last_line = "";
- }
- print $fh_seq_out $line . "\n";
- }
- elsif ($line =~ /^\s*$/) {
- }
- else {
- if ($last_line ne "") {
- $line = $last_line . $line;
- $last_line = "";
- }
- if (defined $hits) {
- if ($ct < scalar(@$hits)) {
- if ($written_len + length($line) < $seq_start) {
- print $fh_seq_out $line . "\n";
- $written_len += length($line);
- }
- else {
- if ($N_start > 0) {
- $subseq_start = 1;
- }
- else {
- $subseq_start = $seq_start - $written_len;
- print $fh_seq_out substr($line, 0, $subseq_start - 1);
- $written_len += ($subseq_start - 1);
- }
- if (length($line) >= ($subseq_start + $subseq_len - 1)) {
- print $fh_seq_out 'N' x $subseq_len;
- print $fh_seq_out "\n";
- $written_len += $subseq_len;
- if (length($line) > ($subseq_start + $subseq_len - 1)) {
- $last_line = substr($line, $subseq_start + $subseq_len - 1);
- }
- $N_start = 0;
- $ct++;
- if ($ct < scalar(@$hits)) {
- $subseq_len = $hits->[$ct]->{len};
- $seq_start = $hits->[$ct]->{start};
- $seq_start = $hits->[$ct]->{end} if ($hits->[$ct]->{strand} == 0);
- }
- }
- else {
- print $fh_seq_out 'N' x (length($line) - $subseq_start + 1);
- print $fh_seq_out "\n";
- $written_len += (length($line) - $subseq_start + 1);
- $N_start = 1;
- $subseq_len -= (length($line) - $subseq_start + 1);
- }
- }
- }
- else {
- print $fh_seq_out $line . "\n";
- $written_len += length($line);
- }
- }
- else {
- print $fh_seq_out $line . "\n";
- $written_len += length($line);
- }
- }
- }
-
- close($fh_seq_in);
- close($fh_seq_out);
-}
-
-1;
diff --git a/tRNAscanSE/Stats.pm b/tRNAscanSE/Stats.pm
deleted file mode 100644
index bb239bb..0000000
--- a/tRNAscanSE/Stats.pm
+++ /dev/null
@@ -1,430 +0,0 @@
-# tRNAscanSE/Stats.pm
-# This class describes the statistics of each run in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-# --------------------------------------------------------------
-#
-package tRNAscan::Stats;
-
-use strict;
-use tRNAscanSE::Utils;
-use tRNAscanSE::Options;
-use tRNAscanSE::GeneticCode;
-
-sub new {
- my $class = shift;
- my $self = {};
-
- initialize($self);
-
- bless ($self, $class);
- return $self;
-}
-
-sub DESTROY
-{
- my $self = shift;
-}
-
-sub initialize
-{
- my $self = shift;
- $self->{file_name} = ""; # name of log file
- $self->{FILE_H} = undef; # file handle
-
- $self->{fp_start_time} = +[]; # save first pass starting time
- $self->{fp_end_time} = +[]; # save first pass ending time
- $self->{sp_end_time} = +[]; # save second pass ending time
- $self->{seqs_hit} = 0; # num seqs with at least one trna hit
- $self->{numscanned} = 0; # total sequences scanned
- $self->{trnatotal} = 0; # total trnas found by tscan
-
- $self->{first_pass_base_ct} = 0; # no bases in all seqs in first pass scans
- $self->{fpass_trna_base_ct} = 0; # no bases in tRNAs in first pass scans
- $self->{fpos_base_ct} = 0; # no bases in false positive tRNAs
- $self->{secpass_base_ct} = 0;
- $self->{coves_base_ct} = 0;
- $self->{total_secpass_ct} = 0;
-}
-
-sub file_name
-{
- my $self = shift;
- if (@_) { $self->{file_name} = shift; }
- return $self->{file_name};
-}
-
-sub FILE_H
-{
- my $self = shift;
- return $self->{FILE_H};
-}
-
-sub start_fp_timer
-{
- my $self = shift;
- @{$self->{fp_start_time}} = (times)[0,2,1,3];
- $self->{fp_end_time} = +[];
- $self->{sp_end_time} = +[];
-}
-
-sub end_fp_timer
-{
- my $self = shift;
- @{$self->{fp_end_time}} = (times)[0,2,1,3];
-}
-
-sub start_sp_timer
-{
- my $self = shift;
- if (!defined $self->{fp_end_time}->[0]) {
- push (@{$self->{fp_end_time}}, @{$self->{fp_start_time}});
- }
-}
-
-sub end_sp_timer
-{
- my $self = shift;
- @{$self->{sp_end_time}} = (times)[0,2,1,3];
-}
-
-sub seqs_hit
-{
- my $self = shift;
- if (@_) { $self->{seqs_hit} = shift; }
- return $self->{seqs_hit};
-}
-
-sub increment_seqs_hit
-{
- my $self = shift;
- if (@_) { $self->{seqs_hit} += shift; }
- else { $self->{seqs_hit} += 1;}
-}
-
-sub numscanned
-{
- my $self = shift;
- if (@_) { $self->{numscanned} = shift; }
- return $self->{numscanned};
-}
-
-sub increment_numscanned
-{
- my $self = shift;
- if (@_) { $self->{numscanned} += shift; }
- else { $self->{numscanned} += 1;}
-}
-
-sub trnatotal
-{
- my $self = shift;
- if (@_) { $self->{trnatotal} = shift; }
- return $self->{trnatotal};
-}
-
-sub increment_trnatotal
-{
- my $self = shift;
- if (@_) { $self->{trnatotal} += shift; }
- else { $self->{trnatotal} += 1;}
-}
-
-sub decrement_trnatotal
-{
- my $self = shift;
- if (@_) { $self->{trnatotal} -= shift; }
- else { $self->{trnatotal} -= 1;}
-}
-
-sub first_pass_base_ct
-{
- my $self = shift;
- if (@_) { $self->{first_pass_base_ct} = shift; }
- return $self->{first_pass_base_ct};
-}
-
-sub increment_first_pass_base_ct
-{
- my $self = shift;
- if (@_) { $self->{first_pass_base_ct} += shift; }
- else { $self->{first_pass_base_ct} += 1;}
-}
-
-sub fpass_trna_base_ct
-{
- my $self = shift;
- if (@_) { $self->{fpass_trna_base_ct} = shift; }
- return $self->{fpass_trna_base_ct};
-}
-
-sub fpos_base_ct
-{
- my $self = shift;
- if (@_) { $self->{fpos_base_ct} = shift; }
- return $self->{fpos_base_ct};
-}
-
-sub increment_fpos_base_ct
-{
- my $self = shift;
- if (@_) { $self->{fpos_base_ct} += shift; }
- else { $self->{fpos_base_ct} += 1;}
-}
-
-sub secpass_base_ct
-{
- my $self = shift;
- if (@_) { $self->{secpass_base_ct} = shift; }
- return $self->{secpass_base_ct};
-}
-
-sub increment_secpass_base_ct
-{
- my $self = shift;
- if (@_) { $self->{secpass_base_ct} += shift; }
- else { $self->{secpass_base_ct} += 1;}
-}
-
-sub coves_base_ct
-{
- my $self = shift;
- if (@_) { $self->{coves_base_ct} = shift; }
- return $self->{coves_base_ct};
-}
-
-sub increment_coves_base_ct
-{
- my $self = shift;
- if (@_) { $self->{coves_base_ct} += shift; }
- else { $self->{coves_base_ct} += 1;}
-}
-
-sub total_secpass_ct
-{
- my $self = shift;
- if (@_) { $self->{total_secpass_ct} = shift; }
- return $self->{total_secpass_ct};
-}
-
-sub increment_total_secpass_ct
-{
- my $self = shift;
- if (@_) { $self->{total_secpass_ct} += shift; }
- else { $self->{total_secpass_ct} += 1;}
-}
-
-sub open_file {
- my $self = shift;
-
- my $success = 0;
-
- if ($self->{file_name} ne "") {
- &open_for_append(\$self->{FILE_H}, $self->{file_name});
- $success = 1;
- }
- else {
- die "Statistics file name is not set.\n"
- }
-
- return $success;
-}
-
-sub close_file {
- my $self = shift;
-
- if (defined $self->{FILE_H}) {
- close($self->{FILE_H});
- }
-}
-
-sub write_line {
- my $self = shift;
- my $line = shift;
-
- my $fh = $self->{FILE_H};
-
- print $fh $line . "\n";
-}
-
-sub save_firstpass_stats {
-
- my $self = shift;
- my $fh = $self->{FILE_H};
-
- print $fh "First-pass (tRNAscan/EufindtRNA) Stats:\n",
- "---------------\n";
- print $fh "Sequences read: $self->{numscanned}\n";
- print $fh "Seqs w/at least 1 hit: $self->{seqs_hit}\n";
- print $fh "Bases read: $self->{first_pass_base_ct} (x2 for both strands)\n";
- print $fh "Bases in tRNAs: $self->{fpass_trna_base_ct}\n";
- print $fh "tRNAs predicted: $self->{trnatotal}\n";
- printf $fh "Av. tRNA length: %d\n",
- int($self->{fpass_trna_base_ct} / &max(1, $self->{trnatotal}));
- printf $fh "Script CPU time: %.2f s\n",
- $self->{fp_end_time}->[0] - $self->{fp_start_time}->[0];
- printf $fh "Scan CPU time: %.2f s\n",
- $self->{fp_end_time}->[1] - $self->{fp_start_time}->[1];
- printf $fh "Scan speed: %.1f Kbp/sec\n", $self->{first_pass_base_ct}*2/
- (&max(0.001, $self->{fp_end_time}->[1] - $self->{fp_start_time}->[1]))/1000;
- print $fh "\nFirst pass search(es) ended: ",`date`,"\n";
-}
-
-sub save_final_stats {
-
- my $self = shift;
- my $opts = shift;
- my $gc = shift;
- my $r_prescan_tRNAs = shift;
- my $r_tab_results = shift;
- my $fh = $self->{FILE_H};
- my $second_pass_label = $opts->second_pass_label();
-
- if ($opts->CM_mode() ne "") {
- print $fh "$second_pass_label Stats:\n-----------\n";
-
- if ($opts->tscan_mode() || $opts->eufind_mode()) {
- print $fh "Candidate tRNAs read: ", scalar(@$r_prescan_tRNAs),"\n";
- }
- else {
- print $fh "Sequences read: $self->{numscanned}\n";
- }
- print $fh "$second_pass_label","-confirmed tRNAs: $self->{total_secpass_ct}\n";
- print $fh "Bases scanned by $second_pass_label: $self->{secpass_base_ct}\n";
- printf $fh "%% seq scanned by $second_pass_label: %2.1f %%\n",
- &min(($self->{secpass_base_ct} / &max(1, $self->{first_pass_base_ct} * 2)) * 100,100);
- printf $fh "Script CPU time: %2.2f s\n", $self->{sp_end_time}->[0] - $self->{fp_end_time}->[0];
- printf $fh "$second_pass_label CPU time: %2.2f s\n", $self->{sp_end_time}->[1] - $self->{fp_end_time}->[1];
- printf $fh "Scan speed: %.1f bp/sec\n", $self->{secpass_base_ct}/
- &max(0.001, $self->{sp_end_time}->[1] - $self->{fp_end_time}->[1]);
- print $fh "\n$second_pass_label analysis of tRNAs ended: ",`date`,"\n";
- if ($opts->tscan_mode() || $opts->eufind_mode()) {
- print $fh "Summary\n--------\n";
- }
- }
- my $total_time = ($self->{sp_end_time}->[0] - $self->{fp_start_time}->[0]) +
- ($self->{sp_end_time}->[1] - $self->{fp_start_time}->[1]);
- printf $fh "Overall scan speed: %.1f bp/sec\n",
- &max($self->{first_pass_base_ct} * 2, $self->{secpass_base_ct}) / &max(0.001, $total_time);
-
- $self->output_summary($opts, $gc, $r_tab_results);
-}
-
-sub output_summary {
-
- my $self = shift;
- my $opts = shift;
- my $gc = shift;
- my $r_tab_results = shift;
- my $fh = $self->{FILE_H};
-
- my ($trna_ct, $selcys_ct, $stop_sup_ct, $undet_ct, $pseudo_ct,
- $total, $intron_ct, $line);
- my (%iso_AR, %ac_AR, %intron_ac_AR);
- my ($iso, $ac, $acset, $iso_count, $istart, $aa);
-
-
- $trna_ct = 0;
- $selcys_ct = 0;
- $pseudo_ct = 0;
- $undet_ct = 0;
- $intron_ct = 0;
- $stop_sup_ct = 0;
- $total = 0;
-
- $line = shift(@$r_tab_results);
-
- while ($line ne '') {
-
- if ($line =~ /^(\S+)\s+(\d+)\s+(\d+)\s+(\d+)\s+(\S+)\s+(\S+)\s+([0-9\,]+)\s+([0-9\,]+)\s+(\S+)/) {
- $iso = $5;
- $ac = $6;
- $istart = $7;
-
- if ($iso eq $gc->undef_isotype()) {
- $undet_ct++;
- }
-
- elsif ($iso =~ /Pseudo/) {
- $pseudo_ct++;
- $iso_AR{"Pseudo"}++;
- }
- elsif ($iso =~ /SeC/) {
- $selcys_ct++;
- $iso_AR{"SelCys"}++;
- $ac_AR{$ac}++;
- }
- elsif ($iso eq "Sup") {
- $iso_AR{"Supres"}++;
- $stop_sup_ct++;
- $ac_AR{$ac}++;
- }
-
- else {
- $trna_ct++;
- $iso_AR{$iso}++;
- $ac_AR{$ac}++;
- }
-
- if ($istart ne "0") {
- my @introns = split(/\,/, $istart);
- $intron_ct += scalar(@introns);
- $intron_ac_AR{$ac} += scalar(@introns);
- }
-
- }
- $line = shift(@$r_tab_results);
-
- }
-
- $total = $trna_ct + $selcys_ct + $pseudo_ct + $undet_ct + $stop_sup_ct;
-
-
- print $fh "\n",
- "tRNAs decoding Standard 20 AA: $trna_ct\n",
- "Selenocysteine tRNAs (TCA): $selcys_ct\n",
- "Possible suppressor tRNAs (CTA,TTA): $stop_sup_ct\n",
- "tRNAs with undetermined/unknown isotypes: $undet_ct\n",
- "Predicted pseudogenes: $pseudo_ct\n",
- " -------\n",
- "Total tRNAs: $total\n\n",
-
- "tRNAs with introns: \t$intron_ct\n\n";
-
- foreach $aa (@{$gc->isotypes()}) {
- foreach $acset ($gc->ac_list()->{$aa}) {
- foreach $ac (@$acset) {
- if (defined($intron_ac_AR{$ac})) {
- print $fh "| $aa-$ac: $intron_ac_AR{$ac} ";
- }
- }
- }
- }
- print $fh "|\n\n";
- print $fh "Isotype / Anticodon Counts:\n\n";
-
- foreach $aa (@{$gc->isotypes()}) {
-
- $iso_count = $iso_AR{$aa} + 0;
- printf $fh ("%-6s: %d\t", $aa, $iso_count);
-
- foreach $acset ($gc->ac_list()->{$aa}) {
- foreach $ac (@$acset) {
- if ($ac eq " ") {
- print $fh " ";
- }
- else {
- printf $fh ("%5s: %-6s",$ac,$ac_AR{$ac});
- }
- }
- }
-
- print $fh "\n";
-
- }
- print $fh "\n";
-}
-
-1;
diff --git a/tRNAscanSE/Tscan.pm b/tRNAscanSE/Tscan.pm
deleted file mode 100644
index 7e97908..0000000
--- a/tRNAscanSE/Tscan.pm
+++ /dev/null
@@ -1,393 +0,0 @@
-# tRNAscanSE/Tscan.pm
-# This class contains parameters and functions for running tRNAscan used in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-# --------------------------------------------------------------
-#
-
-package tRNAscanSE::Tscan;
-
-use strict;
-use tRNAscanSE::Utils;
-
-
-sub new {
- my $class = shift;
- my $self = {};
-
- initialize($self);
-
- bless ($self, $class);
- return $self;
-}
-
-sub DESTROY
-{
- my $self = shift;
-}
-
-sub initialize
-{
- my $self = shift;
-
- # set to non-zero if you do NOT want redundant, overlapping hits
- # found by tRNAscan merged into one hit
- $self->{keep_tscan_repeats} = 0;
-
- $self->{tscan_params} = "-s"; # parameter set to be used for tRNAscan
- # default is "-s" strict params
- # default for prokaryotes should be relaxed
- # params "-r"
-
- $self->{tscan_version} = 1.4; # version of tRNAscan used by tRNAscan-SE
-
- $self->{tscan_bin} = "trnascan-1.4";
-
- $self->{tscan_mask} = 1; # Bit-wise masks for source of tRNA hits
-}
-
-sub keep_tscan_repeats
-{
- my $self = shift;
- if (@_) { $self->{keep_tscan_repeats} = shift; }
- return $self->{keep_tscan_repeats};
-}
-
-sub tscan_params
-{
- my $self = shift;
- if (@_) { $self->{tscan_params} = shift; }
- return $self->{tscan_params};
-}
-
-sub tscan_version
-{
- my $self = shift;
- if (@_) { $self->{tscan_version} = shift; }
- return $self->{tscan_version};
-}
-
-sub tscan_bin
-{
- my $self = shift;
- if (@_) { $self->{tscan_bin} = shift; }
- return $self->{tscan_bin};
-}
-
-sub tscan_mask
-{
- my $self = shift;
- return $self->{tscan_mask};
-}
-
-sub set_bin {
-
- my $self = shift;
- my $bindir = shift;
-
- # choose correct name for version being run
- # only version 1.4 is provided with distribution
-
- if ($self->{tscan_version} == 1.4) {
- $self->{tscan_bin} = "trnascan-1.4";
- }
- elsif ($self->{tscan_version} == 1.39) {
- $self->{tscan_bin} = "trnascan-1.39";
- }
- elsif ($self->{tscan_version} == 2) {
- $self->{tscan_bin} = "TRNAscan";
- }
- elsif ($self->{tscan_version} == 1.3) {
- $self->{tscan_bin} = "trnascan-1.3";
- }
- else {
- die "FATAL: Illegal tRNAscan version.\n\n";
- }
-
- if ($^O =~ /^MSWin/) {
- $self->{tscan_bin} .= ".exe";
- }
-
- if (!(-x $self->{tscan_bin})) {
- $self->{tscan_bin} = $bindir.$self->{tscan_bin};
- if (!(-x $self->{tscan_bin})) {
- die "FATAL: Unable to find ".$self->{tscan_bin}." executable\n\n";
- }
- }
-}
-
-sub run_tRNAscan {
-
- my $self = shift;
- my ($tmp_fa, $tmp_raw, $start_index, $lib_dir, $seq_name) = @_;
- my $tscan_version = $self->{tscan_version};
- my $tscan_bin = $self->{tscan_bin};
- my $tscan_params = $self->{tscan_params};
-
- # version provided with distribution
-
- if ($tscan_version == 1.4) {
- # run default tRNAscan 1.4 using selected param set
- system ("$tscan_bin -i $start_index -c $tscan_params $tmp_fa > $tmp_raw");
- if (&error_exit_status("tRNAscan", $seq_name)) {
- return -1;
- }
- }
-
- # run tRNAscan without conservative ambiguous base pairing rules
- # not available in distribution version
-
- elsif ($tscan_version == 1.39) {
- system ("$tscan_bin -c $tscan_params $tmp_fa > $tmp_raw");
- }
-
- # run tRNAscan v2.0, not available in distribution version
-
- elsif ($tscan_version == 2) {
- system ("$tscan_bin -SEQ $tmp_fa -TEMPLATE SEtemplate -OUTPUT $tmp_raw > /dev/null");
- }
-
- # run original tRNAscan 1.3, not available in distribution version
-
- elsif ($tscan_version == 1.3) {
- if (!(-r "./TPCsignal")) {
- system ("ln -s ".$lib_dir."TPCsignal TPCsignal");
- }
- if (!(-r "./Dsignal")) {
- system ("ln -s ".$lib_dir."Dsignal Dsignal");
- }
- system ("reformat -ld genbank $tmp_fa > tmp.gb");
- system ("$tscan_bin tmp.gb $tmp_raw > /dev/null");
- system ("rm tmp.gb");
- }
- else {
- die "FATAL: Illegal tRNAscan version.\n\n";
- }
-}
-
-
-# Append tRNAscan verbose output to
-# result file with header tag
-
-sub append_verbfile {
-
- my $self = shift;
- my ($verb_file, $tmp_fa, $seq_name) = @_;
-
- &open_for_append(\*TSCANVERB, $verb_file);
- print TSCANVERB "\n>>>> tRNA-Scan verbose output for <$seq_name>\n\n";
- close TSCANVERB;
- system ("cat tscan.verb.out >> $verb_file");
-}
-
-# extract trna hits from raw result file while weeding out repeated hits
-# save non-redundant hits in "hit_list" array
-
-sub process_tRNAscan_hits {
-
- my $self = shift;
- my $constants = shift;
- my $gc = shift;
- my $stats = shift;
- my $seq_name = shift;
- my $r_hit_list = shift;
- my $tmp_raw = $constants->tmp_raw();
-
- my ($istart, $iend, $from, $to, $intron, $trnact, $len, $score,
- $anticodon, $iso_type, $sense_strand, $pos, $i);
-
- $trnact = 0; # trna count for this sequence
- $istart = 0; $iend = 0; # intron bounds
- $from = 0; $to = 0; # tRNA bounds
- $len = 0; # tRNA length
- $intron = 0; # intron present? flag
- $anticodon = '';
- $iso_type = '';
- $score = 0;
-
- # open trnascan raw output file for current seq
-
- open (TSCANRAW, "$tmp_raw") ||
- die ("FATAL: Unable to open temp raw output file $tmp_raw\n\n");
-
- # parse one complete hit per call
- while ($self->parse_tscan_hit($constants, $gc, \*TSCANRAW, \$from, \$to, \$sense_strand,
- \$istart, \$iend, \$intron, \$len, \$iso_type,
- \$anticodon, \$pos)) {
-
- if ($self->{keep_tscan_repeats} ||
- (!$self->merge_repeat_hit($stats, $r_hit_list, \$trnact, $from, $to,
- $sense_strand, $iso_type,$score)))
-
- # if NOT a repeat hit, put it on the hit list
- {
- # check to see if tscan 1.3 has incorrectly reported
- # start/end index (happens occassionally)
-
- if ((abs($to - $from) + 1) != $len) {
- if ($sense_strand) {
- $to = $from + $len - 1; }
- else {
- $to = $from - $len + 1; }
- }
-
- $i=0;
- while (($i < scalar(@$r_hit_list)) && ($r_hit_list->[$i]{position} < $pos)) {
- $i++;
- }
-
- # save non-redundant hit
- splice(@$r_hit_list, $i ,0, {
- seqname => $seq_name,
- start => $from, end => $to,
- type => $iso_type, acodon => $anticodon,
- istart => $istart, iend => $iend,
- sen_strand => $sense_strand,
- position => $pos, score => 0,
- source => $self->{tscan_mask},
- });
-
- $trnact++;
- $stats->increment_trnatotal();
-
- }
-
- } # while (&Parse_tscan_hit), more hits to process for cur seq
-}
-
-sub parse_tscan_hit {
-
- my $self = shift;
- my $constants = shift;
- my $gc = shift;
- my ($TSCANRAW, $r_from, $r_to, $r_sense_strand,
- $r_istart, $r_iend, $r_intron, $r_len, $r_type, $r_anticodon, $r_pos) = @_;
-
- my ($trna_seq) = '';
-
- # clear intron info parsing each hit
- $$r_istart = 0; $$r_iend = 0; $$r_intron = 0;
-
- if ($self->{tscan_version} <= 1.4) {
-
- while (<$TSCANRAW>) {
- if (/^start position=\s*(\d+)\s*end position=\s*(\d+)/o)
- {
- $$r_from = $1;
- $$r_to = $2;
- if ($$r_from < $$r_to) {
- $$r_sense_strand = 1;
- $$r_pos = $$r_from }
- else {
- $$r_sense_strand = 0;
- $$r_pos = $constants->REALLY_BIG_NUMBER() - $$r_from + 1;
- }
- }
-
- elsif (/^potential tRNA sequence=\s(.+)\n/o) {
- $trna_seq = $1; $$r_len = length($trna_seq);
- }
- elsif (/^tRNA predict as a tRNA-\s*(\S+)\s*: anticodon (\S+)/o) {
- $$r_type = $1;
- $$r_anticodon = $2;
- }
- elsif (/^anticodon includes unknown bases/o) {
- $$r_type = $gc->undef_isotype();
- $$r_anticodon = $gc->undef_anticodon();
- }
- elsif (/^potential intron between positions\s*(\d+)\s*(\d+)/o) {
- $$r_istart = $1;
- $$r_iend = $2;
- $$r_intron = 1;
- }
- # flag for end of current tRNA hit info
- elsif (/^number of base pairing in the anticodon/o) {
- return 1;
- }
- elsif (/^number of predicted tRNA=(\d+)/o) {
- return 0; # end of hits for this seq
- }
- }
- return 0; # reached end of raw hits file
- }
-
- else {
- die "FATAL: Illegal tRNAscan version selected.\n\n";
- }
-}
-
-# check current hit for redundancy against all previous hits in hitlist
-#
-# if it IS a repeat, merge it with overlapping hit and return 1
-# if it doesn't overlap with any hits, return 0
-
-sub merge_repeat_hit {
-
- my $self = shift;
- my $stats = shift;
- my ($r_hit_list, $r_trnact, $from, $to, $sense_strand, $iso_type, $score) = @_;
- my ($i);
-
- foreach $i (0..(scalar(@$r_hit_list) - 1)) {
-
- if ($sense_strand) {
- if (($r_hit_list->[$i]{sen_strand} == 1) &&
- (&seg_overlap($from, $to, $r_hit_list->[$i]{start},
- $r_hit_list->[$i]{end})))
- {
- $r_hit_list->[$i]{start} = &min($from, $r_hit_list->[$i]{start});
- $r_hit_list->[$i]{end} = &max($to, $r_hit_list->[$i]{end});
- $r_hit_list->[$i]{source} = $r_hit_list->[$i]{source} | $self->{tscan_mask};
- $r_hit_list->[$i]{type} = $iso_type;
- $r_hit_list->[$i]{score} = $score;
-
- # check to see if extended endpoint overlaps
- # i+1 hit's start boundary
- # if so, combine hit[i] and hit[i+1] into one
- # hit and delete hit[i+1]
- if (($i != (scalar(@$r_hit_list) - 1)) && ($r_hit_list->[$i+1]{sen_strand})
- && ($r_hit_list->[$i]{end} >= $r_hit_list->[$i+1]{start}))
- {
- $r_hit_list->[$i]{end} = &max($r_hit_list->[$i]{end}, $r_hit_list->[$i+1]{end});
- $r_hit_list->[$i]{source} = $r_hit_list->[$i]{source} | $r_hit_list->[$i+1]{source};
-
- splice(@$r_hit_list,$i+1,1); # toss out overlapping hit
- $$r_trnact--;
- $stats->decrement_trnatotal();
- }
- return 1; # exit loop immediately
- }
- }
- else # else (antisense) strand
- {
- if (($r_hit_list->[$i]{sen_strand} == 0) &&
- (&seg_overlap($to, $from, $r_hit_list->[$i]{end}, $r_hit_list->[$i]{start})))
- {
- $r_hit_list->[$i]{start} = &max($from, $r_hit_list->[$i]{start});
- $r_hit_list->[$i]{end} = &min($to, $r_hit_list->[$i]{end});
- $r_hit_list->[$i]{source} = $r_hit_list->[$i]{source} | $self->{tscan_mask};
- $r_hit_list->[$i]{type} = $iso_type;
- $r_hit_list->[$i]{score} = $score;
-
- if (($i != (scalar(@$r_hit_list) - 1)) &&
- ($r_hit_list->[$i]{end} <= $r_hit_list->[$i+1]{start}))
- {
- $r_hit_list->[$i]{end} = &min($r_hit_list->[$i]{end}, $r_hit_list->[$i+1]{end});
- $r_hit_list->[$i]{source} = $r_hit_list->[$i]{source} | $r_hit_list->[$i+1]{source};
-
- splice(@$r_hit_list,$i+1,1); # toss out overlapping hit
- $$r_trnact--;
- $stats->decrement_trnatotal();
- }
- return 1; # exit loop immediately
- }
- } # else (antisense) strand
-
- } # for each (hit)
-
- return 0; # current hit is not a repeat
-}
-
-1;
\ No newline at end of file
diff --git a/tRNAscanSE/Utils.pm b/tRNAscanSE/Utils.pm
deleted file mode 100644
index d58aa35..0000000
--- a/tRNAscanSE/Utils.pm
+++ /dev/null
@@ -1,175 +0,0 @@
-# tRNAscanSE/Utils.pm
-# This module contains utility functions used in tRNAscan-SE.
-#
-# --------------------------------------------------------------
-# This module is part of the tRNAscan-SE program.
-# Copyright (C) 2011 Patricia Chan and Todd Lowe
-# --------------------------------------------------------------
-#
-
-package tRNAscanSE::Utils;
-use strict;
-
-require Exporter;
-our @ISA = qw(Exporter);
-our @EXPORT = qw(check_output_file open_for_read open_for_write open_for_append tempname
- print_filename rev_comp_seq max min seg_overlap error_exit_status trim);
-
-our %comp_map = ( # Complement map
- 'A' => 'T', 'T' => 'A', 'U' => 'A',
- 'G' => 'C', 'C' => 'G',
- 'Y' => 'R', 'R' => 'Y',
- 'S' => 'W', 'W' => 'S',
- 'M' => 'K', 'K' => 'M',
- 'B' => 'V', 'V' => 'B',
- 'H' => 'D', 'D' => 'H',
- 'N' => 'N', 'X' => 'X',
- '?' => '?');
-
-sub check_output_file {
- my ($fname, $prompt_for_overwrite) = @_;
- my ($ans, $ansline);
-
- if ((-e $fname) && ($prompt_for_overwrite)) {
- print STDERR "\nWARNING: $fname exists already.\n\n",
- " (O)verwrite file, (A)ppend to file, or (Q)uit program? ";
- $ansline = <STDIN>;
- $ans = substr($ansline, 0, 1);
- while ($ans !~ /[AOQaoq]/) {
- print STDERR "\nReply (O)verwrite (A)ppend, or (Q)uit [O/A/Q]: ";
- $ansline = <STDIN>;
- $ans = substr($ansline, 0, 1);
- }
- if (uc($ans) eq 'Q') {
- die "\ntRNAscan-SE aborted.\n\n";
- }
- elsif (uc($ans) eq 'A') {
- print STDERR "\n Appending to $fname...\n";
- open(FHAND,">>$fname") ||
- die "Unable to open $fname for appending. ",
- "Aborting program.\n";
- close(FHAND);
- return; # successful exit status
- }
- else { # $ans eq 'O'verwrote
- print STDERR "\n Overwriting $fname...\n";
- }
- }
- open(FHAND, ">$fname") ||
- die "Unable to open $fname for writing. Aborting program.\n";
- close(FHAND);
-}
-
-sub open_for_read {
- my ($FHAND, $fname) = @_;
-
- open($$FHAND, "$fname") ||
- die "Unable to open $fname for reading. Aborting program.\n";
-}
-
-sub open_for_write {
- my ($FHAND, $fname) = @_;
-
- open($$FHAND, ">$fname") ||
- die "Unable to open $fname for writing. Aborting program.\n";
-}
-
-sub open_for_append {
- my ($FHAND, $fname) = @_;
-
- open ($$FHAND, ">>$fname") ||
- die "FATAL: Unable to open output file ",
- &print_filename($fname), "\n\n";
-}
-
-# Function: tempname
-# by SE, modification by TMJL
-# Returns a unique temporary filename.
-#
-# Normally puts temp files to /tmp. This directory can
-# be overridden by an environment variable TMPDIR.
-#
-
-sub tempname {
- my ($temp_dir, $exten) = @_;
- my ($name);
-
- $name = "$temp_dir/tscan$$"."$exten";
- return $name;
-}
-
-sub print_filename {
- my ($fname) = @_;
- if ($fname eq "-") {
- $fname = "Standard output";
- }
- return $fname;
-}
-
-sub rev_comp_seq {
- my ($seq) = @_;
- my ($seqlen) = length($seq);
- my ($i, $j, $rcseq);
-
- $rcseq = 'X' x $seqlen; # pre-extending string for efficiency
- for ($i = ($seqlen - 1), $j = 0; $i > -1; $i--, $j++) {
- substr($rcseq, $j, 1) = $comp_map{(substr($seq, $i, 1))};
- }
- return $rcseq;
-}
-
-sub min {
- my ($a, $b) = @_;
- if ($a < $b) {
- return ($a); }
- else {
- return ($b);
- }
-}
-
-sub max {
- my ($a, $b) = @_;
- if ($a > $b) {
- return ($a);
- }
- else {
- return ($b);
- }
-}
-
-sub seg_overlap {
- my ($seg1_a, $seg1_b, $seg2_a, $seg2_b) = @_;
-
- if ((($seg1_a >= $seg2_a) && ($seg1_a <= $seg2_b)) ||
- (($seg1_b >= $seg2_a) && ($seg1_b <= $seg2_b)) ||
- (($seg2_a >= $seg1_a) && ($seg2_a <= $seg1_b)) ||
- (($seg2_b >= $seg1_a) && ($seg2_b <= $seg1_b))) {
- return 1;
- }
- else {
- return 0;
- }
-}
-
-sub error_exit_status {
- my ($prog_name, $seq_name) = @_;
-
- if ($? != 0) {
- print STDERR "$prog_name could not complete successfully for $seq_name.\n",
- "Possible memory allocation problem or missing file. (Exit code=",$?,").\n\n";
- return 1;
- }
- else {
- return 0;
- }
-}
-
-sub trim
-{
- my $string = shift;
- $string =~ s/^\s+//;
- $string =~ s/\s+$//;
- return $string;
-}
-
-1;
diff --git a/testrun.ref b/testrun.ref
index 41d07a3..453a18d 100644
--- a/testrun.ref
+++ b/testrun.ref
@@ -1,8 +1,8 @@
-Sequence tRNA Bounds tRNA Anti Intron Bounds Cove Hit
-Name tRNA # Begin End Type Codon Begin End Score Origin
--------- ------ ---- ------ ---- ----- ----- ---- ------ ------
-CELF22B7 1 12619 12738 Leu CAA 12657 12692 60.01 Bo
-CELF22B7 2 19480 19561 Ser AGA 0 0 80.44 Bo
-CELF22B7 3 26367 26439 Phe GAA 0 0 80.32 Bo
-CELF22B7 4 26992 26920 Phe GAA 0 0 80.32 Bo
-CELF22B7 5 23765 23694 Pro CGG 0 0 75.76 Bo
+Sequence tRNA Bounds tRNA Anti Intron Bounds Cove
+Name tRNA # Begin End Type Codon Begin End Score
+-------- ------ ---- ------ ---- ----- ----- ---- ------
+CELF22B7 1 12619 12738 Leu CAA 12657 12692 60.01 Bo
+CELF22B7 2 19480 19561 Ser AGA 0 0 80.44 Bo
+CELF22B7 3 26367 26439 Phe GAA 0 0 80.32 Bo
+CELF22B7 4 26992 26920 Phe GAA 0 0 80.32 Bo
+CELF22B7 5 23765 23694 Pro CGG 0 0 75.76 Bo
diff --git a/trnascan.c b/trnascan.c
index 7aa6df3..1f6f4fb 100644
--- a/trnascan.c
+++ b/trnascan.c
@@ -819,9 +819,9 @@ while (!feof(fpi)) {
}
fprintf(fpo,"number of sequences= %d\n", nseq);
-fprintf(fpo,"number of bases tested (one strand)=%ld\n", lseq);
+fprintf(fpo,"number of bases tested (one strand)=%d\n", lseq);
lseq = 2* lseq;
-fprintf(fpo,"number of bases tested (both strands)= %ld\n", lseq);
+fprintf(fpo,"number of bases tested (both strands)= %d\n", lseq);
fprintf(fpo,"number of predicted tRNA=%d\n", npred);
exit(0);
}
@@ -1149,7 +1149,6 @@ lectval(FILE *fp, /* pointer to the consensus matrix file */
{
int i=0,j, k=0,l,m;
float max=0;
-int ret = 0;
for (l=0; l< 30; l++)
for (m=0; m<4; m++)
@@ -1163,7 +1162,7 @@ while(feof(fp) == 0)
{
for(j=0;j<4;j++)
{
- ret = fscanf(fp,"%f",&table_cons[i][j]);
+ fscanf(fp,"%f",&table_cons[i][j]);
}
i++;
}
@@ -1205,7 +1204,6 @@ int fgetseq(char *name, /* string w/name of the sequence */
char line[MAXLINE]; /* character string used to read a line */
char *ptr; /* pointer to the sequence */
long int i,j,c;
-char *ptrRet;
line[0]='\0';
*sequence='\0';
@@ -1224,10 +1222,10 @@ else if (line[0] == ';') {
if (line[1] != ' ')
{
for (i=0, ptr= &(line[1]); *ptr != ' ' && *ptr !='\n';i++)
- name[i]= *ptr++;
+ name[i]= *ptr++;
name[i] = '\0';
while ((c = getc(fpi)) == ';')
- ptrRet = fgets(line, MAXLINE, fpi);
+ fgets(line, MAXLINE, fpi);
ungetc(c, fpi);
ptr = sequence;
@@ -1247,11 +1245,11 @@ else if (line[0] == ';') {
/* Intelligenetics format */
while ((c = getc(fpi)) == ';')
- ptrRet = fgets(line,MAXLINE, fpi);
+ fgets(line,MAXLINE, fpi);
ungetc(c, fpi);
fgets(line, MAXLINE, fpi);
for (i=0, ptr= &(line[0]); *ptr != ' ' && *ptr !='\n';i++)
- name[i]= *ptr++;
+ name[i]= *ptr++;
name[i] = '\0';
ptr = sequence;
@@ -1308,14 +1306,14 @@ else
ptr = sequence;
*seqlen=0;
- ptrRet = fgets(line, MAXLINE, fpi);
+ fgets(line, MAXLINE, fpi);
while (strncmp(line, "//", 2) != 0) {
for (i = 0; line[i] != '\n'; i++)
if (isalpha(line[i])) {
*ptr++ = tolower(line[i]);
(*seqlen)++;
}
- ptrRet = fgets(line, MAXLINE, fpi);
+ fgets(line, MAXLINE, fpi);
}
*ptr = '\0';
@@ -1332,7 +1330,6 @@ int getseqsize(FILE *fpi /* input file pointer */
char line[MAXLINE]; /* character string used to read a line */
long int i,c, seqlen, fpi_save_pos;
-char* ptrRet;
line[0]='\0';
seqlen = 0;
@@ -1352,7 +1349,7 @@ else if (line[0] == ';') {
if (line[1] != ' ')
{
while ((c = getc(fpi)) == ';')
- ptrRet = fgets(line, MAXLINE, fpi);
+ fgets(line, MAXLINE, fpi);
ungetc(c, fpi);
while ((c= getc(fpi)) != ';' && c != EOF)
@@ -1366,9 +1363,9 @@ else if (line[0] == ';') {
/* Intelligenetics format */
while ((c = getc(fpi)) == ';')
- ptrRet = fgets(line,MAXLINE, fpi);
+ fgets(line,MAXLINE, fpi);
ungetc(c, fpi);
- ptrRet = fgets(line, MAXLINE, fpi);
+ fgets(line, MAXLINE, fpi);
while ((c= getc(fpi)) != ';' && c != EOF)
if (isalpha(c)){
@@ -1396,13 +1393,13 @@ else
if (fgets(line, MAXLINE, fpi) == NULL)
exit(1);
- ptrRet = fgets(line, MAXLINE, fpi);
+ fgets(line, MAXLINE, fpi);
while (strncmp(line, "//", 2) != 0) {
for (i = 0; line[i] != '\n'; i++)
if (isalpha(line[i])) {
seqlen++;
}
- ptrRet = fgets(line, MAXLINE, fpi);
+ fgets(line, MAXLINE, fpi);
}
}
@@ -1898,27 +1895,27 @@ if ((nloop) == 0)
if((*ntrna) == 1)
fprintf(fpo,"sequence name= %s\n", name);
- fprintf(fpo,"start position= %ld end position= %ld\n",pos1-7+sqoffset,pos1-6+lpair1+sqoffset);
+ fprintf(fpo,"start position= %d end position= %d\n",pos1-7+sqoffset,pos1-6+lpair1+sqoffset);
fprintf(fpo,"potential tRNA sequence= %s\n",chaine2);
- fprintf(fpo,"D signal= %ld %ld TpsyC signal= %ld %ld\n", pos1+sqoffset,pos1+7+sqoffset, pos+sqoffset,
+ fprintf(fpo,"D signal= %d %d TpsyC signal= %d %d\n", pos1+sqoffset,pos1+7+sqoffset, pos+sqoffset,
pos+14+sqoffset);
- fprintf(fpo,"amino-acyl stem= %ld-%ld;%ld-%ld\n",pos1-7+sqoffset,pos1-1+sqoffset,pos1-13+lpair1+sqoffset,
+ fprintf(fpo,"amino-acyl stem= %d-%d;%d-%d\n",pos1-7+sqoffset,pos1-1+sqoffset,pos1-13+lpair1+sqoffset,
pos1-7+lpair1+sqoffset);
- fprintf(fpo,"D stem= %ld-%ld;%ld-%ld\n",pos1+2+sqoffset,pos1+4+sqoffset,pos1+lpair+sqoffset,
+ fprintf(fpo,"D stem= %d-%d;%d-%d\n",pos1+2+sqoffset,pos1+4+sqoffset,pos1+lpair+sqoffset,
pos1+lpair+2+sqoffset);
if(lpair2 > 16)
{
- fprintf(fpo,"anticodon stem= %ld-%ld;%ld-%ld\n",pos1+lpair+4+sqoffset,pos1+lpair+8+sqoffset,
+ fprintf(fpo,"anticodon stem= %d-%d;%d-%d\n",pos1+lpair+4+sqoffset,pos1+lpair+8+sqoffset,
pos1+lpair+lpair2+sqoffset,pos1+lpair+lpair2+4+sqoffset);
}
else
{
- fprintf(fpo,"anticodon stem= %ld-%ld;%ld-%ld\n",pos1+lpair+4+sqoffset,pos1+lpair+8+sqoffset,
+ fprintf(fpo,"anticodon stem= %d-%d;%d-%d\n",pos1+lpair+4+sqoffset,pos1+lpair+8+sqoffset,
pos1+lpair+16+sqoffset,pos1+lpair+20+sqoffset);
}
- fprintf(fpo,"TpsyC stem= %ld-%ld;%ld-%ld\n",pos+1+sqoffset,pos+5+sqoffset,pos+13+sqoffset,pos+17+sqoffset);
+ fprintf(fpo,"TpsyC stem= %d-%d;%d-%d\n",pos+1+sqoffset,pos+5+sqoffset,pos+13+sqoffset,pos+17+sqoffset);
if (strcmp(type_trna,"Ind") != 0)
{
fprintf(fpo,"tRNA predict as a tRNA- %s : anticodon %s\n", type_trna,
@@ -1933,7 +1930,7 @@ if ((nloop) == 0)
{
posstart=pos1+lpair+15;
posend= pos1+lpair+lpair2-2;
- fprintf(fpo,"potential intron between positions %ld %ld\n",posstart+sqoffset,
+ fprintf(fpo,"potential intron between positions %d %d\n",posstart+sqoffset,
posend+sqoffset);
}
fprintf(fpo,"number of base pairing in the anticodon stem= %d\n",ncomp);
@@ -1964,31 +1961,31 @@ else
}
pos2= length-pos1+8;
- fprintf(fpo,"start position= %ld end position= %ld\n",pos2+sqoffset,pos2-lpair1-1+sqoffset);
+ fprintf(fpo,"start position= %d end position= %d\n",pos2+sqoffset,pos2-lpair1-1+sqoffset);
fprintf(fpo,"potential tRNA sequence= %s\n",chaine2);
- fprintf(fpo,"D signal= %ld %ld TpsyC signal= %ld %ld\n",length-pos1+1+sqoffset,
+ fprintf(fpo,"D signal= %d %d TpsyC signal= %d %d\n",length-pos1+1+sqoffset,
length-pos1-6+sqoffset,length-pos+1+sqoffset,length-pos-13+sqoffset);
- fprintf(fpo,"amino-acyl stem= %ld-%ld;%ld-%ld\n",pos2+sqoffset,pos2-6+sqoffset, pos2-lpair1+6+sqoffset,
+ fprintf(fpo,"amino-acyl stem= %d-%d;%d-%d\n",pos2+sqoffset,pos2-6+sqoffset, pos2-lpair1+6+sqoffset,
pos2-lpair1+sqoffset);
- fprintf(fpo,"D stem= %ld-%ld;%ld-%ld\n",length-pos1-1+sqoffset,length-pos1-3+sqoffset,
+ fprintf(fpo,"D stem= %d-%d;%d-%d\n",length-pos1-1+sqoffset,length-pos1-3+sqoffset,
length-pos1-lpair+1+sqoffset,length-pos1-lpair-1+sqoffset);
if (lpair2 > 16)
{
posstart=pos1+lpair+15;
posend=pos1+lpair+lpair2-2;
- fprintf(fpo,"anticodon stem= %ld-%ld;%ld-%ld\n",length-pos1-lpair-3+sqoffset,
+ fprintf(fpo,"anticodon stem= %d-%d;%d-%d\n",length-pos1-lpair-3+sqoffset,
length-pos1-lpair-7+sqoffset,length-posend-1+sqoffset,length-posend-5+sqoffset);
}
else
{
- fprintf(fpo,"anticodon stem= %ld-%ld;%ld-%ld\n",length-pos1-lpair-3+sqoffset,
+ fprintf(fpo,"anticodon stem= %d-%d;%d-%d\n",length-pos1-lpair-3+sqoffset,
length-pos1-lpair-7+sqoffset,length-pos1-lpair-lpair2+1+sqoffset,
length-pos1-lpair-lpair2-3+sqoffset);
}
- fprintf(fpo,"TpsyC stem= %ld-%ld;%ld-%ld\n",length-pos+sqoffset,length-pos-4+sqoffset,
+ fprintf(fpo,"TpsyC stem= %d-%d;%d-%d\n",length-pos+sqoffset,length-pos-4+sqoffset,
length-pos-12+sqoffset,length-pos-16+sqoffset);
if (strcmp(type_trna,"Ind") != 0)
@@ -2005,7 +2002,7 @@ else
{
posstart=pos1+lpair+15;
posend=pos1+lpair+lpair2-2;
- fprintf(fpo,"potential intron between positions %ld %ld\n",
+ fprintf(fpo,"potential intron between positions %d %d\n",
length-posstart+1+sqoffset ,length-posend+1+sqoffset);
}
--
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/trnascan-se.git
More information about the debian-med-commit
mailing list